m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00218)
Target Name Cytochrome P450 2C8 (CYP2C8)
Synonyms
CYPIIC8; Cytochrome P450 IIC2; Cytochrome P450 MP-12; Cytochrome P450 MP-20; Cytochrome P450 form 1; S-mephenytoin 4-hydroxylase
    Click to Show/Hide
Gene Name CYP2C8
Chromosomal Location 10q23.33
Family cytochrome P450 family
Function
A cytochrome P450 monooxygenase involved in the metabolism of various endogenous substrates, including fatty acids, steroid hormones and vitamins . Mechanistically, uses molecular oxygen inserting one oxygen atom into a substrate, and reducing the second into a water molecule, with two electrons provided by NADPH via cytochrome P450 reductase (NADPH--hemoprotein reductase). Primarily catalyzes the epoxidation of double bonds of polyunsaturated fatty acids (PUFA) with a preference for the last double bond. Catalyzes the hydroxylation of carbon-hydrogen bonds. Metabolizes all trans-retinoic acid toward its 4-hydroxylated form. Displays 16-alpha hydroxylase activity toward estrogen steroid hormones, 17beta-estradiol (E2) and estrone (E1). Plays a role in the oxidative metabolism of xenobiotics. It is the principal enzyme responsible for the metabolism of the anti-cancer drug paclitaxel (taxol).
    Click to Show/Hide
Gene ID 1558
Uniprot ID
CP2C8_HUMAN
HGNC ID
HGNC:2622
KEGG ID
hsa:1558
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
CYP2C8 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Methyltransferase-like 3 (METTL3) [WRITER]
 Regulator Info 
Representative RIP-seq result supporting the interaction between CYP2C8 and the regulator
Cell Line MDA-MB-231 Homo sapiens
Regulation logFC: 4.67E+00 GSE60213
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary In the Hepatocellular carcinoma cells YTHDC2 promotes CYP2C8 mRNA degradation via recognizing the m6A in CYP2C8 mRNA, which is installed by METTL3/14 and removed by FTO.
Target Regulation Up regulation
Responsed Disease Hepatocellular carcinoma ICD-11: 2C12.02
 Disease Info 
Pathway Response Drug metabolism - cytochrome P450 hsa00982
Cell Process Drug-metabolizing
In-vitro Model HepaRG Hepatitis C infection Homo sapiens CVCL_9720
Huh-7 Adult hepatocellular carcinoma Homo sapiens CVCL_0336
Fat mass and obesity-associated protein (FTO) [ERASER]
 Regulator Info 
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary In the Hepatocellular carcinoma cells YTHDC2 promotes CYP2C8 mRNA degradation via recognizing the m6A in CYP2C8 mRNA, which is installed by METTL3/14 and removed by FTO.
Target Regulation Down regulation
Responsed Disease Hepatocellular carcinoma ICD-11: 2C12.02
 Disease Info 
Pathway Response Drug metabolism - cytochrome P450 hsa00982
Cell Process Drug-metabolizing
In-vitro Model HepaRG Hepatitis C infection Homo sapiens CVCL_9720
Huh-7 Adult hepatocellular carcinoma Homo sapiens CVCL_0336
Methyltransferase-like 14 (METTL14) [WRITER]
 Regulator Info 
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary In the Hepatocellular carcinoma cells YTHDC2 promotes CYP2C8 mRNA degradation via recognizing the m6A in CYP2C8 mRNA, which is installed by METTL3/14 and removed by FTO.
Target Regulation Up regulation
Responsed Disease Hepatocellular carcinoma ICD-11: 2C12.02
 Disease Info 
Pathway Response Drug metabolism - cytochrome P450 hsa00982
Cell Process Drug-metabolizing
In-vitro Model HepaRG Hepatitis C infection Homo sapiens CVCL_9720
Huh-7 Adult hepatocellular carcinoma Homo sapiens CVCL_0336
YTH domain-containing protein 2 (YTHDC2) [READER]
 Regulator Info 
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary In the Hepatocellular carcinoma cells YTHDC2 promotes CYP2C8 mRNA degradation via recognizing the m6A in CYP2C8 mRNA, which is installed by METTL3/14 and removed by FTO.
