m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00664)

Target Name	Polycomb complex protein BMI-1 (BMI1)
Synonyms	Polycomb group RING finger protein 4; RING finger protein 51 Click to Show/Hide
Gene Name	BMI1
Chromosomal Location	10p12.2
Function	Component of a Polycomb group (PcG) multiprotein PRC1-like complex, a complex class required to maintain the transcriptionally repressive state of many genes, including Hox genes, throughout development. PcG PRC1 complex acts via chromatin remodeling and modification of histones; it mediates monoubiquitination of histone H2A 'Lys-119', rendering chromatin heritably changed in its expressibility. The complex composed of RNF2, UB2D3 and BMI1 binds nucleosomes, and has activity only with nucleosomal histone H2A. In the PRC1-like complex, regulates the E3 ubiquitin-protein ligase activity of RNF2/RING2. Click to Show/Hide
Gene ID	648
Uniprot ID	BMI1_HUMAN
HGNC ID	HGNC:1066
KEGG ID	hsa:100532731

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

BMI1 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Insulin-like growth factor 2 mRNA-binding protein 1 (IGF2BP1) [READER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by IGF2BP1*
Cell Line	PANC-1 cell line	Homo sapiens
Treatment: siIGF2BP1 PANC-1 cells Control: siControl PANC-1 cells		GSE161087
Regulation		logFC: -6.85E-01 p-value: 1.16E-03
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	METTL3 promotes Polycomb complex protein BMI-1 (BMI1) translation in OSCC under the cooperation with m6A reader IGF2BP1. And the study revealed that METTL3 promotes OSCC proliferation and metastasis through BMI1 m6A methylation.
Target Regulation	Up regulation
Responsed Disease	Oral squamous cell carcinoma		ICD-11: 2B6E.0	Disease Info
In-vitro Model	UM1	Tongue squamous cell carcinoma	Homo sapiens	CVCL_VH00
	SCC-9	Tongue squamous cell carcinoma	Homo sapiens	CVCL_1685
	SCC-25	Tongue squamous cell carcinoma	Homo sapiens	CVCL_1682
	SCC-15	Tongue squamous cell carcinoma	Homo sapiens	CVCL_1681
	HSC-3	Tongue squamous cell carcinoma	Homo sapiens	CVCL_1288
	HOK	Normal	Hexagrammos otakii	CVCL_YE19
In-vivo Model	To construct the subcutaneous tumorigenesis model, the cells were suspended in 100 uL of PBS and Matrigel matrix (BD Biosciences, USA) (1:1) and injected into the right flanks of 6-week-old female BALB/c nude mice.To construct the lymph node metastasis model, we injected 1 × 10⁵/50 uL stably infected SCC9 cells into the left hind footpads of BALB/c mice.

Methyltransferase-like 3 (METTL3) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by METTL3*
Cell Line	Pancreatic islets	Mus musculus
Treatment: Mettl3 knockout mice Control: Mettl3 flox/flox mice		GSE155612
Regulation		logFC: 5.95E-01 p-value: 1.91E-03
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	METTL3 promotes Polycomb complex protein BMI-1 (BMI1) translation in OSCC under the cooperation with m6A reader IGF2BP1. And the study revealed that METTL3 promotes OSCC proliferation and metastasis through BMI1 m6A methylation.
Target Regulation	Up regulation
Responsed Disease	Oral squamous cell carcinoma		ICD-11: 2B6E.0	Disease Info
In-vitro Model	UM1	Tongue squamous cell carcinoma	Homo sapiens	CVCL_VH00
	SCC-9	Tongue squamous cell carcinoma	Homo sapiens	CVCL_1685
	SCC-25	Tongue squamous cell carcinoma	Homo sapiens	CVCL_1682
	SCC-15	Tongue squamous cell carcinoma	Homo sapiens	CVCL_1681
	HSC-3	Tongue squamous cell carcinoma	Homo sapiens	CVCL_1288
	HOK	Normal	Hexagrammos otakii	CVCL_YE19
In-vivo Model	To construct the subcutaneous tumorigenesis model, the cells were suspended in 100 uL of PBS and Matrigel matrix (BD Biosciences, USA) (1:1) and injected into the right flanks of 6-week-old female BALB/c nude mice.To construct the lymph node metastasis model, we injected 1 × 10⁵/50 uL stably infected SCC9 cells into the left hind footpads of BALB/c mice.

Head and neck squamous carcinoma [ICD-11: 2B6E]

Disease Info

In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	METTL3 promotes Polycomb complex protein BMI-1 (BMI1) translation in OSCC under the cooperation with m6A reader IGF2BP1. And the study revealed that METTL3 promotes OSCC proliferation and metastasis through BMI1 m6A methylation.
Responsed Disease	Oral squamous cell carcinoma [ICD-11: 2B6E.0]
Target Regulator	Insulin-like growth factor 2 mRNA-binding protein 1 (IGF2BP1)		READER	Regulator Info
Target Regulation	Up regulation
In-vitro Model	UM1	Tongue squamous cell carcinoma	Homo sapiens	CVCL_VH00
	SCC-9	Tongue squamous cell carcinoma	Homo sapiens	CVCL_1685
	SCC-25	Tongue squamous cell carcinoma	Homo sapiens	CVCL_1682
	SCC-15	Tongue squamous cell carcinoma	Homo sapiens	CVCL_1681
	HSC-3	Tongue squamous cell carcinoma	Homo sapiens	CVCL_1288
	HOK	Normal	Hexagrammos otakii	CVCL_YE19
In-vivo Model	To construct the subcutaneous tumorigenesis model, the cells were suspended in 100 uL of PBS and Matrigel matrix (BD Biosciences, USA) (1:1) and injected into the right flanks of 6-week-old female BALB/c nude mice.To construct the lymph node metastasis model, we injected 1 × 10⁵/50 uL stably infected SCC9 cells into the left hind footpads of BALB/c mice.
