m6A Target Gene Information
General Information of the m6A Target Gene (ID: M6ATAR00078)
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
KCNMB2-AS1
can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Insulin-like growth factor 2 mRNA-binding protein 3 (IGF2BP3) [READER]
| In total 1 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [1] | |||
| Response Summary | KCNMB2 antisense RNA 1 (KCNMB2-AS1) and IGF2BP3 formed a positive regulatory circuit that enlarged the tumorigenic effect of KCNMB2-AS1 in cervical cancer. | |||
| Target Regulation | Up regulation | |||
| Responsed Disease | Cervical cancer | ICD-11: 2C77 | ||
| Cell Process | Cell proliferation | |||
| Cell apoptosis | ||||
| In-vitro Model | HeLa | Endocervical adenocarcinoma | Homo sapiens | CVCL_0030 |
| SiHa | Cervical squamous cell carcinoma | Homo sapiens | CVCL_0032 | |
| In-vivo Model | A total of 1 × 107 control or KCNMB2-AS1-depleted SiHa cells were resuspended in 0.1 ml phosphate-buffered saline and inoculated into the armpit of 5-week-old male BALB/c nude mice. | |||
Cervical cancer [ICD-11: 2C77]
| In total 1 item(s) under this disease | ||||
| Experiment 1 Reporting the m6A-centered Disease Response | [1] | |||
| Response Summary | KCNMB2 antisense RNA 1 (KCNMB2-AS1) and IGF2BP3 formed a positive regulatory circuit that enlarged the tumorigenic effect of KCNMB2-AS1 in cervical cancer. | |||
| Responsed Disease | Cervical cancer [ICD-11: 2C77] | |||
| Target Regulator | Insulin-like growth factor 2 mRNA-binding protein 3 (IGF2BP3) | READER | ||
| Target Regulation | Up regulation | |||
| Cell Process | Cell proliferation | |||
| Cell apoptosis | ||||
| In-vitro Model | HeLa | Endocervical adenocarcinoma | Homo sapiens | CVCL_0030 |
| SiHa | Cervical squamous cell carcinoma | Homo sapiens | CVCL_0032 | |
| In-vivo Model | A total of 1 × 107 control or KCNMB2-AS1-depleted SiHa cells were resuspended in 0.1 ml phosphate-buffered saline and inoculated into the armpit of 5-week-old male BALB/c nude mice. | |||
Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator
Non-coding RNA
m6A Regulator: Insulin-like growth factor 2 mRNA-binding protein 3 (IGF2BP3)
| In total 6 item(s) under this m6A regulator | ||
| Crosstalk ID: M6ACROT05015 | ||
| Epigenetic Regulator | DARS1 antisense RNA 1 (DARS1-AS1) | |
| Regulated Target | Insulin like growth factor 2 mRNA binding protein 3 (IGF2BP3) | |
| Crosstalk relationship | ncRNA → m6A | |
| Disease | Cervical cancer | |
| Crosstalk ID: M6ACROT05331 | ||
| Epigenetic Regulator | KCNMB2 antisense RNA 1 (KCNMB2-AS1) | |
| Regulated Target | hsa-miR-130b-5p | |
| Crosstalk relationship | ncRNA → m6A | |
| Disease | Cervical cancer | |
| Crosstalk ID: M6ACROT05332 | ||
| Epigenetic Regulator | KCNMB2 antisense RNA 1 (KCNMB2-AS1) | |
| Regulated Target | hsa-miR-4294 | |
| Crosstalk relationship | ncRNA → m6A | |
| Disease | Cervical cancer | |
| Crosstalk ID: M6ACROT05333 | ||
| Epigenetic Regulator | hsa-miR-130b-5p | |
| Regulated Target | Insulin like growth factor 2 mRNA binding protein 3 (IGF2BP3) | |
| Crosstalk relationship | ncRNA → m6A | |
| Disease | Cervical cancer | |
| Crosstalk ID: M6ACROT05334 | ||
| Epigenetic Regulator | hsa-miR-4294 | |
| Regulated Target | Insulin like growth factor 2 mRNA binding protein 3 (IGF2BP3) | |
| Crosstalk relationship | ncRNA → m6A | |
| Disease | Cervical cancer | |
| Crosstalk ID: M6ACROT05448 | ||
| Epigenetic Regulator | KCNMB2 antisense RNA 1 (KCNMB2-AS1) | |
| Regulated Target | hsa-miR-130b-5p | |
| Crosstalk relationship | m6A → ncRNA | |
| Disease | Cervical cancer | |
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00078)
| In total 4 m6A sequence/site(s) in this target gene | |||
| mod ID: M6ASITE063083 | Click to Show/Hide the Full List | ||
| mod site | chr3:178749131-178749132:- | [2] | |
| Sequence | GGAAGAAAAACTAAGTGAAGACAAAAGAAGGATTTGAACTG | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000425330.1; ENST00000451742.5; ENST00000437488.5; ENST00000432385.5; ENST00000421498.1 | ||
| External Link | RMBase: m6A_site_618910 | ||
| mod ID: M6ASITE063084 | Click to Show/Hide the Full List | ||
| mod site | chr3:178749196-178749197:- | [2] | |
| Sequence | CTTCATAACAACTGTGTGAAACATATTAATATCCTCATTGT | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000437488.5; ENST00000432385.5; ENST00000421498.1; ENST00000425330.1; ENST00000451742.5 | ||
| External Link | RMBase: m6A_site_618911 | ||
| mod ID: M6ASITE063085 | Click to Show/Hide the Full List | ||
| mod site | chr3:178801829-178801830:- | [3] | |
| Sequence | CAACATTTGTACTACACCAGACCAGCTCTCTTCTAAGGTTG | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | Huh7 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | rmsk_1178399; ENST00000421498.1; ENST00000437488.5; ENST00000432385.5; ENST00000425330.1; ENST00000451742.5 | ||
| External Link | RMBase: m6A_site_618912 | ||
| mod ID: M6ASITE063086 | Click to Show/Hide the Full List | ||
| mod site | chr3:178801896-178801897:- | [3] | |
| Sequence | GTGGGGACCAAAACATTCAGACCTGCTTCTAAGGAGTGCAG | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | Huh7 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000421498.1; ENST00000425330.1; ENST00000432385.5; ENST00000451742.5; ENST00000437488.5 | ||
| External Link | RMBase: m6A_site_618913 | ||
References