m6A Target Gene Information
General Information of the m6A Target Gene (ID: M6ATAR00565)
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
MNK2
can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Methyltransferase-like 3 (METTL3) [WRITER]
| Representative RNA-seq result indicating the expression of this target gene regulated by METTL3 | ||
| Cell Line | LX2 cell line | Homo sapiens |
|
Treatment: shMETTL3 LX2 cells
Control: shLuc LX2 cells
|
GSE207909 | |
| Regulation |
![]() ![]() |
logFC: 1.09E+00 p-value: 4.06E-29 |
| More Results | Click to View More RNA-seq Results | |
| Representative RIP-seq result supporting the interaction between MNK2 and the regulator | ||
| Cell Line | MDA-MB-231 | Homo sapiens |
| Regulation | logFC: 1.25E+00 | GSE60213 |
| In total 1 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [1] | |||
| Response Summary | m6A writers METTL3/METTL14 and the m6A reader YTHDF1 orchestrate MAP kinase signal-integrating kinase 2 (MNK2) expression posttranscriptionally and thus control ERK signaling, which is required for the maintenance of muscle myogenesis and contributes to regeneration. | |||
| Target Regulation | Up regulation | |||
| Responsed Disease | Muscular dystrophies | ICD-11: 8C70 | ||
| Pathway Response | MAPK signaling pathway | hsa04010 | ||
| In-vitro Model | HEK293T | Normal | Homo sapiens | CVCL_0063 |
| C2C12 | Normal | Mus musculus | CVCL_0188 | |
| In-vivo Model | For mouse muscle injury and regeneration experiment, tibialis anterior (TA) muscles of 6-week-old male mice were injected with 25 uL of 10 uM cardiotoxin (CTX, Merck Millipore, 217503), 0.9% normal saline (Saline) were used as control. The regenerated muscles were collected at day 1, 3, 5, and 10 post-injection. TA muscles were isolated for Hematoxylin and eosin staining or frozen in liquid nitrogen for RNA and protein extraction. | |||
Methyltransferase-like 14 (METTL14) [WRITER]
| In total 1 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [1] | |||
| Response Summary | m6A writers METTL3/METTL14 and the m6A reader YTHDF1 orchestrate MAP kinase signal-integrating kinase 2 (MNK2) expression posttranscriptionally and thus control ERK signaling, which is required for the maintenance of muscle myogenesis and contributes to regeneration. | |||
| Target Regulation | Up regulation | |||
| Responsed Disease | Muscular dystrophies | ICD-11: 8C70 | ||
| Pathway Response | MAPK signaling pathway | hsa04010 | ||
| In-vitro Model | HEK293T | Normal | Homo sapiens | CVCL_0063 |
| C2C12 | Normal | Mus musculus | CVCL_0188 | |
| In-vivo Model | For mouse muscle injury and regeneration experiment, tibialis anterior (TA) muscles of 6-week-old male mice were injected with 25 uL of 10 uM cardiotoxin (CTX, Merck Millipore, 217503), 0.9% normal saline (Saline) were used as control. The regenerated muscles were collected at day 1, 3, 5, and 10 post-injection. TA muscles were isolated for Hematoxylin and eosin staining or frozen in liquid nitrogen for RNA and protein extraction. | |||
YTH domain-containing family protein 1 (YTHDF1) [READER]
| In total 1 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [1] | |||
| Response Summary | m6A writers METTL3/METTL14 and the m6A reader YTHDF1 orchestrate MAP kinase signal-integrating kinase 2 (MNK2) expression posttranscriptionally and thus control ERK signaling, which is required for the maintenance of muscle myogenesis contributes to regeneration. | |||
| Target Regulation | Up regulation | |||
| Responsed Disease | Muscular dystrophies | ICD-11: 8C70 | ||
| Pathway Response | MAPK signaling pathway | hsa04010 | ||
| In-vitro Model | HEK293T | Normal | Homo sapiens | CVCL_0063 |
| C2C12 | Normal | Mus musculus | CVCL_0188 | |
| In-vivo Model | For mouse muscle injury and regeneration experiment, tibialis anterior (TA) muscles of 6-week-old male mice were injected with 25 uL of 10 uM cardiotoxin (CTX, Merck Millipore, 217503), 0.9% normal saline (Saline) were used as control. The regenerated muscles were collected at day 1, 3, 5, and 10 post-injection. TA muscles were isolated for Hematoxylin and eosin staining or frozen in liquid nitrogen for RNA and protein extraction. | |||