Experiment 2 Reporting the m6A-centered Disease Response				[1]
Response Summary	METTL3 promotes Polycomb complex protein BMI-1 (BMI1) translation in OSCC under the cooperation with m6A reader IGF2BP1. And the study revealed that METTL3 promotes OSCC proliferation and metastasis through BMI1 m6A methylation.
Responsed Disease	Oral squamous cell carcinoma [ICD-11: 2B6E.0]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
In-vitro Model	UM1	Tongue squamous cell carcinoma	Homo sapiens	CVCL_VH00
	SCC-9	Tongue squamous cell carcinoma	Homo sapiens	CVCL_1685
	SCC-25	Tongue squamous cell carcinoma	Homo sapiens	CVCL_1682
	SCC-15	Tongue squamous cell carcinoma	Homo sapiens	CVCL_1681
	HSC-3	Tongue squamous cell carcinoma	Homo sapiens	CVCL_1288
	HOK	Normal	Hexagrammos otakii	CVCL_YE19
In-vivo Model	To construct the subcutaneous tumorigenesis model, the cells were suspended in 100 uL of PBS and Matrigel matrix (BD Biosciences, USA) (1:1) and injected into the right flanks of 6-week-old female BALB/c nude mice.To construct the lymph node metastasis model, we injected 1 × 10⁵/50 uL stably infected SCC9 cells into the left hind footpads of BALB/c mice.

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00664)

Polycomb complex protein BMI-1 (BMI1)

5-methylcytidine (m5C)

In total 1 m6A sequence/site(s) in this target gene
mod ID: M5CSITE004686		Click to Show/Hide the Full List
mod site	chr10:22321602-22321603:+		[2]
Sequence	GCAGCTCGCTTCAAGATGGCCGCTTGGCTCGCATTCATTTT
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000376663.8; ENST00000475460.6; ENST00000602390.5; ENST00000463409.6; ENST00000417470.1; ENST00000602395.1; ENST00000602523.1; ENST00000456675.2; ENST00000489125.2
External Link	RMBase: m5C_site_5126

N6-methyladenosine (m6A)

In total 83 m6A sequence/site(s) in this target gene
mod ID: M6ASITE095766		Click to Show/Hide the Full List
mod site	chr10:22321258-22321259:+		[3]
Sequence	GAGGCAGAGATCGGGGCGAGACAATGGGGATGTGGGCGCGG
Motif Score	2.897386905
Cell/Tissue List	HeLa; A549; U2OS; HEK293T; MT4; MM6; Jurkat; CD4T; GSC-11; HEK293A-TOA; MSC; GSCs
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000602390.5; ENST00000417470.1; ENST00000463409.6; ENST00000489125.2; ENST00000376663.8; ENST00000475460.6; ENST00000602395.1
External Link	RMBase: m6A_site_94937
mod ID: M6ASITE095767		Click to Show/Hide the Full List
mod site	chr10:22321325-22321326:+		[3]
Sequence	TCCCAGCCCCGCAGAATAAAACCGATCGCGCCCCCTCCGCG
Motif Score	2.185083333
Cell/Tissue List	HeLa; HepG2; A549; U2OS; HEK293T; MT4; MM6; Jurkat; CD4T; GSC-11; HEK293A-TOA; MSC; TIME; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000602395.1; ENST00000463409.6; ENST00000475460.6; ENST00000376663.8; ENST00000417470.1; ENST00000602390.5; ENST00000489125.2
External Link	RMBase: m6A_site_94938
mod ID: M6ASITE095768		Click to Show/Hide the Full List
mod site	chr10:22326458-22326459:+		[3]
Sequence	ATCAAGCAGAAATGCATCGAACAACGAGAATCAAGATCACT
Motif Score	2.951386905
Cell/Tissue List	HeLa; hESC-HEK293T
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000602523.1; ENST00000463409.6; ENST00000416820.5; ENST00000602524.1; ENST00000456675.2; ENST00000602390.5; ENST00000376663.8; ENST00000417470.1; ENST00000475460.6; ENST00000442508.5; ENST00000602358.5; ENST00000602395.1; ENST00000489125.2
External Link	RMBase: m6A_site_94939
mod ID: M6ASITE095769		Click to Show/Hide the Full List
mod site	chr10:22326533-22326534:+		[4]
Sequence	GAGGGTACTTCATTGATGCCACAACCATAATAGAATGTCTA
Motif Score	2.053113095
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000416820.5; ENST00000602524.1; ENST00000456675.2; ENST00000376663.8; ENST00000442508.5; ENST00000602358.5; ENST00000602523.1; ENST00000475460.6; ENST00000417470.1; ENST00000443519.1; ENST00000602390.5
External Link	RMBase: m6A_site_94940
mod ID: M6ASITE095770		Click to Show/Hide the Full List
mod site	chr10:22326553-22326554:+		[4]
Sequence	ACAACCATAATAGAATGTCTACATTCCTGTAAGTACCGAGC
Motif Score	2.078666667
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000417470.1; ENST00000602523.1; ENST00000376663.8; ENST00000443519.1; ENST00000602358.5; ENST00000456675.2; ENST00000602524.1; ENST00000602390.5; ENST00000416820.5; ENST00000442508.5; ENST00000475460.6
External Link	RMBase: m6A_site_94941
mod ID: M6ASITE095771		Click to Show/Hide the Full List
mod site	chr10:22326627-22326628:+		[3]
Sequence	GTTCGACCTGGAATTTGAAAACTGTTAATGATTCCTGCAAT
