m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00185)

Target Name	Cyclic AMP-dependent transcription factor ATF-4 (ATF4)
Synonyms	cAMP-dependent transcription factor ATF-4; Activating transcription factor 4; Cyclic AMP-responsive element-binding protein 2; CREB-2; cAMP-responsive element-binding protein 2; Tax-responsive enhancer element-binding protein 67; TaxREB67; CREB2; TXREB Click to Show/Hide
Gene Name	ATF4
Chromosomal Location	22q13.1
Family	bZIP family
Function	Transcription factor that binds the cAMP response element (CRE) (consensus: 5'-GTGACGT[AC][AG]-3') and displays two biological functions, as regulator of metabolic and redox processes under normal cellular conditions, and as master transcription factor during integrated stress response (ISR). Binds to asymmetric CRE's as a heterodimer and to palindromic CRE's as a homodimer (By similarity). Core effector of the ISR, which is required for adaptation to various stress such as endoplasmic reticulum (ER) stress, amino acid starvation, mitochondrial stress or oxidative stress. During ISR, ATF4 translation is induced via an alternative ribosome translation re-initiation mechanism in response to EIF2S1/eIF-2-alpha phosphorylation, and stress-induced ATF4 acts as a master transcription factor of stress-responsive genes in order to promote cell recovery. Promotes the transcription of genes linked to amino acid sufficiency and resistance to oxidative stress to protect cells against metabolic consequences of ER oxidation (By similarity). Activates the transcription of NLRP1, possibly in concert with other factors in response to ER stress. Activates the transcription of asparagine synthetase (ASNS) in response to amino acid deprivation or ER stress. However, when associated with DDIT3/CHOP, the transcriptional activation of the ASNS gene is inhibited in response to amino acid deprivation. Together with DDIT3/CHOP, mediates programmed cell death by promoting the expression of genes involved in cellular amino acid metabolic processes, mRNA translation and the terminal unfolded protein response (terminal UPR), a cellular response that elicits programmed cell death when ER stress is prolonged and unresolved (By similarity). Together with DDIT3/CHOP, activates the transcription of the IRS-regulator TRIB3 and promotes ER stress-induced neuronal cell death by regulating the expression of BBC3/PUMA in response to ER stress. May cooperate with the UPR transcriptional regulator QRICH1 to regulate ER protein homeostasis which is critical for cell viability in response to ER stress. In the absence of stress, ATF4 translation is at low levels and it is required for normal metabolic processes such as embryonic lens formation, fetal liver hematopoiesis, bone development and synaptic plasticity (By similarity). Acts as a regulator of osteoblast differentiation in response to phosphorylation by RPS6KA3/RSK2: phosphorylation in osteoblasts enhances transactivation activity and promotes expression of osteoblast-specific genes and post-transcriptionally regulates the synthesis of Type I collagen, the main constituent of the bone matrix. Cooperates with FOXO1 in osteoblasts to regulate glucose homeostasis through suppression of beta-cell production and decrease in insulin production (By similarity). Activates transcription of SIRT4 (By similarity). Regulates the circadian expression of the core clock component PER2 and the serotonin transporter SLC6A4 (By similarity). Binds in a circadian time-dependent manner to the cAMP response elements (CRE) in the SLC6A4 and PER2 promoters and periodically activates the transcription of these genes (By similarity). Mainly acts as a transcriptional activator in cellular stress adaptation, but it can also act as a transcriptional repressor: acts as a regulator of synaptic plasticity by repressing transcription, thereby inhibiting induction and maintenance of long-term memory (By similarity). Regulates synaptic functions via interaction with DISC1 in neurons, which inhibits ATF4 transcription factor activity by disrupting ATF4 dimerization and DNA-binding . Click to Show/Hide
Gene ID	468
Uniprot ID	ATF4_HUMAN
HGNC ID	HGNC:786
KEGG ID	hsa:468

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

ATF4 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Browse Drug

Fat mass and obesity-associated protein (FTO) [ERASER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by FTO*
Cell Line	253J cell line	Homo sapiens
Treatment: siFTO 253J cells Control: 253J cells		GSE150239
Regulation		logFC: -1.42E+00 p-value: 2.68E-47
More Results	Click to View More RNA-seq Results

In total 4 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	In colorectal cancer, Glutaminolysis inhibition upregulated ATF4 expression in an m6A-dependent manner to activate pro-survival autophagy through transcriptional activation of the mTOR inhibitor DDIT4. Determined the relationship between FTO alpha-ketoglutarate dependent dioxygenase (FTO), YTH N6-methyladenosine RNA binding protein 2 (YTHDF2), and ATF4. ATF4 transcriptionally upregulated DDIT4 to suppress Cyclic AMP-dependent transcription factor ATF-4 (ATF4), which induced pro-survival autophagy during glutaminolysis inhibition.
Responsed Disease	Colorectal cancer		ICD-11: 2B91	Disease Info
Responsed Drug	Asparagine inhibitor		Approved	Drug Info
Pathway Response	mTOR signaling pathway			hsa04150
Cell Process	RNA decay
	Cell growth and death
	Cell autophagy
In-vitro Model	HCT 116	Colon carcinoma	Homo sapiens	CVCL_0291
	SW480	Colon adenocarcinoma	Homo sapiens	CVCL_0546
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	In colorectal cancer, Glutaminolysis inhibition upregulated ATF4 expression in an m6A-dependent manner to activate pro-survival autophagy through transcriptional activation of the mTOR inhibitor DDIT4. Determined the relationship between FTO alpha-ketoglutarate dependent dioxygenase (FTO), YTH N6-methyladenosine RNA binding protein 2 (YTHDF2), and ATF4. ATF4 transcriptionally upregulated DDIT4 to suppress Cyclic AMP-dependent transcription factor ATF-4 (ATF4), which induced pro-survival autophagy during glutaminolysis inhibition.
Responsed Disease	Colorectal cancer		ICD-11: 2B91	Disease Info
Responsed Drug	Chloroquine		Approved	Drug Info
Pathway Response	mTOR signaling pathway			hsa04150
Cell Process	RNA decay
	Cell growth and death
	Cell autophagy
In-vitro Model	HCT 116	Colon carcinoma	Homo sapiens	CVCL_0291
	SW480	Colon adenocarcinoma	Homo sapiens	CVCL_0546
Experiment 3 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	In colorectal cancer, Glutaminolysis inhibition upregulated ATF4 expression in an m6A-dependent manner to activate pro-survival autophagy through transcriptional activation of the mTOR inhibitor DDIT4. Determined the relationship between FTO alpha-ketoglutarate dependent dioxygenase (FTO), YTH N6-methyladenosine RNA binding protein 2 (YTHDF2), and ATF4. Cyclic AMP-dependent transcription factor ATF-4 (ATF4) transcriptionally upregulated DDIT4 to suppress mTOR, which induced pro-survival autophagy during glutaminolysis inhibition.
Responsed Disease	Colorectal cancer		ICD-11: 2B91	Disease Info
Responsed Drug	Meclofenamate sodium		Approved	Drug Info
Pathway Response	mTOR signaling pathway			hsa04150
Cell Process	RNA decay
	Cell growth and death
	Cell autophagy
In-vitro Model	HCT 116	Colon carcinoma	Homo sapiens	CVCL_0291
	SW480	Colon adenocarcinoma	Homo sapiens	CVCL_0546
Experiment 4 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	In colorectal cancer, Glutaminolysis inhibition upregulated ATF4 expression in an m6A-dependent manner to activate pro-survival autophagy through transcriptional activation of the mTOR inhibitor DDIT4. Determined the relationship between FTO alpha-ketoglutarate dependent dioxygenase (FTO), YTH N6-methyladenosine RNA binding protein 2 (YTHDF2), and ATF4. Cyclic AMP-dependent transcription factor ATF-4 (ATF4) transcriptionally upregulated DDIT4 to suppress mTOR, which induced pro-survival autophagy during glutaminolysis inhibition.
Responsed Disease	Colorectal cancer		ICD-11: 2B91	Disease Info
Responsed Drug	CB-839		Phase 2	Drug Info
Pathway Response	mTOR signaling pathway			hsa04150
Cell Process	RNA decay
	Cell growth and death
	Cell autophagy
In-vitro Model	HCT 116	Colon carcinoma	Homo sapiens	CVCL_0291
	SW480	Colon adenocarcinoma	Homo sapiens	CVCL_0546

