m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00167)
Target Name Putative C->U-editing enzyme APOBEC-4 (APOBEC4)
Synonyms
Apolipoprotein B mRNA-editing enzyme catalytic polypeptide-like 4; C1orf169
    Click to Show/Hide
Gene Name APOBEC4
Chromosomal Location 1q25.3
Family cytidine and deoxycytidylate deaminase family
Function
Putative C to U editing enzyme whose physiological substrate is not yet known.
    Click to Show/Hide
Gene ID 403314
Uniprot ID
ABEC4_HUMAN
HGNC ID
HGNC:32152
KEGG ID
hsa:403314
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
APOBEC4 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Methyltransferase-like 14 (METTL14) [WRITER]
 Regulator Info 
Representative RNA-seq result indicating the expression of this target gene regulated by METTL14
Cell Line CT26 cell line Mus musculus
Treatment: METTL14 knockout CT26 cells
Control: CT26 cells
 GSE142589
Regulation
logFC: 1.15E+00
p-value: 4.95E-02
More Results Click to View More RNA-seq Results
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary Putative C->U-editing enzyme APOBEC-4 (APOBEC4) was found to be significantly correlated with m6A regulators such as WTAP, METTL14, ZC3H13, RBM15B, and FMR1. APOBEC3A was identified as a protective factor from comprehensive analyses based on the immune microenvironment and genomic instability of ovarian cancer. APOBEC3A had the potential to serve as a promising prognostic biomarker for foretelling the survival and immunotherapy response of ovarian cancer patients.
Responsed Disease Ovarian cancer ICD-11: 2C73
 Disease Info 
In-vitro Model HEY Ovarian serous adenocarcinoma Homo sapiens CVCL_0297
THP-1 Childhood acute monocytic leukemia Homo sapiens CVCL_0006
Synaptic functional regulator FMR1 (FMR1) [READER]
 Regulator Info 
Representative RNA-seq result indicating the expression of this target gene regulated by FMR1
Cell Line Neural precursor cells Mus musculus
Treatment: Fmr1 knockout NPCs
Control: Wild type NPCs
 GSE121809
Regulation
logFC: -2.56E+00
p-value: 3.49E-02
More Results Click to View More RNA-seq Results
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary Putative C->U-editing enzyme APOBEC-4 (APOBEC4) was found to be significantly correlated with m6A regulators such as WTAP, METTL14, ZC3H13, RBM15B, and FMR1. APOBEC3A was identified as a protective factor from comprehensive analyses based on the immune microenvironment and genomic instability of ovarian cancer. APOBEC3A had the potential to serve as a promising prognostic biomarker for foretelling the survival and immunotherapy response of ovarian cancer patients.
Responsed Disease Ovarian cancer ICD-11: 2C73
 Disease Info 
In-vitro Model HEY Ovarian serous adenocarcinoma Homo sapiens CVCL_0297
THP-1 Childhood acute monocytic leukemia Homo sapiens CVCL_0006
RNA-binding motif protein 15B (RBM15B) [WRITER]
 Regulator Info 
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary Putative C->U-editing enzyme APOBEC-4 (APOBEC4) was found to be significantly correlated with m6A regulators such as WTAP, METTL14, ZC3H13, RBM15B, and FMR1. APOBEC3A was identified as a protective factor from comprehensive analyses based on the immune microenvironment and genomic instability of ovarian cancer. APOBEC3A had the potential to serve as a promising prognostic biomarker for foretelling the survival and immunotherapy response of ovarian cancer patients.
Responsed Disease Ovarian cancer ICD-11: 2C73
 Disease Info 
In-vitro Model HEY Ovarian serous adenocarcinoma Homo sapiens CVCL_0297
THP-1 Childhood acute monocytic leukemia Homo sapiens CVCL_0006
Wilms tumor 1-associating protein (WTAP) [WRITER]
 Regulator Info 
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary Putative C->U-editing enzyme APOBEC-4 (APOBEC4) was found to be significantly correlated with m6A regulators such as WTAP, METTL14, ZC3H13, RBM15B, and FMR1. APOBEC3A was identified as a protective factor from comprehensive analyses based on the immune microenvironment and genomic instability of ovarian cancer. APOBEC3A had the potential to serve as a promising prognostic biomarker for foretelling the survival and immunotherapy response of ovarian cancer patients.
Responsed Disease Ovarian cancer ICD-11: 2C73
 Disease Info 
In-vitro Model HEY Ovarian serous adenocarcinoma Homo sapiens CVCL_0297
THP-1 Childhood acute monocytic leukemia Homo sapiens CVCL_0006
Zinc finger CCCH domain-containing protein 13 (ZC3H13) [WRITER]
 Regulator Info 
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary Putative C->U-editing enzyme APOBEC-4 (APOBEC4) was found to be significantly correlated with m6A regulators such as WTAP, METTL14, ZC3H13, RBM15B, and FMR1. APOBEC3A was identified as a protective factor from comprehensive analyses based on the immune microenvironment and genomic instability of ovarian cancer. APOBEC3A had the potential to serve as a promising prognostic biomarker for foretelling the survival and immunotherapy response of ovarian cancer patients.
Responsed Disease Ovarian cancer ICD-11: 2C73
 Disease Info 
In-vitro Model HEY Ovarian serous adenocarcinoma Homo sapiens CVCL_0297
THP-1 Childhood acute monocytic leukemia Homo sapiens CVCL_0006
Ovarian cancer [ICD-11: 2C73]
 Disease Info 
In total 5 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [1]
Response Summary Putative C->U-editing enzyme APOBEC-4 (APOBEC4) was found to be significantly correlated with m6A regulators such as WTAP, METTL14, ZC3H13, RBM15B, and FMR1. APOBEC3A was identified as a protective factor from comprehensive analyses based on the immune microenvironment and genomic instability of ovarian cancer. APOBEC3A had the potential to serve as a promising prognostic biomarker for foretelling the survival and immunotherapy response of ovarian cancer patients.