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000602523.1; ENST00000443519.1; ENST00000442508.5; ENST00000376663.8; ENST00000417470.1; ENST00000602358.5; ENST00000456675.2; ENST00000602524.1; ENST00000602390.5; ENST00000416820.5
External Link	RMBase: m6A_site_94942
mod ID: M6ASITE095772		Click to Show/Hide the Full List
mod site	chr10:22326913-22326914:+		[5]
Sequence	TAAAACGTGTATTGTTCGTTACCTGGAGACCAGCAAGTATT
Motif Score	2.052208333
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000602358.5; ENST00000416820.5; ENST00000456675.2; ENST00000602390.5; ENST00000417470.1; ENST00000376663.8; ENST00000443519.1; ENST00000442508.5; ENST00000602523.1
External Link	RMBase: m6A_site_94943
mod ID: M6ASITE095773		Click to Show/Hide the Full List
mod site	chr10:22326921-22326922:+		[3]
Sequence	GTATTGTTCGTTACCTGGAGACCAGCAAGTATTGTCCTATT
Motif Score	2.876744048
Cell/Tissue List	HeLa; CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000443519.1; ENST00000602523.1; ENST00000416820.5; ENST00000376663.8; ENST00000442508.5; ENST00000456675.2; ENST00000417470.1; ENST00000602390.5; ENST00000602358.5
External Link	RMBase: m6A_site_94944
mod ID: M6ASITE095774		Click to Show/Hide the Full List
mod site	chr10:22326958-22326959:+		[4]
Sequence	TATTTGTGATGTCCAAGTTCACAAGACCAGACCACTACTGA
Motif Score	2.047297619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000602390.5; ENST00000416820.5; ENST00000417470.1; ENST00000443519.1; ENST00000456675.2; ENST00000376663.8; ENST00000442508.5; ENST00000602358.5
External Link	RMBase: m6A_site_94945
mod ID: M6ASITE095775		Click to Show/Hide the Full List
mod site	chr10:22326963-22326964:+		[3]
Sequence	GTGATGTCCAAGTTCACAAGACCAGACCACTACTGAATATA
Motif Score	2.876744048
Cell/Tissue List	HeLa; CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000376663.8; ENST00000442508.5; ENST00000417470.1; ENST00000456675.2; ENST00000602358.5; ENST00000416820.5; ENST00000602390.5; ENST00000443519.1
External Link	RMBase: m6A_site_94946
mod ID: M6ASITE095776		Click to Show/Hide the Full List
mod site	chr10:22326968-22326969:+		[3]
Sequence	GTCCAAGTTCACAAGACCAGACCACTACTGAATATAAGGTA
Motif Score	2.876744048
Cell/Tissue List	HeLa; CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000376663.8; ENST00000442508.5; ENST00000602358.5; ENST00000602390.5; ENST00000417470.1; ENST00000456675.2; ENST00000443519.1; ENST00000416820.5
External Link	RMBase: m6A_site_94947
mod ID: M6ASITE095777		Click to Show/Hide the Full List
mod site	chr10:22327604-22327605:+		[3]
Sequence	TATTTTTCAGGTCAGATAAAACTCTCCAAGATATTGTATAC
Motif Score	2.627720238
Cell/Tissue List	HeLa; CD34; AML
Seq Type List	m6A-seq; miCLIP
Transcript ID List	ENST00000443519.1; ENST00000602390.5; ENST00000376663.8; ENST00000417470.1; ENST00000602358.5; ENST00000416820.5; ENST00000442508.5; ENST00000456675.2
External Link	RMBase: m6A_site_94948
mod ID: M6ASITE095778		Click to Show/Hide the Full List
mod site	chr10:22327623-22327624:+		[4]
Sequence	AACTCTCCAAGATATTGTATACAAATTAGTTCCAGGGCTTT
Motif Score	2.110482143
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000456675.2; ENST00000602390.5; ENST00000416820.5; ENST00000417470.1; ENST00000376663.8; ENST00000443519.1; ENST00000602358.5; ENST00000442508.5
External Link	RMBase: m6A_site_94949
mod ID: M6ASITE095779		Click to Show/Hide the Full List
mod site	chr10:22327796-22327797:+		[6]
Sequence	CATCCTTCTGCTGATGGTAAACCTTTTAGGGGAGGGAAGAC
Motif Score	2.185083333
Cell/Tissue List	CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000602358.5; ENST00000456675.2; ENST00000602390.5; ENST00000442508.5; ENST00000417470.1; ENST00000443519.1; ENST00000376663.8
External Link	RMBase: m6A_site_94950
mod ID: M6ASITE095780		Click to Show/Hide the Full List
mod site	chr10:22328008-22328009:+		[5]
Sequence	ATGAAGATAAGAGAATTATAACTGATGATGAGATAATAAGC
Motif Score	2.590089286
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000376663.8; ENST00000417470.1; ENST00000442508.5; ENST00000490311.1; ENST00000602358.5; ENST00000443519.1; ENST00000602390.5; ENST00000496174.5
External Link	RMBase: m6A_site_94951
mod ID: M6ASITE095781		Click to Show/Hide the Full List
mod site	chr10:22328054-22328055:+		[3]
Sequence	CATTGAATTCTTTGACCAGAACAGGTAAAATCTTTAGGCAA
Motif Score	2.951386905
Cell/Tissue List	HeLa; CD34; HEK293T; hNPCs
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000602358.5; ENST00000443519.1; ENST00000496174.5; ENST00000376663.8; ENST00000442508.5; ENST00000417470.1; ENST00000602390.5; ENST00000490311.1
External Link	RMBase: m6A_site_94952
mod ID: M6ASITE095782		Click to Show/Hide the Full List
mod site	chr10:22328150-22328151:+		[3]