Wilms tumor 1-associating protein (WTAP) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by WTAP*
Cell Line	mice hepatocyte	Mus musculus
Treatment: Wtap Hknockout mice hepatocyte Control: Wtap flox/flox mice hepatocyte		GSE168850
Regulation		logFC: 7.14E-01 p-value: 2.43E-02
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[2]
Response Summary	Myocardial infarction (MI) is one of the leading causes of death. WTAP promoted myocardial I/R injury through promoting ER stress and cell apoptosis by regulating m6A modification of Cyclic AMP-dependent transcription factor ATF-4 (ATF4) mRNA. H/R effects on ER stress and apoptosis were all blocked by silencing of WTAP, promoted by WTAP overexpression, and ameliorated by administration of ER stress inhibitor, 4-PBA.
Target Regulation	Up regulation
Responsed Disease	Acute myocardial infarction		ICD-11: BA41	Disease Info
Cell Process	Endoplasmic reticulum stress
	Cell apoptosis
In-vitro Model	AC16 [Human hybrid cardiomyocyte]	Normal	Homo sapiens	CVCL_4U18
In-vivo Model	Left anterior descending coronary artery (LAD) was ligated for 20 minutes, followed by 48 h reperfusion. Controls underwent same procedures except LAD ligation. WTAP shRNA vector or its negative control (shNC) was injected into the left ventricular anterior wall 24 h before I/R. A pressure volume catheter was used for cardiac function assay.

YTH domain-containing family protein 2 (YTHDF2) [READER]

Regulator Info

In total 4 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	In colorectal cancer, Glutaminolysis inhibition upregulated ATF4 expression in an m6A-dependent manner to activate pro-survival autophagy through transcriptional activation of the mTOR inhibitor DDIT4. Determined the relationship between FTO alpha-ketoglutarate dependent dioxygenase (FTO), YTH N6-methyladenosine RNA binding protein 2 (YTHDF2), and ATF4. ATF4 transcriptionally upregulated DDIT4 to suppress Cyclic AMP-dependent transcription factor ATF-4 (ATF4), which induced pro-survival autophagy during glutaminolysis inhibition.
Target Regulation	Down regulation
Responsed Disease	Colorectal cancer		ICD-11: 2B91	Disease Info
Responsed Drug	Asparagine inhibitor		Approved	Drug Info
Pathway Response	mTOR signaling pathway			hsa04150
Cell Process	RNA decay
	Cell growth and death
	Cell autophagy
In-vitro Model	HCT 116	Colon carcinoma	Homo sapiens	CVCL_0291
	SW480	Colon adenocarcinoma	Homo sapiens	CVCL_0546
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	In colorectal cancer, Glutaminolysis inhibition upregulated ATF4 expression in an m6A-dependent manner to activate pro-survival autophagy through transcriptional activation of the mTOR inhibitor DDIT4. Determined the relationship between FTO alpha-ketoglutarate dependent dioxygenase (FTO), YTH N6-methyladenosine RNA binding protein 2 (YTHDF2), and ATF4. Cyclic AMP-dependent transcription factor ATF-4 (ATF4) transcriptionally upregulated DDIT4 to suppress mTOR, which induced pro-survival autophagy during glutaminolysis inhibition.
Target Regulation	Down regulation
Responsed Disease	Colorectal cancer		ICD-11: 2B91	Disease Info
Responsed Drug	Chloroquine		Approved	Drug Info
Pathway Response	mTOR signaling pathway			hsa04150
Cell Process	RNA decay
	Cell growth and death
	Cell autophagy
In-vitro Model	HCT 116	Colon carcinoma	Homo sapiens	CVCL_0291
	SW480	Colon adenocarcinoma	Homo sapiens	CVCL_0546
Experiment 3 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	In colorectal cancer, Glutaminolysis inhibition upregulated ATF4 expression in an m6A-dependent manner to activate pro-survival autophagy through transcriptional activation of the mTOR inhibitor DDIT4. Determined the relationship between FTO alpha-ketoglutarate dependent dioxygenase (FTO), YTH N6-methyladenosine RNA binding protein 2 (YTHDF2), and ATF4. Cyclic AMP-dependent transcription factor ATF-4 (ATF4) transcriptionally upregulated DDIT4 to suppress mTOR, which induced pro-survival autophagy during glutaminolysis inhibition.
Target Regulation	Down regulation
Responsed Disease	Colorectal cancer		ICD-11: 2B91	Disease Info
Responsed Drug	Meclofenamate sodium		Approved	Drug Info
Pathway Response	mTOR signaling pathway			hsa04150
Cell Process	RNA decay
	Cell growth and death
	Cell autophagy
In-vitro Model	HCT 116	Colon carcinoma	Homo sapiens	CVCL_0291
	SW480	Colon adenocarcinoma	Homo sapiens	CVCL_0546
Experiment 4 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	In colorectal cancer, Glutaminolysis inhibition upregulated ATF4 expression in an m6A-dependent manner to activate pro-survival autophagy through transcriptional activation of the mTOR inhibitor DDIT4. Determined the relationship between FTO alpha-ketoglutarate dependent dioxygenase (FTO), YTH N6-methyladenosine RNA binding protein 2 (YTHDF2), and ATF4. ATF4 transcriptionally upregulated DDIT4 to suppress Cyclic AMP-dependent transcription factor ATF-4 (ATF4), which induced pro-survival autophagy during glutaminolysis inhibition.
Target Regulation	Down regulation
Responsed Disease	Colorectal cancer		ICD-11: 2B91	Disease Info
Responsed Drug	CB-839		Phase 2	Drug Info
Pathway Response	mTOR signaling pathway			hsa04150
Cell Process	RNA decay
	Cell growth and death
	Cell autophagy
In-vitro Model	HCT 116	Colon carcinoma	Homo sapiens	CVCL_0291
	SW480	Colon adenocarcinoma	Homo sapiens	CVCL_0546

Colorectal cancer [ICD-11: 2B91]