Target Regulation Down regulation
Responsed Disease Hepatocellular carcinoma ICD-11: 2C12.02
 Disease Info 
Pathway Response Drug metabolism - cytochrome P450 hsa00982
Cell Process Drug-metabolizing
In-vitro Model HepaRG Hepatitis C infection Homo sapiens CVCL_9720
Huh-7 Adult hepatocellular carcinoma Homo sapiens CVCL_0336
Liver cancer [ICD-11: 2C12]
 Disease Info 
In total 3 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [1]
Response Summary In the Hepatocellular carcinoma cells YTHDC2 promotes CYP2C8 mRNA degradation via recognizing the m6A in CYP2C8 mRNA, which is installed by METTL3/14 and removed by FTO.
Responsed Disease Hepatocellular carcinoma [ICD-11: 2C12.02]
Target Regulator Fat mass and obesity-associated protein (FTO) ERASER
 Regulator Info 
Target Regulation Down regulation
Pathway Response Drug metabolism - cytochrome P450 hsa00982
Cell Process Drug-metabolizing
In-vitro Model HepaRG Hepatitis C infection Homo sapiens CVCL_9720
Huh-7 Adult hepatocellular carcinoma Homo sapiens CVCL_0336
Experiment 2 Reporting the m6A-centered Disease Response [1]
Response Summary In the Hepatocellular carcinoma cells YTHDC2 promotes CYP2C8 mRNA degradation via recognizing the m6A in CYP2C8 mRNA, which is installed by METTL3/14 and removed by FTO.
Responsed Disease Hepatocellular carcinoma [ICD-11: 2C12.02]
Target Regulator Methyltransferase-like 14 (METTL14) WRITER
 Regulator Info 
Target Regulation Up regulation
Pathway Response Drug metabolism - cytochrome P450 hsa00982
Cell Process Drug-metabolizing
In-vitro Model HepaRG Hepatitis C infection Homo sapiens CVCL_9720
Huh-7 Adult hepatocellular carcinoma Homo sapiens CVCL_0336
Experiment 3 Reporting the m6A-centered Disease Response [1]
Response Summary In the Hepatocellular carcinoma cells YTHDC2 promotes CYP2C8 mRNA degradation via recognizing the m6A in CYP2C8 mRNA, which is installed by METTL3/14 and removed by FTO.
Responsed Disease Hepatocellular carcinoma [ICD-11: 2C12.02]
Target Regulator YTH domain-containing protein 2 (YTHDC2) READER
 Regulator Info 
Target Regulation Down regulation
Pathway Response Drug metabolism - cytochrome P450 hsa00982
Cell Process Drug-metabolizing
In-vitro Model HepaRG Hepatitis C infection Homo sapiens CVCL_9720
Huh-7 Adult hepatocellular carcinoma Homo sapiens CVCL_0336
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00218)
Cytochrome P450 2C8 (CYP2C8)
Adenosine-to-Inosine editing (A-to-I)
In total 2 m6A sequence/site(s) in this target gene
mod ID: A2ISITE004353 Click to Show/Hide the Full List
mod site chr10:95069474-95069475:- [2]
Sequence ATGTCAAAGAGACACACACTAAATTAGCAGGGAGTGTTATA
Transcript ID List ENST00000539050.5; ENST00000479946.2; ENST00000525991.5; ENST00000526814.5; ENST00000527953.5; ENST00000623108.3; ENST00000535898.5; ENST00000371270.6; ENST00000490994.6
External Link RMBase: RNA-editing_site_17628
mod ID: A2ISITE004354 Click to Show/Hide the Full List
mod site chr10:95069488-95069489:- [2]
Sequence ATTGTTTACTTTACATGTCAAAGAGACACACACTAAATTAG
Transcript ID List ENST00000535898.5; ENST00000539050.5; ENST00000490994.6; ENST00000623108.3; ENST00000479946.2; ENST00000371270.6; ENST00000525991.5
External Link RMBase: RNA-editing_site_17629
N6-methyladenosine (m6A)
In total 1 m6A sequence/site(s) in this target gene
mod ID: M6ASITE001455 Click to Show/Hide the Full List
mod site chr10:95036992-95036993:- [3]
Sequence AATATCCCATAAGCATCCAAACTCCATTAAGGAGAGTTGTT
Motif Score 2.627720238
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000539050.5; ENST00000527953.5; ENST00000525991.5; ENST00000371270.6; ENST00000535898.5; ENST00000623108.3; ENST00000526814.5; ENST00000533320.5; ENST00000490994.6; ENST00000527420.5
External Link RMBase: m6A_site_111657