Sequence	TAGATTGGATCGGAAAGTAAACAAAGACAAAGAGAAATCTA
Motif Score	2.20572619
Cell/Tissue List	HeLa; CD34; HEK293T; hNPCs
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000442508.5; ENST00000602390.5; ENST00000417470.1; ENST00000443519.1; ENST00000490311.1; ENST00000602358.5; ENST00000376663.8; ENST00000496174.5
External Link	RMBase: m6A_site_94953
mod ID: M6ASITE095783		Click to Show/Hide the Full List
mod site	chr10:22328156-22328157:+		[3]
Sequence	GGATCGGAAAGTAAACAAAGACAAAGAGAAATCTAAGGAGG
Motif Score	2.897386905
Cell/Tissue List	HeLa; HEK293T; hESC-HEK293T; hNPCs; fibroblasts; A549; Huh7
Seq Type List	m6A-seq; MeRIP-seq; MAZTER-seq
Transcript ID List	ENST00000602390.5; ENST00000496174.5; ENST00000376663.8; ENST00000602358.5; ENST00000442508.5; ENST00000443519.1; ENST00000417470.1; ENST00000490311.1
External Link	RMBase: m6A_site_94954
mod ID: M6ASITE095784		Click to Show/Hide the Full List
mod site	chr10:22328678-22328679:+		[3]
Sequence	GTTTCTCAGAAGTAAAATGGACATACCTAATACTTTCCAGG
Motif Score	3.643047619
Cell/Tissue List	HeLa; HEK293T; hESC-HEK293T; U2OS; hNPCs; fibroblasts; A549; Huh7
Seq Type List	m6A-seq; MeRIP-seq; MAZTER-seq
Transcript ID List	ENST00000602390.5; ENST00000376663.8; ENST00000490311.1; ENST00000496174.5; ENST00000443519.1; ENST00000417470.1
External Link	RMBase: m6A_site_94955
mod ID: M6ASITE095785		Click to Show/Hide the Full List
mod site	chr10:22329070-22329071:+		[3]
Sequence	GATGTCATGTATGAGGAGGAACCTTTAAAGGATTATTATAC
Motif Score	2.930744048
Cell/Tissue List	HeLa; HEK293T; U2OS; hNPCs; fibroblasts; A549; Huh7; HEK293A-TOA
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000417470.1; ENST00000443519.1; ENST00000602390.5; ENST00000490311.1; ENST00000376663.8; ENST00000496174.5
External Link	RMBase: m6A_site_94956
mod ID: M6ASITE095786		Click to Show/Hide the Full List
mod site	chr10:22329089-22329090:+		[4]
Sequence	AACCTTTAAAGGATTATTATACACTAATGGATATTGCCTAC
Motif Score	2.110482143
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000443519.1; ENST00000490311.1; ENST00000376663.8; ENST00000417470.1; ENST00000496174.5; ENST00000602390.5
External Link	RMBase: m6A_site_94957
mod ID: M6ASITE095787		Click to Show/Hide the Full List
mod site	chr10:22329108-22329109:+		[5]
Sequence	TACACTAATGGATATTGCCTACATTTATACCTGGAGAAGGG
Motif Score	2.078666667
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000376663.8; ENST00000602390.5; ENST00000490311.1; ENST00000443519.1
External Link	RMBase: m6A_site_94958
mod ID: M6ASITE095788		Click to Show/Hide the Full List
mod site	chr10:22329286-22329287:+		[3]
Sequence	ATCAGTCACCAGAGAGATGGACTGACAAATGCTGGAGAACT
Motif Score	4.065041667
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1B; hNPCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List	ENST00000490311.1; ENST00000376663.8; ENST00000443519.1; ENST00000602390.5
External Link	RMBase: m6A_site_94959
mod ID: M6ASITE095789		Click to Show/Hide the Full List
mod site	chr10:22329290-22329291:+		[5]
Sequence	GTCACCAGAGAGATGGACTGACAAATGCTGGAGAACTGGAA
Motif Score	2.859755952
Cell/Tissue List	HEK293T; hESC-HEK293T; CD8T; A549
Seq Type List	DART-seq; MAZTER-seq; m6A-CLIP/IP
Transcript ID List	ENST00000602390.5; ENST00000376663.8; ENST00000443519.1; ENST00000490311.1
External Link	RMBase: m6A_site_94960
mod ID: M6ASITE095790		Click to Show/Hide the Full List
mod site	chr10:22329304-22329305:+		[3]
Sequence	GGACTGACAAATGCTGGAGAACTGGAAAGTGACTCTGGGAG
Motif Score	3.373380952
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List	ENST00000602390.5; ENST00000376663.8; ENST00000490311.1; ENST00000443519.1
External Link	RMBase: m6A_site_94961
mod ID: M6ASITE095791		Click to Show/Hide the Full List
mod site	chr10:22329315-22329316:+		[7]
Sequence	TGCTGGAGAACTGGAAAGTGACTCTGGGAGTGACAAGGCCA
Motif Score	3.28175
Cell/Tissue List	CD8T; A549; AML
Seq Type List	m6A-CLIP/IP; miCLIP
Transcript ID List	ENST00000376663.8; ENST00000602390.5; ENST00000443519.1; ENST00000490311.1
External Link	RMBase: m6A_site_94962
mod ID: M6ASITE095792		Click to Show/Hide the Full List
mod site	chr10:22329327-22329328:+		[5]
Sequence	GGAAAGTGACTCTGGGAGTGACAAGGCCAACAGCCCAGCAG
Motif Score	2.859755952
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000490311.1; ENST00000376663.8; ENST00000443519.1; ENST00000602390.5
External Link	RMBase: m6A_site_94963
mod ID: M6ASITE095793		Click to Show/Hide the Full List
mod site	chr10:22329412-22329413:+		[8]
Sequence	CCAGTGCAGTCTCCTCATCCACAGTTTCCTCACATTTCCAG
Motif Score	2.053113095
Cell/Tissue List	HEK293