Disease Info

In total 4 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	In colorectal cancer, Glutaminolysis inhibition upregulated ATF4 expression in an m6A-dependent manner to activate pro-survival autophagy through transcriptional activation of the mTOR inhibitor DDIT4. Determined the relationship between FTO alpha-ketoglutarate dependent dioxygenase (FTO), YTH N6-methyladenosine RNA binding protein 2 (YTHDF2), and ATF4. ATF4 transcriptionally upregulated DDIT4 to suppress Cyclic AMP-dependent transcription factor ATF-4 (ATF4), which induced pro-survival autophagy during glutaminolysis inhibition.
Responsed Disease	Colorectal cancer [ICD-11: 2B91]
Target Regulator	Fat mass and obesity-associated protein (FTO)		ERASER	Regulator Info
Responsed Drug	Asparagine inhibitor		Approved	Drug Info
Pathway Response	mTOR signaling pathway			hsa04150
Cell Process	RNA decay
	Cell growth and death
	Cell autophagy
In-vitro Model	HCT 116	Colon carcinoma	Homo sapiens	CVCL_0291
	SW480	Colon adenocarcinoma	Homo sapiens	CVCL_0546
Experiment 2 Reporting the m6A-centered Disease Response				[1]
Response Summary	In colorectal cancer, Glutaminolysis inhibition upregulated ATF4 expression in an m6A-dependent manner to activate pro-survival autophagy through transcriptional activation of the mTOR inhibitor DDIT4. Determined the relationship between FTO alpha-ketoglutarate dependent dioxygenase (FTO), YTH N6-methyladenosine RNA binding protein 2 (YTHDF2), and ATF4. ATF4 transcriptionally upregulated DDIT4 to suppress Cyclic AMP-dependent transcription factor ATF-4 (ATF4), which induced pro-survival autophagy during glutaminolysis inhibition.
Responsed Disease	Colorectal cancer [ICD-11: 2B91]
Target Regulator	Fat mass and obesity-associated protein (FTO)		ERASER	Regulator Info
Responsed Drug	Chloroquine		Approved	Drug Info
Pathway Response	mTOR signaling pathway			hsa04150
Cell Process	RNA decay
	Cell growth and death
	Cell autophagy
In-vitro Model	HCT 116	Colon carcinoma	Homo sapiens	CVCL_0291
	SW480	Colon adenocarcinoma	Homo sapiens	CVCL_0546
Experiment 3 Reporting the m6A-centered Disease Response				[1]
Response Summary	In colorectal cancer, Glutaminolysis inhibition upregulated ATF4 expression in an m6A-dependent manner to activate pro-survival autophagy through transcriptional activation of the mTOR inhibitor DDIT4. Determined the relationship between FTO alpha-ketoglutarate dependent dioxygenase (FTO), YTH N6-methyladenosine RNA binding protein 2 (YTHDF2), and ATF4. Cyclic AMP-dependent transcription factor ATF-4 (ATF4) transcriptionally upregulated DDIT4 to suppress mTOR, which induced pro-survival autophagy during glutaminolysis inhibition.
Responsed Disease	Colorectal cancer [ICD-11: 2B91]
Target Regulator	Fat mass and obesity-associated protein (FTO)		ERASER	Regulator Info
Responsed Drug	Meclofenamate sodium		Approved	Drug Info
Pathway Response	mTOR signaling pathway			hsa04150
Cell Process	RNA decay
	Cell growth and death
	Cell autophagy
In-vitro Model	HCT 116	Colon carcinoma	Homo sapiens	CVCL_0291
	SW480	Colon adenocarcinoma	Homo sapiens	CVCL_0546
Experiment 4 Reporting the m6A-centered Disease Response				[1]
Response Summary	In colorectal cancer, Glutaminolysis inhibition upregulated ATF4 expression in an m6A-dependent manner to activate pro-survival autophagy through transcriptional activation of the mTOR inhibitor DDIT4. Determined the relationship between FTO alpha-ketoglutarate dependent dioxygenase (FTO), YTH N6-methyladenosine RNA binding protein 2 (YTHDF2), and ATF4. Cyclic AMP-dependent transcription factor ATF-4 (ATF4) transcriptionally upregulated DDIT4 to suppress mTOR, which induced pro-survival autophagy during glutaminolysis inhibition.
Responsed Disease	Colorectal cancer [ICD-11: 2B91]
Target Regulator	Fat mass and obesity-associated protein (FTO)		ERASER	Regulator Info
Responsed Drug	CB-839		Phase 2	Drug Info
Pathway Response	mTOR signaling pathway			hsa04150
Cell Process	RNA decay
	Cell growth and death
	Cell autophagy
In-vitro Model	HCT 116	Colon carcinoma	Homo sapiens	CVCL_0291
	SW480	Colon adenocarcinoma	Homo sapiens	CVCL_0546

Acute myocardial infarction [ICD-11: BA41]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[2]
Response Summary	Myocardial infarction (MI) is one of the leading causes of death. WTAP promoted myocardial I/R injury through promoting ER stress and cell apoptosis by regulating m6A modification of Cyclic AMP-dependent transcription factor ATF-4 (ATF4) mRNA. H/R effects on ER stress and apoptosis were all blocked by silencing of WTAP, promoted by WTAP overexpression, and ameliorated by administration of ER stress inhibitor, 4-PBA.
Responsed Disease	Acute myocardial infarction [ICD-11: BA41]
Target Regulator	Wilms tumor 1-associating protein (WTAP)		WRITER	Regulator Info
Target Regulation	Up regulation
Cell Process	Endoplasmic reticulum stress
	Cell apoptosis
In-vitro Model	AC16 [Human hybrid cardiomyocyte]	Normal	Homo sapiens	CVCL_4U18
In-vivo Model	Left anterior descending coronary artery (LAD) was ligated for 20 minutes, followed by 48 h reperfusion. Controls underwent same procedures except LAD ligation. WTAP shRNA vector or its negative control (shNC) was injected into the left ventricular anterior wall 24 h before I/R. A pressure volume catheter was used for cardiac function assay.

Asparagine inhibitor [Approved]

Drug Info

In total 2 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response				[1]
Response Summary	In colorectal cancer, Glutaminolysis inhibition upregulated ATF4 expression in an m6A-dependent manner to activate pro-survival autophagy through transcriptional activation of the mTOR inhibitor DDIT4. Determined the relationship between FTO alpha-ketoglutarate dependent dioxygenase (FTO), YTH N6-methyladenosine RNA binding protein 2 (YTHDF2), and ATF4. ATF4 transcriptionally upregulated DDIT4 to suppress Cyclic AMP-dependent transcription factor ATF-4 (ATF4), which induced pro-survival autophagy during glutaminolysis inhibition.
Target Regulator	Fat mass and obesity-associated protein (FTO)		ERASER	Regulator Info
Responsed Disease	Colorectal cancer		ICD-11: 2B91	Disease Info
Pathway Response	mTOR signaling pathway			hsa04150
Cell Process	RNA decay
	Cell growth and death
	Cell autophagy
In-vitro Model	HCT 116	Colon carcinoma	Homo sapiens	CVCL_0291
	SW480	Colon adenocarcinoma	Homo sapiens	CVCL_0546
Experiment 2 Reporting the m6A-centered Drug Response				[1]
Response Summary	In colorectal cancer, Glutaminolysis inhibition upregulated ATF4 expression in an m6A-dependent manner to activate pro-survival autophagy through transcriptional activation of the mTOR inhibitor DDIT4. Determined the relationship between FTO alpha-ketoglutarate dependent dioxygenase (FTO), YTH N6-methyladenosine RNA binding protein 2 (YTHDF2), and ATF4. ATF4 transcriptionally upregulated DDIT4 to suppress Cyclic AMP-dependent transcription factor ATF-4 (ATF4), which induced pro-survival autophagy during glutaminolysis inhibition.
Target Regulator	YTH domain-containing family protein 2 (YTHDF2)		READER	Regulator Info
Target Regulation	Down regulation
Responsed Disease	Colorectal cancer		ICD-11: 2B91	Disease Info
Pathway Response	mTOR signaling pathway			hsa04150
Cell Process	RNA decay
	Cell growth and death
	Cell autophagy
In-vitro Model	HCT 116	Colon carcinoma	Homo sapiens	CVCL_0291
	SW480	Colon adenocarcinoma	Homo sapiens	CVCL_0546

Chloroquine [Approved]