Responsed Disease Ovarian cancer [ICD-11: 2C73]
Target Regulator Methyltransferase-like 14 (METTL14) WRITER
 Regulator Info 
In-vitro Model HEY Ovarian serous adenocarcinoma Homo sapiens CVCL_0297
THP-1 Childhood acute monocytic leukemia Homo sapiens CVCL_0006
Experiment 2 Reporting the m6A-centered Disease Response [1]
Response Summary Putative C->U-editing enzyme APOBEC-4 (APOBEC4) was found to be significantly correlated with m6A regulators such as WTAP, METTL14, ZC3H13, RBM15B, and FMR1. APOBEC3A was identified as a protective factor from comprehensive analyses based on the immune microenvironment and genomic instability of ovarian cancer. APOBEC3A had the potential to serve as a promising prognostic biomarker for foretelling the survival and immunotherapy response of ovarian cancer patients.
Responsed Disease Ovarian cancer [ICD-11: 2C73]
Target Regulator RNA-binding motif protein 15B (RBM15B) WRITER
 Regulator Info 
In-vitro Model HEY Ovarian serous adenocarcinoma Homo sapiens CVCL_0297
THP-1 Childhood acute monocytic leukemia Homo sapiens CVCL_0006
Experiment 3 Reporting the m6A-centered Disease Response [1]
Response Summary Putative C->U-editing enzyme APOBEC-4 (APOBEC4) was found to be significantly correlated with m6A regulators such as WTAP, METTL14, ZC3H13, RBM15B, and FMR1. APOBEC3A was identified as a protective factor from comprehensive analyses based on the immune microenvironment and genomic instability of ovarian cancer. APOBEC3A had the potential to serve as a promising prognostic biomarker for foretelling the survival and immunotherapy response of ovarian cancer patients.
Responsed Disease Ovarian cancer [ICD-11: 2C73]
Target Regulator Synaptic functional regulator FMR1 (FMR1) READER
 Regulator Info 
In-vitro Model HEY Ovarian serous adenocarcinoma Homo sapiens CVCL_0297
THP-1 Childhood acute monocytic leukemia Homo sapiens CVCL_0006
Experiment 4 Reporting the m6A-centered Disease Response [1]
Response Summary Putative C->U-editing enzyme APOBEC-4 (APOBEC4) was found to be significantly correlated with m6A regulators such as WTAP, METTL14, ZC3H13, RBM15B, and FMR1. APOBEC3A was identified as a protective factor from comprehensive analyses based on the immune microenvironment and genomic instability of ovarian cancer. APOBEC3A had the potential to serve as a promising prognostic biomarker for foretelling the survival and immunotherapy response of ovarian cancer patients.
Responsed Disease Ovarian cancer [ICD-11: 2C73]
Target Regulator Wilms tumor 1-associating protein (WTAP) WRITER
 Regulator Info 
In-vitro Model HEY Ovarian serous adenocarcinoma Homo sapiens CVCL_0297
THP-1 Childhood acute monocytic leukemia Homo sapiens CVCL_0006
Experiment 5 Reporting the m6A-centered Disease Response [1]
Response Summary Putative C->U-editing enzyme APOBEC-4 (APOBEC4) was found to be significantly correlated with m6A regulators such as WTAP, METTL14, ZC3H13, RBM15B, and FMR1. APOBEC3A was identified as a protective factor from comprehensive analyses based on the immune microenvironment and genomic instability of ovarian cancer. APOBEC3A had the potential to serve as a promising prognostic biomarker for foretelling the survival and immunotherapy response of ovarian cancer patients.
Responsed Disease Ovarian cancer [ICD-11: 2C73]
Target Regulator Zinc finger CCCH domain-containing protein 13 (ZC3H13) WRITER
 Regulator Info 
In-vitro Model HEY Ovarian serous adenocarcinoma Homo sapiens CVCL_0297
THP-1 Childhood acute monocytic leukemia Homo sapiens CVCL_0006
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00167)
Putative C->U-editing enzyme APOBEC-4 (APOBEC4)
N6-methyladenosine (m6A)
In total 4 m6A sequence/site(s) in this target gene
mod ID: M6ASITE071008 Click to Show/Hide the Full List
mod site chr1:183653081-183653082:- [2]
Sequence AATGTGATCCAAGCCTGGAGACAAATTGATGGTAATTATAA
Motif Score 2.897386905
Cell/Tissue List endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000308641.6; ENST00000481562.1
External Link RMBase: m6A_site_68544
mod ID: M6ASITE071009 Click to Show/Hide the Full List
mod site chr1:183653122-183653123:- [2]
Sequence GGAGAAAAAAAAGGAAATGGACCATCTCTTCTAACACCTGG
Motif Score 3.622404762
Cell/Tissue List endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000308641.6; ENST00000481562.1
External Link RMBase: m6A_site_68545
mod ID: M6ASITE071010 Click to Show/Hide the Full List
mod site chr1:183653149-183653150:- [2]
Sequence TACTTGAAACAGGGCATGGGACTTAAAGGAGAAAAAAAAGG
Motif Score 4.065041667
Cell/Tissue List endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000308641.6; ENST00000481562.1
External Link RMBase: m6A_site_68546
mod ID: M6ASITE071011 Click to Show/Hide the Full List
mod site chr1:183653161-183653162:- [2]
Sequence GCCTTCTGAAGCTACTTGAAACAGGGCATGGGACTTAAAGG
Motif Score 2.20572619
Cell/Tissue List endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000308641.6; ENST00000481562.1
External Link RMBase: m6A_site_68547