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000376663.8; ENST00000602390.5; ENST00000490311.1
External Link	RMBase: m6A_site_94964
mod ID: M6ASITE095794		Click to Show/Hide the Full List
mod site	chr10:22329446-22329447:+		[3]
Sequence	TTTCCAGTACTATGAATGGAACCAGCAACAGCCCCAGCGGT
Motif Score	2.930744048
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; hNPCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000490311.1; ENST00000376663.8; ENST00000602390.5
External Link	RMBase: m6A_site_94965
mod ID: M6ASITE095795		Click to Show/Hide the Full List
mod site	chr10:22329493-22329494:+		[3]
Sequence	CAATCTTCTTTTGCCAATAGACCTCGAAAATCATCAGTAAA
Motif Score	2.876744048
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; hNPCs; fibroblasts; GM12878; LCLs; CD8T; H1299; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4; MM6
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List	ENST00000602390.5; ENST00000376663.8
External Link	RMBase: m6A_site_94966
mod ID: M6ASITE095796		Click to Show/Hide the Full List
mod site	chr10:22329527-22329528:+		[7]
Sequence	CAGTAAATGGGTCATCAGCAACTTCTTCTGGTTGATACCTG
Motif Score	2.595904762
Cell/Tissue List	CD8T; A549
Seq Type List	m6A-CLIP/IP
Transcript ID List	ENST00000376663.8; ENST00000602390.5
External Link	RMBase: m6A_site_94967
mod ID: M6ASITE095797		Click to Show/Hide the Full List
mod site	chr10:22329550-22329551:+		[3]
Sequence	TCTTCTGGTTGATACCTGAGACTGTTAAGGAAAAAAATTTT
Motif Score	3.319380952
Cell/Tissue List	HeLa; HEK293T; A549; HepG2; U2OS; hNPCs; fibroblasts; GM12878; LCLs; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX; MM6; AML
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP; miCLIP
Transcript ID List	ENST00000376663.8
External Link	RMBase: m6A_site_94968
mod ID: M6ASITE095798		Click to Show/Hide the Full List
mod site	chr10:22329573-22329574:+		[3]
Sequence	GTTAAGGAAAAAAATTTTAAACCCCTGATTTATATAGATAT
Motif Score	2.185083333
Cell/Tissue List	HeLa; CD34; HEK293T; A549; HepG2; U2OS; hNPCs; fibroblasts; GM12878; LCLs; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000376663.8
External Link	RMBase: m6A_site_94969
mod ID: M6ASITE095799		Click to Show/Hide the Full List
mod site	chr10:22329606-22329607:+		[5]
Sequence	ATAGATATCTTCATGCCATTACAGCTTTCTAGATGCTAATA
Motif Score	2.07285119
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000376663.8
External Link	RMBase: m6A_site_94970
mod ID: M6ASITE095800		Click to Show/Hide the Full List
mod site	chr10:22329633-22329634:+		[9]
Sequence	TCTAGATGCTAATACATGTGACTATCGTCCAATTTGCTTTC
Motif Score	3.28175
Cell/Tissue List	AML
Seq Type List	miCLIP
Transcript ID List	ENST00000376663.8
External Link	RMBase: m6A_site_94971
mod ID: M6ASITE095801		Click to Show/Hide the Full List
mod site	chr10:22329664-22329665:+		[8]
Sequence	ATTTGCTTTCTTTTGTAGTGACATTAAATTTGGCTATAAAA
Motif Score	2.859755952
Cell/Tissue List	brain; HEK293T; hESC-HEK293T; AML
Seq Type List	m6A-REF-seq; DART-seq; MAZTER-seq; miCLIP
Transcript ID List	ENST00000376663.8
External Link	RMBase: m6A_site_94972
mod ID: M6ASITE095802		Click to Show/Hide the Full List
mod site	chr10:22329690-22329691:+		[3]
Sequence	AATTTGGCTATAAAAGATGGACTACATGTGATACTCCTATG
Motif Score	4.065041667
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; U2OS; hNPCs; hESCs; fibroblasts; A549; GM12878; LCLs; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX; AML
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP; miCLIP
Transcript ID List	ENST00000376663.8
External Link	RMBase: m6A_site_94973
mod ID: M6ASITE095803		Click to Show/Hide the Full List
mod site	chr10:22329693-22329694:+		[4]
Sequence	TTGGCTATAAAAGATGGACTACATGTGATACTCCTATGGAC
Motif Score	2.078666667
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000376663.8
External Link	RMBase: m6A_site_94974
mod ID: M6ASITE095804		Click to Show/Hide the Full List
mod site	chr10:22329702-22329703:+		[5]
Sequence	AAAGATGGACTACATGTGATACTCCTATGGACGTTAATTGA
Motif Score	2.53247619
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000376663.8
External Link	RMBase: m6A_site_94975
mod ID: M6ASITE095805		Click to Show/Hide the Full List
mod site	chr10:22329712-22329713:+		[7]
Sequence	TACATGTGATACTCCTATGGACGTTAATTGAAAAGAAAGAT
Motif Score	3.616982143
Cell/Tissue List	CD8T; A549
Seq Type List	m6A-CLIP/IP
Transcript ID List	ENST00000376663.8
External Link	RMBase: m6A_site_94976
mod ID: M6ASITE095806		Click to Show/Hide the Full List
mod site	chr10:22329772-22329773:+		[3]
Sequence	TTTCTTGGAAAGCAGGCAAGACTTTTTCTCTGTGTTAGGAA
Motif Score	3.319380952