Drug Info

In total 2 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response				[1]
Response Summary	In colorectal cancer, Glutaminolysis inhibition upregulated ATF4 expression in an m6A-dependent manner to activate pro-survival autophagy through transcriptional activation of the mTOR inhibitor DDIT4. Determined the relationship between FTO alpha-ketoglutarate dependent dioxygenase (FTO), YTH N6-methyladenosine RNA binding protein 2 (YTHDF2), and ATF4. ATF4 transcriptionally upregulated DDIT4 to suppress Cyclic AMP-dependent transcription factor ATF-4 (ATF4), which induced pro-survival autophagy during glutaminolysis inhibition.
Target Regulator	Fat mass and obesity-associated protein (FTO)		ERASER	Regulator Info
Responsed Disease	Colorectal cancer		ICD-11: 2B91	Disease Info
Pathway Response	mTOR signaling pathway			hsa04150
Cell Process	RNA decay
	Cell growth and death
	Cell autophagy
In-vitro Model	HCT 116	Colon carcinoma	Homo sapiens	CVCL_0291
	SW480	Colon adenocarcinoma	Homo sapiens	CVCL_0546
Experiment 2 Reporting the m6A-centered Drug Response				[1]
Response Summary	In colorectal cancer, Glutaminolysis inhibition upregulated ATF4 expression in an m6A-dependent manner to activate pro-survival autophagy through transcriptional activation of the mTOR inhibitor DDIT4. Determined the relationship between FTO alpha-ketoglutarate dependent dioxygenase (FTO), YTH N6-methyladenosine RNA binding protein 2 (YTHDF2), and ATF4. Cyclic AMP-dependent transcription factor ATF-4 (ATF4) transcriptionally upregulated DDIT4 to suppress mTOR, which induced pro-survival autophagy during glutaminolysis inhibition.
Target Regulator	YTH domain-containing family protein 2 (YTHDF2)		READER	Regulator Info
Target Regulation	Down regulation
Responsed Disease	Colorectal cancer		ICD-11: 2B91	Disease Info
Pathway Response	mTOR signaling pathway			hsa04150
Cell Process	RNA decay
	Cell growth and death
	Cell autophagy
In-vitro Model	HCT 116	Colon carcinoma	Homo sapiens	CVCL_0291
	SW480	Colon adenocarcinoma	Homo sapiens	CVCL_0546

Meclofenamate sodium [Approved]

Drug Info

In total 2 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response				[1]
Response Summary	In colorectal cancer, Glutaminolysis inhibition upregulated ATF4 expression in an m6A-dependent manner to activate pro-survival autophagy through transcriptional activation of the mTOR inhibitor DDIT4. Determined the relationship between FTO alpha-ketoglutarate dependent dioxygenase (FTO), YTH N6-methyladenosine RNA binding protein 2 (YTHDF2), and ATF4. Cyclic AMP-dependent transcription factor ATF-4 (ATF4) transcriptionally upregulated DDIT4 to suppress mTOR, which induced pro-survival autophagy during glutaminolysis inhibition.
Target Regulator	Fat mass and obesity-associated protein (FTO)		ERASER	Regulator Info
Responsed Disease	Colorectal cancer		ICD-11: 2B91	Disease Info
Pathway Response	mTOR signaling pathway			hsa04150
Cell Process	RNA decay
	Cell growth and death
	Cell autophagy
In-vitro Model	HCT 116	Colon carcinoma	Homo sapiens	CVCL_0291
	SW480	Colon adenocarcinoma	Homo sapiens	CVCL_0546
Experiment 2 Reporting the m6A-centered Drug Response				[1]
Response Summary	In colorectal cancer, Glutaminolysis inhibition upregulated ATF4 expression in an m6A-dependent manner to activate pro-survival autophagy through transcriptional activation of the mTOR inhibitor DDIT4. Determined the relationship between FTO alpha-ketoglutarate dependent dioxygenase (FTO), YTH N6-methyladenosine RNA binding protein 2 (YTHDF2), and ATF4. Cyclic AMP-dependent transcription factor ATF-4 (ATF4) transcriptionally upregulated DDIT4 to suppress mTOR, which induced pro-survival autophagy during glutaminolysis inhibition.
Target Regulator	YTH domain-containing family protein 2 (YTHDF2)		READER	Regulator Info
Target Regulation	Down regulation
Responsed Disease	Colorectal cancer		ICD-11: 2B91	Disease Info
Pathway Response	mTOR signaling pathway			hsa04150
Cell Process	RNA decay
	Cell growth and death
	Cell autophagy
In-vitro Model	HCT 116	Colon carcinoma	Homo sapiens	CVCL_0291
	SW480	Colon adenocarcinoma	Homo sapiens	CVCL_0546

Rapamycin [Approved]

Drug Info

In total 2 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response				[1]
Response Summary	In colorectal cancer, Glutaminolysis inhibition upregulated ATF4 expression in an m6A-dependent manner to activate pro-survival autophagy through transcriptional activation of the mTOR inhibitor DDIT4. Determined the relationship between FTO alpha-ketoglutarate dependent dioxygenase (FTO), YTH N6-methyladenosine RNA binding protein 2 (YTHDF2), and ATF4. Cyclic AMP-dependent transcription factor ATF-4 (ATF4) transcriptionally upregulated DDIT4 to suppress mTOR, which induced pro-survival autophagy during glutaminolysis inhibition.
Target Regulator	Fat mass and obesity-associated protein (FTO)		ERASER	Regulator Info
Responsed Disease	Colorectal cancer		ICD-11: 2B91	Disease Info
Pathway Response	mTOR signaling pathway			hsa04150
Cell Process	RNA decay
	Cell growth and death
	Cell autophagy
In-vitro Model	HCT 116	Colon carcinoma	Homo sapiens	CVCL_0291
	SW480	Colon adenocarcinoma	Homo sapiens	CVCL_0546
Experiment 2 Reporting the m6A-centered Drug Response				[1]
Response Summary	In colorectal cancer, Glutaminolysis inhibition upregulated ATF4 expression in an m6A-dependent manner to activate pro-survival autophagy through transcriptional activation of the mTOR inhibitor DDIT4. Determined the relationship between FTO alpha-ketoglutarate dependent dioxygenase (FTO), YTH N6-methyladenosine RNA binding protein 2 (YTHDF2), and ATF4. Cyclic AMP-dependent transcription factor ATF-4 (ATF4) transcriptionally upregulated DDIT4 to suppress mTOR, which induced pro-survival autophagy during glutaminolysis inhibition.
Target Regulator	YTH domain-containing family protein 2 (YTHDF2)		READER	Regulator Info
Target Regulation	Down regulation
Responsed Disease	Colorectal cancer		ICD-11: 2B91	Disease Info
Pathway Response	mTOR signaling pathway			hsa04150
Cell Process	RNA decay
	Cell growth and death
	Cell autophagy
In-vitro Model	HCT 116	Colon carcinoma	Homo sapiens	CVCL_0291
	SW480	Colon adenocarcinoma	Homo sapiens	CVCL_0546

CB-839 [Phase 2]

Drug Info

In total 2 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response				[1]
Response Summary	In colorectal cancer, Glutaminolysis inhibition upregulated ATF4 expression in an m6A-dependent manner to activate pro-survival autophagy through transcriptional activation of the mTOR inhibitor DDIT4. Determined the relationship between FTO alpha-ketoglutarate dependent dioxygenase (FTO), YTH N6-methyladenosine RNA binding protein 2 (YTHDF2), and ATF4. Cyclic AMP-dependent transcription factor ATF-4 (ATF4) transcriptionally upregulated DDIT4 to suppress mTOR, which induced pro-survival autophagy during glutaminolysis inhibition.
Target Regulator	Fat mass and obesity-associated protein (FTO)		ERASER	Regulator Info
Responsed Disease	Colorectal cancer		ICD-11: 2B91	Disease Info
Pathway Response	mTOR signaling pathway			hsa04150
Cell Process	RNA decay
	Cell growth and death
	Cell autophagy
In-vitro Model	HCT 116	Colon carcinoma	Homo sapiens	CVCL_0291
	SW480	Colon adenocarcinoma	Homo sapiens	CVCL_0546
Experiment 2 Reporting the m6A-centered Drug Response				[1]
Response Summary	In colorectal cancer, Glutaminolysis inhibition upregulated ATF4 expression in an m6A-dependent manner to activate pro-survival autophagy through transcriptional activation of the mTOR inhibitor DDIT4. Determined the relationship between FTO alpha-ketoglutarate dependent dioxygenase (FTO), YTH N6-methyladenosine RNA binding protein 2 (YTHDF2), and ATF4. ATF4 transcriptionally upregulated DDIT4 to suppress Cyclic AMP-dependent transcription factor ATF-4 (ATF4), which induced pro-survival autophagy during glutaminolysis inhibition.
Target Regulator	YTH domain-containing family protein 2 (YTHDF2)		READER	Regulator Info
Target Regulation	Down regulation
Responsed Disease	Colorectal cancer		ICD-11: 2B91	Disease Info
Pathway Response	mTOR signaling pathway			hsa04150
Cell Process	RNA decay
	Cell growth and death
	Cell autophagy
In-vitro Model	HCT 116	Colon carcinoma	Homo sapiens	CVCL_0291
	SW480	Colon adenocarcinoma	Homo sapiens	CVCL_0546

