General Information of the m6A Target Gene (ID: M6ATAR00078)
Target Name KCNMB2 antisense RNA 1 (KCNMB2-AS1)
Synonyms
KCNMB2-AS1; RP11-385J1.2
    Click to Show/Hide
Gene Name KCNMB2-AS1
Chromosomal Location 3q26.32
Family Antisense RNAs
Gene ID 104797538
HGNC ID
HGNC:51409
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
KCNMB2-AS1 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Insulin-like growth factor 2 mRNA-binding protein 3 (IGF2BP3) [READER]
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary KCNMB2 antisense RNA 1 (KCNMB2-AS1) and IGF2BP3 formed a positive regulatory circuit that enlarged the tumorigenic effect of KCNMB2-AS1 in cervical cancer.
Target Regulation Up regulation
Responsed Disease Cervical cancer ICD-11: 2C77
Cell Process Cell proliferation
Cell apoptosis
In-vitro Model HeLa Endocervical adenocarcinoma Homo sapiens CVCL_0030
SiHa Cervical squamous cell carcinoma Homo sapiens CVCL_0032
In-vivo Model A total of 1 × 107 control or KCNMB2-AS1-depleted SiHa cells were resuspended in 0.1 ml phosphate-buffered saline and inoculated into the armpit of 5-week-old male BALB/c nude mice.
Cervical cancer [ICD-11: 2C77]
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [1]
Response Summary KCNMB2 antisense RNA 1 (KCNMB2-AS1) and IGF2BP3 formed a positive regulatory circuit that enlarged the tumorigenic effect of KCNMB2-AS1 in cervical cancer.
Responsed Disease Cervical cancer [ICD-11: 2C77]
Target Regulator Insulin-like growth factor 2 mRNA-binding protein 3 (IGF2BP3) READER
Target Regulation Up regulation
Cell Process Cell proliferation
Cell apoptosis
In-vitro Model HeLa Endocervical adenocarcinoma Homo sapiens CVCL_0030
SiHa Cervical squamous cell carcinoma Homo sapiens CVCL_0032
In-vivo Model A total of 1 × 107 control or KCNMB2-AS1-depleted SiHa cells were resuspended in 0.1 ml phosphate-buffered saline and inoculated into the armpit of 5-week-old male BALB/c nude mice.
Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator
Non-coding RNA
m6A Regulator: Insulin-like growth factor 2 mRNA-binding protein 3 (IGF2BP3)
In total 6 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05015
Epigenetic Regulator DARS1 antisense RNA 1 (DARS1-AS1)
Regulated Target Insulin like growth factor 2 mRNA binding protein 3 (IGF2BP3)
Crosstalk relationship ncRNA → m6A
Disease Cervical cancer
Crosstalk ID: M6ACROT05331
Epigenetic Regulator KCNMB2 antisense RNA 1 (KCNMB2-AS1)
Regulated Target hsa-miR-130b-5p
Crosstalk relationship ncRNA → m6A
Disease Cervical cancer
Crosstalk ID: M6ACROT05332
Epigenetic Regulator KCNMB2 antisense RNA 1 (KCNMB2-AS1)
Regulated Target hsa-miR-4294
Crosstalk relationship ncRNA → m6A
Disease Cervical cancer
Crosstalk ID: M6ACROT05333
Epigenetic Regulator hsa-miR-130b-5p
Regulated Target Insulin like growth factor 2 mRNA binding protein 3 (IGF2BP3)
Crosstalk relationship ncRNA → m6A
Disease Cervical cancer
Crosstalk ID: M6ACROT05334
Epigenetic Regulator hsa-miR-4294
Regulated Target Insulin like growth factor 2 mRNA binding protein 3 (IGF2BP3)
Crosstalk relationship ncRNA → m6A
Disease Cervical cancer
Crosstalk ID: M6ACROT05448
Epigenetic Regulator KCNMB2 antisense RNA 1 (KCNMB2-AS1)
Regulated Target hsa-miR-130b-5p
Crosstalk relationship m6A → ncRNA
Disease Cervical cancer
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00078)
KCNMB2 antisense RNA 1 (KCNMB2-AS1)
N6-methyladenosine (m6A)
In total 4 m6A sequence/site(s) in this target gene
mod ID: M6ASITE063083 Click to Show/Hide the Full List
mod site chr3:178749131-178749132:- [2]
Sequence GGAAGAAAAACTAAGTGAAGACAAAAGAAGGATTTGAACTG
Motif Score 2.897386905
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000425330.1; ENST00000451742.5; ENST00000437488.5; ENST00000432385.5; ENST00000421498.1
External Link RMBase: m6A_site_618910
mod ID: M6ASITE063084 Click to Show/Hide the Full List
mod site chr3:178749196-178749197:- [2]
Sequence CTTCATAACAACTGTGTGAAACATATTAATATCCTCATTGT
Motif Score 2.20572619
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000437488.5; ENST00000432385.5; ENST00000421498.1; ENST00000425330.1; ENST00000451742.5
External Link RMBase: m6A_site_618911
mod ID: M6ASITE063085 Click to Show/Hide the Full List
mod site chr3:178801829-178801830:- [3]
Sequence CAACATTTGTACTACACCAGACCAGCTCTCTTCTAAGGTTG
Motif Score 2.876744048
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List rmsk_1178399; ENST00000421498.1; ENST00000437488.5; ENST00000432385.5; ENST00000425330.1; ENST00000451742.5
External Link RMBase: m6A_site_618912
mod ID: M6ASITE063086 Click to Show/Hide the Full List
mod site chr3:178801896-178801897:- [3]
Sequence GTGGGGACCAAAACATTCAGACCTGCTTCTAAGGAGTGCAG
Motif Score 2.876744048
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000421498.1; ENST00000425330.1; ENST00000432385.5; ENST00000451742.5; ENST00000437488.5
External Link RMBase: m6A_site_618913