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; U2OS; hNPCs; hESCs; fibroblasts; A549; GM12878; LCLs; MM6; Huh7; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000376663.8
External Link	RMBase: m6A_site_94977
mod ID: M6ASITE095807		Click to Show/Hide the Full List
mod site	chr10:22329836-22329837:+		[5]
Sequence	CATTGTTTGGATTTGGAAGTACTCTGCAGTGGACATAAGCA
Motif Score	3.278136905
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000376663.8
External Link	RMBase: m6A_site_94978
mod ID: M6ASITE095808		Click to Show/Hide the Full List
mod site	chr10:22329848-22329849:+		[3]
Sequence	TTGGAAGTACTCTGCAGTGGACATAAGCATTGGGCCATAGT
Motif Score	3.643047619
Cell/Tissue List	HeLa; HepG2; HEK293T; hESC-HEK293T; U2OS; hESCs; fibroblasts; A549; GM12878; LCLs; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX
Seq Type List	m6A-seq; MeRIP-seq; m6A-REF-seq; DART-seq; MAZTER-seq
Transcript ID List	ENST00000376663.8
External Link	RMBase: m6A_site_94979
mod ID: M6ASITE095809		Click to Show/Hide the Full List
mod site	chr10:22329891-22329892:+		[5]
Sequence	GTTAATCTCAACTAACGCCTACATTACATTCTCCTTGATCG
Motif Score	2.078666667
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000376663.8
External Link	RMBase: m6A_site_94980
mod ID: M6ASITE095810		Click to Show/Hide the Full List
mod site	chr10:22329896-22329897:+		[5]
Sequence	TCTCAACTAACGCCTACATTACATTCTCCTTGATCGTTCTT
Motif Score	2.07285119
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000376663.8
External Link	RMBase: m6A_site_94981
mod ID: M6ASITE095811		Click to Show/Hide the Full List
mod site	chr10:22329937-22329938:+		[3]
Sequence	GTTATTACGCTGTTTTGTGAACCTGTAGAAAACAAGTGCTT
Motif Score	2.930744048
Cell/Tissue List	HeLa; HEK293T; HepG2; GM12878; Huh7; iSLK; TIME; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000376663.8
External Link	RMBase: m6A_site_94982
mod ID: M6ASITE095812		Click to Show/Hide the Full List
mod site	chr10:22329948-22329949:+		[3]
Sequence	GTTTTGTGAACCTGTAGAAAACAAGTGCTTTTTATCTTGAA
Motif Score	2.20572619
Cell/Tissue List	HeLa; HEK293T; hESC-HEK293T; HepG2; GM12878; Huh7; iSLK; TIME; TREX
Seq Type List	m6A-seq; DART-seq; MAZTER-seq; MeRIP-seq
Transcript ID List	ENST00000376663.8
External Link	RMBase: m6A_site_94983
mod ID: M6ASITE095813		Click to Show/Hide the Full List
mod site	chr10:22329978-22329979:+		[5]
Sequence	TTTATCTTGAAATTCAACCAACGGAAAGAATATGCATAGAA
Motif Score	2.147845238
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000376663.8
External Link	RMBase: m6A_site_94984
mod ID: M6ASITE095814		Click to Show/Hide the Full List
mod site	chr10:22330023-22330024:+		[5]
Sequence	GCATTCTATGTAGCCATGTCACTGTGAATAACGATTTCTTG
Motif Score	2.469291667
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000376663.8
External Link	RMBase: m6A_site_94985
mod ID: M6ASITE095815		Click to Show/Hide the Full List
mod site	chr10:22330033-22330034:+		[5]
Sequence	TAGCCATGTCACTGTGAATAACGATTTCTTGCATATTTAGC
Motif Score	2.142029762
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000376663.8
External Link	RMBase: m6A_site_94986
mod ID: M6ASITE095816		Click to Show/Hide the Full List
mod site	chr10:22330078-22330079:+		[5]
Sequence	TTGATTCCTGTTTGATTTATACTTCTCTGTTGCTACGCAAA
Motif Score	2.53247619
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000376663.8
External Link	RMBase: m6A_site_94987
mod ID: M6ASITE095817		Click to Show/Hide the Full List
mod site	chr10:22330092-22330093:+		[5]
Sequence	ATTTATACTTCTCTGTTGCTACGCAAAACCGATCAAAGAAA
Motif Score	2.05260119
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000376663.8
External Link	RMBase: m6A_site_94988
mod ID: M6ASITE095818		Click to Show/Hide the Full List
mod site	chr10:22330099-22330100:+		[3]
Sequence	CTTCTCTGTTGCTACGCAAAACCGATCAAAGAAAAGTGAAC
Motif Score	2.185083333
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000376663.8
External Link	RMBase: m6A_site_94989
mod ID: M6ASITE095819		Click to Show/Hide the Full List
mod site	chr10:22330118-22330119:+		[3]
Sequence	AACCGATCAAAGAAAAGTGAACTTCAGTTTTACAATCTGTA
Motif Score	3.373380952
Cell/Tissue List	HeLa; HEK293T
Seq Type List	m6A-seq; DART-seq
Transcript ID List	ENST00000376663.8
External Link	RMBase: m6A_site_94990
mod ID: M6ASITE095820		Click to Show/Hide the Full List
mod site	chr10:22330129-22330130:+		[4]
Sequence	GAAAAGTGAACTTCAGTTTTACAATCTGTATGCCTAAAAGC
Motif Score	2.07285119
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000376663.8
External Link	RMBase: m6A_site_94991
mod ID: M6ASITE095821		Click to Show/Hide the Full List