GLS-IN-968 [Investigative]

Drug Info

In total 2 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response				[1]
Response Summary	In colorectal cancer, Glutaminolysis inhibition upregulated ATF4 expression in an m6A-dependent manner to activate pro-survival autophagy through transcriptional activation of the mTOR inhibitor DDIT4. Determined the relationship between FTO alpha-ketoglutarate dependent dioxygenase (FTO), YTH N6-methyladenosine RNA binding protein 2 (YTHDF2), and ATF4. ATF4 transcriptionally upregulated DDIT4 to suppress Cyclic AMP-dependent transcription factor ATF-4 (ATF4), which induced pro-survival autophagy during glutaminolysis inhibition.
Target Regulator	Fat mass and obesity-associated protein (FTO)		ERASER	Regulator Info
Responsed Disease	Colorectal cancer		ICD-11: 2B91	Disease Info
Pathway Response	mTOR signaling pathway			hsa04150
Cell Process	RNA decay
	Cell growth and death
	Cell autophagy
In-vitro Model	HCT 116	Colon carcinoma	Homo sapiens	CVCL_0291
	SW480	Colon adenocarcinoma	Homo sapiens	CVCL_0546
Experiment 2 Reporting the m6A-centered Drug Response				[1]
Response Summary	In colorectal cancer, Glutaminolysis inhibition upregulated ATF4 expression in an m6A-dependent manner to activate pro-survival autophagy through transcriptional activation of the mTOR inhibitor DDIT4. Determined the relationship between FTO alpha-ketoglutarate dependent dioxygenase (FTO), YTH N6-methyladenosine RNA binding protein 2 (YTHDF2), and ATF4. ATF4 transcriptionally upregulated DDIT4 to suppress Cyclic AMP-dependent transcription factor ATF-4 (ATF4), which induced pro-survival autophagy during glutaminolysis inhibition.
Target Regulator	YTH domain-containing family protein 2 (YTHDF2)		READER	Regulator Info
Target Regulation	Down regulation
Responsed Disease	Colorectal cancer		ICD-11: 2B91	Disease Info
Pathway Response	mTOR signaling pathway			hsa04150
Cell Process	RNA decay
	Cell growth and death
	Cell autophagy
In-vitro Model	HCT 116	Colon carcinoma	Homo sapiens	CVCL_0291
	SW480	Colon adenocarcinoma	Homo sapiens	CVCL_0546

Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator

Histone modification

m6A Regulator: YTH domain-containing family protein 2 (YTHDF2)

Regulator Info

In total 6 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03334		Crosstalk Info
Epigenetic Regulator	Histone acetyltransferase p300 (P300)
Regulated Target	Histone H3 lysine 18 lactylation (H3K18la)
Crosstalk relationship	Histone modification → m6A
Disease	Colorectal cancer	Disease Info
Drug	Rapamycin	Drug Info
Crosstalk ID: M6ACROT03335		Crosstalk Info
Epigenetic Regulator	Histone acetyltransferase p300 (P300)
Regulated Target	Histone H3 lysine 18 lactylation (H3K18la)
Crosstalk relationship	Histone modification → m6A
Disease	Colorectal cancer	Disease Info
Drug	GLS-IN-968	Drug Info
Crosstalk ID: M6ACROT03336		Crosstalk Info
Epigenetic Regulator	Histone acetyltransferase p300 (P300)
Regulated Target	Histone H3 lysine 18 lactylation (H3K18la)
Crosstalk relationship	Histone modification → m6A
Disease	Colorectal cancer	Disease Info
Drug	CB-839	Drug Info
Crosstalk ID: M6ACROT03337		Crosstalk Info
Epigenetic Regulator	Histone acetyltransferase p300 (P300)
Regulated Target	Histone H3 lysine 18 lactylation (H3K18la)
Crosstalk relationship	Histone modification → m6A
Disease	Colorectal cancer	Disease Info
Drug	Meclofenamate sodium	Drug Info
Crosstalk ID: M6ACROT03338		Crosstalk Info
Epigenetic Regulator	Histone acetyltransferase p300 (P300)
Regulated Target	Histone H3 lysine 18 lactylation (H3K18la)
Crosstalk relationship	Histone modification → m6A
Disease	Colorectal cancer	Disease Info
Drug	Chloroquine	Drug Info
Crosstalk ID: M6ACROT03339		Crosstalk Info
Epigenetic Regulator	Histone acetyltransferase p300 (P300)
Regulated Target	Histone H3 lysine 18 lactylation (H3K18la)
Crosstalk relationship	Histone modification → m6A
Disease	Colorectal cancer	Disease Info
Drug	Asparagine inhibitor	Drug Info

m6A Regulator: Fat mass and obesity-associated protein (FTO)

Regulator Info

In total 6 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03432		Crosstalk Info
Epigenetic Regulator	Histone deacetylase 1 (HDAC1)
Regulated Target	Histone H3 lysine 27 acetylation (H3K27ac)
Crosstalk relationship	Histone modification → m6A
Disease	Colorectal cancer	Disease Info
Drug	Rapamycin	Drug Info
Crosstalk ID: M6ACROT03433		Crosstalk Info
Epigenetic Regulator	Histone deacetylase 1 (HDAC1)
Regulated Target	Histone H3 lysine 27 acetylation (H3K27ac)
Crosstalk relationship	Histone modification → m6A
Disease	Colorectal cancer	Disease Info
Drug	GLS-IN-968	Drug Info
Crosstalk ID: M6ACROT03434		Crosstalk Info
Epigenetic Regulator	Histone deacetylase 1 (HDAC1)
Regulated Target	Histone H3 lysine 27 acetylation (H3K27ac)
Crosstalk relationship	Histone modification → m6A
Disease	Colorectal cancer	Disease Info
Drug	CB-839	Drug Info
Crosstalk ID: M6ACROT03435		Crosstalk Info
Epigenetic Regulator	Histone deacetylase 1 (HDAC1)
Regulated Target	Histone H3 lysine 27 acetylation (H3K27ac)
Crosstalk relationship	Histone modification → m6A
Disease	Colorectal cancer	Disease Info
Drug	Meclofenamate sodium	Drug Info
Crosstalk ID: M6ACROT03436		Crosstalk Info
Epigenetic Regulator	Histone deacetylase 1 (HDAC1)
Regulated Target	Histone H3 lysine 27 acetylation (H3K27ac)
Crosstalk relationship	Histone modification → m6A
Disease	Colorectal cancer	Disease Info
Drug	Chloroquine	Drug Info
Crosstalk ID: M6ACROT03437		Crosstalk Info
Epigenetic Regulator	Histone deacetylase 1 (HDAC1)
Regulated Target	Histone H3 lysine 27 acetylation (H3K27ac)
Crosstalk relationship	Histone modification → m6A
Disease	Colorectal cancer	Disease Info
Drug	Asparagine inhibitor	Drug Info

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00185)

Cyclic AMP-dependent transcription factor ATF-4 (ATF4)

2'-O-Methylation (2'-O-Me)