mod site	chr10:22330154-22330155:+		[5]
Sequence	CTGTATGCCTAAAAGCGGGTACTACCGTTTATTTTACTGAC
Motif Score	3.278136905
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000376663.8
External Link	RMBase: m6A_site_94992
mod ID: M6ASITE095822		Click to Show/Hide the Full List
mod site	chr10:22330169-22330170:+		[5]
Sequence	CGGGTACTACCGTTTATTTTACTGACTTGTTTAAATGATTC
Motif Score	2.494845238
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000376663.8
External Link	RMBase: m6A_site_94993
mod ID: M6ASITE095823		Click to Show/Hide the Full List
mod site	chr10:22330173-22330174:+		[5]
Sequence	TACTACCGTTTATTTTACTGACTTGTTTAAATGATTCGCTT
Motif Score	3.28175
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000376663.8
External Link	RMBase: m6A_site_94994
mod ID: M6ASITE095824		Click to Show/Hide the Full List
mod site	chr10:22330226-22330227:+		[4]
Sequence	GATGGCATTATGCTTGTTGTACAATGCCATATTGGTATATG
Motif Score	2.856142857
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000376663.8
External Link	RMBase: m6A_site_94995
mod ID: M6ASITE095825		Click to Show/Hide the Full List
mod site	chr10:22330247-22330248:+		[5]
Sequence	CAATGCCATATTGGTATATGACATAACAGGAAACAGTATTG
Motif Score	2.859755952
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000376663.8
External Link	RMBase: m6A_site_94996
mod ID: M6ASITE095826		Click to Show/Hide the Full List
mod site	chr10:22330259-22330260:+		[3]
Sequence	GGTATATGACATAACAGGAAACAGTATTGTATGATATATTT
Motif Score	2.20572619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000376663.8
External Link	RMBase: m6A_site_94997
mod ID: M6ASITE095827		Click to Show/Hide the Full List
mod site	chr10:22330456-22330457:+		[4]
Sequence	TTCCATTAGAAGCAATTGGCACATCTTTCTATACTTTATAT
Motif Score	2.830589286
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000376663.8
External Link	RMBase: m6A_site_94998
mod ID: M6ASITE095828		Click to Show/Hide the Full List
mod site	chr10:22330477-22330478:+		[5]
Sequence	CATCTTTCTATACTTTATATACTTTTCTCCAGTAATACATG
Motif Score	2.53247619
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000376663.8
External Link	RMBase: m6A_site_94999
mod ID: M6ASITE095829		Click to Show/Hide the Full List
mod site	chr10:22330493-22330494:+		[5]
Sequence	ATATACTTTTCTCCAGTAATACATGTTTACTTTAAAGATTG
Motif Score	2.110482143
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000376663.8
External Link	RMBase: m6A_site_95000
mod ID: M6ASITE095830		Click to Show/Hide the Full List
mod site	chr10:22330501-22330502:+		[5]
Sequence	TTCTCCAGTAATACATGTTTACTTTAAAGATTGTTGCAGTG
Motif Score	2.494845238
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000376663.8
External Link	RMBase: m6A_site_95001
mod ID: M6ASITE095831		Click to Show/Hide the Full List
mod site	chr10:22330536-22330537:+		[5]
Sequence	GCAGTGAAGAAAAACCTTTAACTGAGAAATATGGAAACCGT
Motif Score	2.590089286
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000376663.8
External Link	RMBase: m6A_site_95002
mod ID: M6ASITE095832		Click to Show/Hide the Full List
mod site	chr10:22330616-22330617:+		[5]
Sequence	TTTAAAAATGCATATTGATCACTATAATTCTAAAACAATTT
Motif Score	2.469291667
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000376663.8
External Link	RMBase: m6A_site_95003
mod ID: M6ASITE095833		Click to Show/Hide the Full List
mod site	chr10:22330630-22330631:+		[5]
Sequence	TTGATCACTATAATTCTAAAACAATTTTTTAAATAAACCAG
Motif Score	2.20572619
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000376663.8
External Link	RMBase: m6A_site_95004
mod ID: M6ASITE095834		Click to Show/Hide the Full List
mod site	chr10:22330733-22330734:+		[5]
Sequence	TAAATTTAAGAGTTGCTTTTACAGTTAACAATGGAATATGC
Motif Score	2.07285119
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000376663.8
External Link	RMBase: m6A_site_95005
mod ID: M6ASITE095835		Click to Show/Hide the Full List
mod site	chr10:22330740-22330741:+		[4]
Sequence	AAGAGTTGCTTTTACAGTTAACAATGGAATATGCCTTCTCT
Motif Score	2.168095238
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000376663.8
External Link	RMBase: m6A_site_95006
mod ID: M6ASITE095836		Click to Show/Hide the Full List
mod site	chr10:22330858-22330859:+		[5]
Sequence	AATATGAATAACCCCACCCAACAATTTTCAGTTTATTTTTT
Motif Score	2.173910714
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000376663.8
External Link	RMBase: m6A_site_95007
mod ID: M6ASITE095837		Click to Show/Hide the Full List
mod site	chr10:22330890-22330891:+		[3]
Sequence	TTATTTTTTGCTTTGGTCGAACTTGGTGTGTGTTCATCACC
Motif Score	3.373380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000376663.8