In total 3 m6A sequence/site(s) in this target gene
mod ID: 2OMSITE000300		Click to Show/Hide the Full List
mod site	chr22:39521399-39521400:+		[4]
Sequence	TTGCTGTAACCGACAAAGACACCTTCGAATTAAGCACATTC
Cell/Tissue List	HEK293
Seq Type List	Nm-seq
Transcript ID List	ENST00000404241.6; ENST00000337304.2; ENST00000396680.2
External Link	RMBase: Nm_site_4856
mod ID: 2OMSITE000301		Click to Show/Hide the Full List
mod site	chr22:39521400-39521401:+		[4]
Sequence	TGCTGTAACCGACAAAGACACCTTCGAATTAAGCACATTCC
Cell/Tissue List	HEK293
Seq Type List	Nm-seq
Transcript ID List	ENST00000396680.2; ENST00000337304.2; ENST00000404241.6
External Link	RMBase: Nm_site_4857
mod ID: 2OMSITE000302		Click to Show/Hide the Full List
mod site	chr22:39521403-39521404:+		[4]
Sequence	TGTAACCGACAAAGACACCTTCGAATTAAGCACATTCCTCG
Cell/Tissue List	HeLa
Seq Type List	Nm-seq
Transcript ID List	ENST00000396680.2; ENST00000337304.2; ENST00000404241.6
External Link	RMBase: Nm_site_4858

5-methylcytidine (m5C)

In total 4 m6A sequence/site(s) in this target gene
mod ID: M5CSITE002926		Click to Show/Hide the Full List
mod site	chr22:39521497-39521498:+		[5]
Sequence	GTTGGTGGGGGACTTGATGTCCCCCTTCGACCAGTCGGGTT
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000404241.6; ENST00000396680.2; ENST00000337304.2
External Link	RMBase: m5C_site_30981
mod ID: M5CSITE002927		Click to Show/Hide the Full List
mod site	chr22:39521498-39521499:+		[5]
Sequence	TTGGTGGGGGACTTGATGTCCCCCTTCGACCAGTCGGGTTT
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000396680.2; ENST00000337304.2; ENST00000404241.6
External Link	RMBase: m5C_site_30982
mod ID: M5CSITE002928		Click to Show/Hide the Full List
mod site	chr22:39521500-39521501:+		[5]
Sequence	GGTGGGGGACTTGATGTCCCCCTTCGACCAGTCGGGTTTGG
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000337304.2; ENST00000404241.6; ENST00000396680.2
External Link	RMBase: m5C_site_30983
mod ID: M5CSITE002929		Click to Show/Hide the Full List
mod site	chr22:39522053-39522054:+		[5]
Sequence	TTCCCCTTTCCCCAGGGGTCCTGTCCTCCACTCCAGATCAT
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000404241.6; ENST00000396680.2; ENST00000337304.2
External Link	RMBase: m5C_site_30984

N6-methyladenosine (m6A)