External Link	RMBase: m6A_site_95008
mod ID: M6ASITE095838		Click to Show/Hide the Full List
mod site	chr10:22330983-22330984:+		[5]
Sequence	TATGGGAAAATTGTAGCTAAACATTTCATTGTCCCCAGTCT
Motif Score	2.20572619
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000376663.8
External Link	RMBase: m6A_site_95009
mod ID: M6ASITE095839		Click to Show/Hide the Full List
mod site	chr10:22331015-22331016:+		[4]
Sequence	CCCCAGTCTGCAAAAGAAGCACAATTCTATTGCTTTGTCTT
Motif Score	2.830589286
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000376663.8
External Link	RMBase: m6A_site_95010
mod ID: M6ASITE095840		Click to Show/Hide the Full List
mod site	chr10:22331057-22331058:+		[5]
Sequence	CTTATAGTCATTAAATCATTACTTTTACATATATTGCTGTT
Motif Score	2.494845238
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000376663.8
External Link	RMBase: m6A_site_95011
mod ID: M6ASITE095841		Click to Show/Hide the Full List
mod site	chr10:22331063-22331064:+		[5]
Sequence	GTCATTAAATCATTACTTTTACATATATTGCTGTTACTTCT
Motif Score	2.07285119
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000376663.8
External Link	RMBase: m6A_site_95012
mod ID: M6ASITE095842		Click to Show/Hide the Full List
mod site	chr10:22331078-22331079:+		[5]
Sequence	CTTTTACATATATTGCTGTTACTTCTGCTTTCTTTAAAAAT
Motif Score	2.494845238
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000376663.8
External Link	RMBase: m6A_site_95013
mod ID: M6ASITE095843		Click to Show/Hide the Full List
mod site	chr10:22331124-22331125:+		[5]
Sequence	AAAGGATGTTTTATGAAGTCACAAGATACATATATTTTTAT
Motif Score	2.047297619
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000376663.8
External Link	RMBase: m6A_site_95014
mod ID: M6ASITE095844		Click to Show/Hide the Full List
mod site	chr10:22331131-22331132:+		[5]
Sequence	GTTTTATGAAGTCACAAGATACATATATTTTTATTTTGACC
Motif Score	2.110482143
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000376663.8
External Link	RMBase: m6A_site_95015
mod ID: M6ASITE095845		Click to Show/Hide the Full List
mod site	chr10:22331149-22331150:+		[5]
Sequence	ATACATATATTTTTATTTTGACCTAAATTTGTACAGTCCCA
Motif Score	2.839113095
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000376663.8
External Link	RMBase: m6A_site_95016
mod ID: M6ASITE095846		Click to Show/Hide the Full List
mod site	chr10:22331161-22331162:+		[5]
Sequence	TTATTTTGACCTAAATTTGTACAGTCCCATTGTAAGTGTTG
Motif Score	2.856142857
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000376663.8
External Link	RMBase: m6A_site_95017
mod ID: M6ASITE095847		Click to Show/Hide the Full List
mod site	chr10:22331296-22331297:+		[4]
Sequence	AAAAATTTGATATGAAAAGCACAATGTGCAGAAGTTATGGA
Motif Score	2.830589286
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000376663.8
External Link	RMBase: m6A_site_95018
mod ID: M6ASITE095848		Click to Show/Hide the Full List
mod site	chr10:22331392-22331393:+		[4]
Sequence	TAGTGATGTGGCTAAGAAGTACATGCTTTGTTGTAAAATTG
Motif Score	2.856142857
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000376663.8
External Link	RMBase: m6A_site_95019

Ref 1	METTL3 Promotes Tumorigenesis and Metastasis through BMI1 m(6)A Methylation in Oral Squamous Cell Carcinoma. Mol Ther. 2020 Oct 7;28(10):2177-2190. doi: 10.1016/j.ymthe.2020.06.024. Epub 2020 Jun 24.
Ref 2	5-methylcytosine promotes mRNA export - NSUN2 as the methyltransferase and ALYREF as an m(5)C reader. Cell Res. 2017 May;27(5):606-625. doi: 10.1038/cr.2017.55. Epub 2017 Apr 18.
Ref 3	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 4	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.
Ref 5	DART-seq: an antibody-free method for global m(6)A detection. Nat Methods. 2019 Dec;16(12):1275-1280. doi: 10.1038/s41592-019-0570-0. Epub 2019 Sep 23.
Ref 6	Suppression of m(6)A reader Ythdf2 promotes hematopoietic stem cell expansion. Cell Res. 2018 Sep;28(9):904-917. doi: 10.1038/s41422-018-0072-0. Epub 2018 Jul 31.
Ref 7	A majority of m6A residues are in the last exons, allowing the potential for 3' UTR regulation. Genes Dev. 2015 Oct 1;29(19):2037-53. doi: 10.1101/gad.269415.115. Epub 2015 Sep 24.
Ref 8	Single-base mapping of m(6)A by an antibody-independent method. Sci Adv. 2019 Jul 3;5(7):eaax0250. doi: 10.1126/sciadv.aax0250. eCollection 2019 Jul.
Ref 9	The N(6)-methyladenosine (m(6)A)-forming enzyme METTL3 controls myeloid differentiation of normal hematopoietic and leukemia cells. Nat Med. 2017 Nov;23(11):1369-1376. doi: 10.1038/nm.4416. Epub 2017 Sep 18.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map