In total 41 m6A sequence/site(s) in this target gene
mod ID: M6ASITE058147		Click to Show/Hide the Full List
mod site	chr22:39519700-39519701:+		[6]
Sequence	CGGCCTTTGGGGGTAGGTGGACAGGCCCGGCGCGCCCTCTC
Motif Score	3.643047619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000404241.6
External Link	RMBase: m6A_site_567292
mod ID: M6ASITE058148		Click to Show/Hide the Full List
mod site	chr22:39519784-39519785:+		[6]
Sequence	ATGAATGGGGCCTCTGGAAAACTCAGGCTTGGAACAGGTAA
Motif Score	2.627720238
Cell/Tissue List	HeLa; HEK293A-TOA
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000404241.6
External Link	RMBase: m6A_site_567293
mod ID: M6ASITE058149		Click to Show/Hide the Full List
mod site	chr22:39519797-39519798:+		[6]
Sequence	CTGGAAAACTCAGGCTTGGAACAGGTAACCCCCCGGTTTCC
Motif Score	2.951386905
Cell/Tissue List	HeLa; HEK293A-TOA
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000404241.6
External Link	RMBase: m6A_site_567294
mod ID: M6ASITE058150		Click to Show/Hide the Full List
mod site	chr22:39520220-39520221:+		[6]
Sequence	CCTCGGCCTTCACAATAAAAACTCTTCGCCGGAAAACGACC
Motif Score	2.627720238
Cell/Tissue List	HeLa; HEK293A-TOA
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000404241.6
External Link	RMBase: m6A_site_567295
mod ID: M6ASITE058151		Click to Show/Hide the Full List
mod site	chr22:39520323-39520324:+		[6]
Sequence	GGCGGCGAAGGAAAGAACGGACTCTGATCATAGAAGCCTAG
Motif Score	4.065041667
Cell/Tissue List	HeLa; HEK293T; HEK293A-TOA; MSC
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000404241.6
External Link	RMBase: m6A_site_567296
mod ID: M6ASITE058152		Click to Show/Hide the Full List
mod site	chr22:39520383-39520384:+		[6]
Sequence	CCTTTCGTGAGGCCATAAGAACAAACTCCTTTTCTCGTCAC
Motif Score	2.951386905
Cell/Tissue List	HeLa; HEK293T; HEK293A-TOA
Seq Type List	m6A-seq
Transcript ID List	ENST00000404241.6
External Link	RMBase: m6A_site_567297
mod ID: M6ASITE058153		Click to Show/Hide the Full List
mod site	chr22:39520568-39520569:+		[7]
Sequence	CGGCCACGGCAGCCATTTCTACTTTGCCCGCCCACAGATGT
Motif Score	2.500660714
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000404241.6; ENST00000337304.2; ENST00000396680.2
External Link	RMBase: m6A_site_567298
mod ID: M6ASITE058154		Click to Show/Hide the Full List
mod site	chr22:39520948-39520949:+		[6]
Sequence	AAGCGTAGTCGGGTGCCCGGACTGCTTCCCCAGGAGCCCTA
Motif Score	4.065041667
Cell/Tissue List	HeLa; HepG2; MM6; HEK293T; endometrial; NB4
Seq Type List	m6A-seq
Transcript ID List	ENST00000396680.2; ENST00000337304.2; ENST00000404241.6
External Link	RMBase: m6A_site_567299
mod ID: M6ASITE058155		Click to Show/Hide the Full List
mod site	chr22:39520979-39520980:+		[6]
Sequence	AGGAGCCCTACAGCCCTCGGACCCCGAGCCCCGCAAGGGTC
Motif Score	3.622404762
Cell/Tissue List	HeLa; HepG2; MM6; peripheral-blood; HEK293T; endometrial; NB4
Seq Type List	m6A-seq
Transcript ID List	ENST00000404241.6; ENST00000396680.2; ENST00000337304.2
External Link	RMBase: m6A_site_567300
mod ID: M6ASITE058156		Click to Show/Hide the Full List
mod site	chr22:39521039-39521040:+		[6]
Sequence	CCCCACGAAACGTGGCAGGAACCAAGATGGCGGCGGCAGGG
Motif Score	2.930744048
Cell/Tissue List	HeLa; HepG2; HEK293T; endometrial; NB4
Seq Type List	m6A-seq
Transcript ID List	ENST00000396680.2; ENST00000404241.6; ENST00000337304.2
External Link	RMBase: m6A_site_567301
mod ID: M6ASITE058157		Click to Show/Hide the Full List
mod site	chr22:39521387-39521388:+		[7]
Sequence	TCAGCAGCAGCGTTGCTGTAACCGACAAAGACACCTTCGAA
Motif Score	2.147452381
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000337304.2; ENST00000396680.2; ENST00000404241.6
External Link	RMBase: m6A_site_567302
mod ID: M6ASITE058158		Click to Show/Hide the Full List
mod site	chr22:39521391-39521392:+		[7]
Sequence	CAGCAGCGTTGCTGTAACCGACAAAGACACCTTCGAATTAA
Motif Score	2.865571429
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000337304.2; ENST00000396680.2; ENST00000404241.6
External Link	RMBase: m6A_site_567303
mod ID: M6ASITE058159		Click to Show/Hide the Full List
mod site	chr22:39521443-39521444:+		[8]
Sequence	GATTCCAGCAAAGCACCGCAACATGACCGAAATGAGCTTCC
Motif Score	2.173910714
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000396680.2; ENST00000337304.2; ENST00000404241.6
External Link	RMBase: m6A_site_567304
mod ID: M6ASITE058160		Click to Show/Hide the Full List
mod site	chr22:39521488-39521489:+		[9]
Sequence	CAGCGAGGTGTTGGTGGGGGACTTGATGTCCCCCTTCGACC
Motif Score	4.065041667
Cell/Tissue List	CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000396680.2; ENST00000337304.2; ENST00000404241.6
External Link	RMBase: m6A_site_567305
mod ID: M6ASITE058161		Click to Show/Hide the Full List
mod site	chr22:39521572-39521573:+		[7]
Sequence	TTACCTGGAGGTGGCCAAGCACTTCAAACCTCATGGGTTCT
Motif Score	3.252583333
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000337304.2; ENST00000396680.2; ENST00000404241.6
External Link	RMBase: m6A_site_567306
mod ID: M6ASITE058162		Click to Show/Hide the Full List
mod site	chr22:39521579-39521580:+		[9]
Sequence	GAGGTGGCCAAGCACTTCAAACCTCATGGGTTCTCCAGCGA
Motif Score	2.185083333
Cell/Tissue List	CD34; HepG2; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000404241.6; ENST00000337304.2; ENST00000396680.2
External Link	RMBase: m6A_site_567307
mod ID: M6ASITE058163		Click to Show/Hide the Full List
mod site	chr22:39521599-39521600:+		[8]
Sequence	ACCTCATGGGTTCTCCAGCGACAAGGCTAAGGCGGGCTCCT
Motif Score	2.865571429
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000404241.6; ENST00000337304.2; ENST00000396680.2
External Link	RMBase: m6A_site_567308
mod ID: M6ASITE058164		Click to Show/Hide the Full List
mod site	chr22:39521659-39521660:+		[8]
Sequence	TGGGTTGGTCAGTCCCTCCAACAACAGCAAGGGTGAGTGGG
Motif Score	2.173910714
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000337304.2; ENST00000396680.2; ENST00000404241.6
External Link	RMBase: m6A_site_567309
mod ID: M6ASITE058165		Click to Show/Hide the Full List
mod site	chr22:39521789-39521790:+		[9]
Sequence	CAGAGGATGCCTTCTCCGGGACAGATTGGATGTTGGAGAAA
Motif Score	3.643047619
Cell/Tissue List	CD34; HepG2; A549; H1299; MM6; peripheral-blood; HEK293T; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq
Transcript ID List	ENST00000404241.6; ENST00000396680.2; ENST00000337304.2
External Link	RMBase: m6A_site_567310
mod ID: M6ASITE058166		Click to Show/Hide the Full List
mod site	chr22:39521829-39521830:+		[7]
Sequence	AATGGATTTGAAGGAGTTCGACTTGGATGCCCTGTTGGGTA
Motif Score	3.287565476
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000396680.2; ENST00000337304.2; ENST00000404241.6
External Link	RMBase: m6A_site_567311
mod ID: M6ASITE058167		Click to Show/Hide the Full List
mod site	chr22:39521864-39521865:+		[9]
Sequence	TGGGTATAGATGACCTGGAAACCATGCCAGATGACCTTCTG
Motif Score	2.185083333
Cell/Tissue List	CD34; HepG2; A549; H1299; MM6; peripheral-blood; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq
Transcript ID List	ENST00000404241.6; ENST00000396680.2; ENST00000337304.2
External Link	RMBase: m6A_site_567312
mod ID: M6ASITE058168		Click to Show/Hide the Full List
mod site	chr22:39521898-39521899:+		[7]
Sequence	CCTTCTGACCACGTTGGATGACACTTGTGATCTCTTTGCCC
Motif Score	2.859755952
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000337304.2; ENST00000404241.6; ENST00000396680.2
External Link	RMBase: m6A_site_567313
mod ID: M6ASITE058169		Click to Show/Hide the Full List
mod site	chr22:39521933-39521934:+		[9]
Sequence	TTGCCCCCCTAGTCCAGGAGACTAATAAGCAGCCCCCCCAG
Motif Score	3.319380952
Cell/Tissue List	CD34; HepG2; A549; H1299; MM6; peripheral-blood; endometrial; NB4
Seq Type List	m6A-seq; m6A-CLIP/IP
Transcript ID List	ENST00000404241.6; ENST00000337304.2; ENST00000396680.2
External Link	RMBase: m6A_site_567314
mod ID: M6ASITE058170		Click to Show/Hide the Full List
mod site	chr22:39521954-39521955:+		[7]
Sequence	CTAATAAGCAGCCCCCCCAGACGGTGAACCCAATTGGCCAT
Motif Score	2.871321429
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000337304.2; ENST00000396680.2; ENST00000404241.6
External Link	RMBase: m6A_site_567315
mod ID: M6ASITE058171		Click to Show/Hide the Full List
mod site	chr22:39521961-39521962:+		[9]
Sequence	GCAGCCCCCCCAGACGGTGAACCCAATTGGCCATCTCCCAG
Motif Score	2.930744048
Cell/Tissue List	CD34; A549; H1299; MM6; endometrial; NB4
Seq Type List	m6A-seq
Transcript ID List	ENST00000396680.2; ENST00000404241.6; ENST00000337304.2
External Link	RMBase: m6A_site_567316
mod ID: M6ASITE058172		Click to Show/Hide the Full List
mod site	chr22:39521990-39521991:+		[8]
Sequence	GCCATCTCCCAGAAAGTTTAACAAAACCCGACCAGGTTGCC
Motif Score	2.168095238
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000404241.6; ENST00000396680.2; ENST00000337304.2
External Link	RMBase: m6A_site_567317
mod ID: M6ASITE058173		Click to Show/Hide the Full List
mod site	chr22:39521995-39521996:+		[9]
Sequence	CTCCCAGAAAGTTTAACAAAACCCGACCAGGTTGCCCCCTT
Motif Score	2.185083333
Cell/Tissue List	CD34; A549; H1299; MM6; endometrial; NB4
Seq Type List	m6A-seq
Transcript ID List	ENST00000404241.6; ENST00000396680.2; ENST00000337304.2
External Link	RMBase: m6A_site_567318
mod ID: M6ASITE058174		Click to Show/Hide the Full List
mod site	chr22:39522000-39522001:+		[7]
Sequence	AGAAAGTTTAACAAAACCCGACCAGGTTGCCCCCTTCACCT
Motif Score	2.844928571
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000337304.2; ENST00000396680.2; ENST00000404241.6
External Link	RMBase: m6A_site_567319
mod ID: M6ASITE058175		Click to Show/Hide the Full List
mod site	chr22:39522025-39522026:+		[7]
Sequence	GTTGCCCCCTTCACCTTCTTACAACCTCTTCCCCTTTCCCC
Motif Score	2.07285119
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000337304.2; ENST00000396680.2; ENST00000404241.6
External Link	RMBase: m6A_site_567320
mod ID: M6ASITE058176		Click to Show/Hide the Full List
mod site	chr22:39522062-39522063:+		[7]
Sequence	CCCCAGGGGTCCTGTCCTCCACTCCAGATCATTCCTTTAGT
Motif Score	2.475107143
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000337304.2; ENST00000396680.2; ENST00000404241.6
External Link	RMBase: m6A_site_567321
mod ID: M6ASITE058177		Click to Show/Hide the Full List
mod site	chr22:39522132-39522133:+		[9]
Sequence	TGAAGGAGATAGGAAGCCAGACTACACTGCTTACGTTGCCA
Motif Score	3.319380952
Cell/Tissue List	CD34; HEK293T; H1299; endometrial; NB4; AML
Seq Type List	m6A-seq; DART-seq; miCLIP
Transcript ID List	ENST00000396680.2; ENST00000337304.2; ENST00000404241.6
External Link	RMBase: m6A_site_567322
mod ID: M6ASITE058178		Click to Show/Hide the Full List
mod site	chr22:39522135-39522136:+		[8]
Sequence	AGGAGATAGGAAGCCAGACTACACTGCTTACGTTGCCATGA
Motif Score	2.078666667
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000337304.2; ENST00000404241.6; ENST00000396680.2
External Link	RMBase: m6A_site_567323
mod ID: M6ASITE058179		Click to Show/Hide the Full List
mod site	chr22:39522144-39522145:+		[7]
Sequence	GAAGCCAGACTACACTGCTTACGTTGCCATGATCCCTCAGT
Motif Score	2.046785714
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000396680.2; ENST00000404241.6; ENST00000337304.2
External Link	RMBase: m6A_site_567324
mod ID: M6ASITE058180		Click to Show/Hide the Full List
mod site	chr22:39522180-39522181:+		[9]
Sequence	TCAGTGCATAAAGGAGGAAGACACCCCTTCAGATAATGATA
Motif Score	2.897386905
Cell/Tissue List	CD34; hESC-HEK293T; NB4
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000396680.2; ENST00000404241.6; ENST00000337304.2
External Link	RMBase: m6A_site_567325
mod ID: M6ASITE058181		Click to Show/Hide the Full List
mod site	chr22:39522257-39522258:+		[7]
Sequence	CTCCTCAGCACAGCCCCTCTACCAGGGGCTCTCCAAATAGG
Motif Score	2.05802381
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000337304.2; ENST00000396680.2; ENST00000404241.6
External Link	RMBase: m6A_site_567326
mod ID: M6ASITE058182		Click to Show/Hide the Full List
mod site	chr22:39522322-39522323:+		[9]
Sequence	TGTGGGTCTGCCCGTCCCAAACCTTACGATCCTCCTGGAGA
Motif Score	2.185083333
Cell/Tissue List	CD34; HEK293T; fibroblasts; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000337304.2; ENST00000404241.6; ENST00000396680.2
External Link	RMBase: m6A_site_567327
mod ID: M6ASITE058183		Click to Show/Hide the Full List
mod site	chr22:39522327-39522328:+		[7]
Sequence	GTCTGCCCGTCCCAAACCTTACGATCCTCCTGGAGAGAAGA
Motif Score	2.046785714
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000404241.6; ENST00000396680.2; ENST00000337304.2
External Link	RMBase: m6A_site_567328
mod ID: M6ASITE058184		Click to Show/Hide the Full List
mod site	chr22:39522376-39522377:+		[9]
Sequence	GCAAAAGTAAAGGGTGAGAAACTGGATAAGAAGCTGAAAAA
Motif Score	2.627720238
Cell/Tissue List	CD34; HEK293T; hNPCs; hESCs; fibroblasts; A549; LCLs; MM6; Huh7; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000337304.2; ENST00000396680.2; ENST00000404241.6
External Link	RMBase: m6A_site_567329
mod ID: M6ASITE058185		Click to Show/Hide the Full List
mod site	chr22:39522408-39522409:+		[9]
Sequence	GCTGAAAAAAATGGAGCAAAACAAGACAGCAGCCACTAGGT
Motif Score	2.20572619
Cell/Tissue List	CD34; HepG2; HEK293T; hESC-HEK293T; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; A549; LCLs; H1299; MM6; Huh7; Jurkat; peripheral-blood; TIME; endometrial; NB4
Seq Type List	m6A-seq; MeRIP-seq; MAZTER-seq
Transcript ID List	ENST00000396680.2; ENST00000404241.6; ENST00000337304.2
External Link	RMBase: m6A_site_567330
mod ID: M6ASITE058186		Click to Show/Hide the Full List
mod site	chr22:39522413-39522414:+		[9]
Sequence	AAAAAATGGAGCAAAACAAGACAGCAGCCACTAGGTACCGC
Motif Score	2.897386905
Cell/Tissue List	CD34; HepG2; HEK293T; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; A549; LCLs; H1299; MM6; Huh7; Jurkat; peripheral-blood; TIME; endometrial; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000404241.6; ENST00000337304.2; ENST00000396680.2
External Link	RMBase: m6A_site_567331
mod ID: M6ASITE058187		Click to Show/Hide the Full List
mod site	chr22:39522634-39522635:+		[7]
Sequence	AGGAGCGTCAATGTGCTTGTACATAGAGTGCTGTAGCTGTG
Motif Score	2.856142857
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000404241.6; ENST00000396680.2; ENST00000337304.2
External Link	RMBase: m6A_site_567332

N7-methylguanosine (m7G)

In total 1 m6A sequence/site(s) in this target gene
mod ID: m7GSITE000095		Click to Show/Hide the Full List
mod site	chr22:39521352-39521353:+		[10]
Sequence	TGGCTTCTGATTCTCATTCAGGCTTCTCACGGCATTCAGCA
Cell/Tissue List	A549; HeLa; HepG2
Seq Type List	BoRed-seq&m7G-RIP-seq; m7G-seq
Transcript ID List	ENST00000396680.2; ENST00000404241.6; ENST00000337304.2
External Link	RMBase: m7G_site_621

Pseudouridine (Pseudo)

In total 1 m6A sequence/site(s) in this target gene
mod ID: PSESITE000183		Click to Show/Hide the Full List
mod site	chr22:39521355-39521356:+		[11]
Sequence	CTTCTGATTCTCATTCAGGCTTCTCACGGCATTCAGCAGCA
Transcript ID List	ENST00000404241.6; ENST00000396680.2; ENST00000337304.2
External Link	RMBase: Pseudo_site_3446

Ref 1	Targeting ATF4-dependent pro-survival autophagy to synergize glutaminolysis inhibition. Theranostics. 2021 Jul 25;11(17):8464-8479. doi: 10.7150/thno.60028. eCollection 2021.
Ref 2	WTAP promotes myocardial ischemia/reperfusion injury by increasing endoplasmic reticulum stress via regulating m(6)A modification of ATF4 mRNA. Aging (Albany NY). 2021 Mar 26;13(8):11135-11149. doi: 10.18632/aging.202770. Epub 2021 Mar 26.
Ref 3	Arginine-482 is not essential for transport of antibiotics, primary bile acids and unconjugated sterols by the human breast cancer resistance protein (ABCG2). Biochem J. 2005 Jan 15;385(Pt 2):419-26.
Ref 4	Nm-seq maps 2'-O-methylation sites in human mRNA with base precision. Nat Methods. 2017 Jul;14(7):695-698. doi: 10.1038/nmeth.4294. Epub 2017 May 15.
Ref 5	5-methylcytosine promotes mRNA export - NSUN2 as the methyltransferase and ALYREF as an m(5)C reader. Cell Res. 2017 May;27(5):606-625. doi: 10.1038/cr.2017.55. Epub 2017 Apr 18.
Ref 6	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 7	DART-seq: an antibody-free method for global m(6)A detection. Nat Methods. 2019 Dec;16(12):1275-1280. doi: 10.1038/s41592-019-0570-0. Epub 2019 Sep 23.
Ref 8	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.
Ref 9	Suppression of m(6)A reader Ythdf2 promotes hematopoietic stem cell expansion. Cell Res. 2018 Sep;28(9):904-917. doi: 10.1038/s41422-018-0072-0. Epub 2018 Jul 31.
Ref 10	METTL1 Promotes let-7 MicroRNA Processing via m7G Methylation. Mol Cell. 2019 Jun 20;74(6):1278-1290.e9. doi: 10.1016/j.molcel.2019.03.040. Epub 2019 Apr 25.
Ref 11	Chemical pulldown reveals dynamic pseudouridylation of the mammalian transcriptome. Nat Chem Biol. 2015 Aug;11(8):592-7. doi: 10.1038/nchembio.1836. Epub 2015 Jun 15.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map