Muscular dystrophies [ICD-11: 8C70]
| In total 3 item(s) under this disease | ||||
| Experiment 1 Reporting the m6A-centered Disease Response | [1] | |||
| Response Summary | m6A writers METTL3/METTL14 and the m6A reader YTHDF1 orchestrate MAP kinase signal-integrating kinase 2 (MNK2) expression posttranscriptionally and thus control ERK signaling, which is required for the maintenance of muscle myogenesis and contributes to regeneration. | |||
| Responsed Disease | Muscular dystrophies [ICD-11: 8C70] | |||
| Target Regulator | Methyltransferase-like 14 (METTL14) | WRITER | ||
| Target Regulation | Up regulation | |||
| Pathway Response | MAPK signaling pathway | hsa04010 | ||
| In-vitro Model | HEK293T | Normal | Homo sapiens | CVCL_0063 |
| C2C12 | Normal | Mus musculus | CVCL_0188 | |
| In-vivo Model | For mouse muscle injury and regeneration experiment, tibialis anterior (TA) muscles of 6-week-old male mice were injected with 25 uL of 10 uM cardiotoxin (CTX, Merck Millipore, 217503), 0.9% normal saline (Saline) were used as control. The regenerated muscles were collected at day 1, 3, 5, and 10 post-injection. TA muscles were isolated for Hematoxylin and eosin staining or frozen in liquid nitrogen for RNA and protein extraction. | |||
| Experiment 2 Reporting the m6A-centered Disease Response | [1] | |||
| Response Summary | m6A writers METTL3/METTL14 and the m6A reader YTHDF1 orchestrate MAP kinase signal-integrating kinase 2 (MNK2) expression posttranscriptionally and thus control ERK signaling, which is required for the maintenance of muscle myogenesis and contributes to regeneration. | |||
| Responsed Disease | Muscular dystrophies [ICD-11: 8C70] | |||
| Target Regulator | Methyltransferase-like 3 (METTL3) | WRITER | ||
| Target Regulation | Up regulation | |||
| Pathway Response | MAPK signaling pathway | hsa04010 | ||
| In-vitro Model | HEK293T | Normal | Homo sapiens | CVCL_0063 |
| C2C12 | Normal | Mus musculus | CVCL_0188 | |
| In-vivo Model | For mouse muscle injury and regeneration experiment, tibialis anterior (TA) muscles of 6-week-old male mice were injected with 25 uL of 10 uM cardiotoxin (CTX, Merck Millipore, 217503), 0.9% normal saline (Saline) were used as control. The regenerated muscles were collected at day 1, 3, 5, and 10 post-injection. TA muscles were isolated for Hematoxylin and eosin staining or frozen in liquid nitrogen for RNA and protein extraction. | |||
| Experiment 3 Reporting the m6A-centered Disease Response | [1] | |||
| Response Summary | m6A writers METTL3/METTL14 and the m6A reader YTHDF1 orchestrate MAP kinase signal-integrating kinase 2 (MNK2) expression posttranscriptionally and thus control ERK signaling, which is required for the maintenance of muscle myogenesis contributes to regeneration. | |||
| Responsed Disease | Muscular dystrophies [ICD-11: 8C70] | |||
| Target Regulator | YTH domain-containing family protein 1 (YTHDF1) | READER | ||
| Target Regulation | Up regulation | |||
| Pathway Response | MAPK signaling pathway | hsa04010 | ||
| In-vitro Model | HEK293T | Normal | Homo sapiens | CVCL_0063 |
| C2C12 | Normal | Mus musculus | CVCL_0188 | |
| In-vivo Model | For mouse muscle injury and regeneration experiment, tibialis anterior (TA) muscles of 6-week-old male mice were injected with 25 uL of 10 uM cardiotoxin (CTX, Merck Millipore, 217503), 0.9% normal saline (Saline) were used as control. The regenerated muscles were collected at day 1, 3, 5, and 10 post-injection. TA muscles were isolated for Hematoxylin and eosin staining or frozen in liquid nitrogen for RNA and protein extraction. | |||
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00565)
| In total 1 m6A sequence/site(s) in this target gene | |||
| mod ID: AC4SITE000245 | Click to Show/Hide the Full List | ||
| mod site | chr19:2046380-2046381:- | [2] | |
| Sequence | CCGGGCCACCGACAGCTTCTCGGGCAGGTTTGAAGGTGAGC | ||
| Cell/Tissue List | H1 | ||
| Seq Type List | ac4C-seq | ||
| Transcript ID List | ENST00000591601.5; ENST00000586828.5; ENST00000250896.7; ENST00000309340.11 | ||
| External Link | RMBase: ac4C_site_911 | ||
Adenosine-to-Inosine editing (A-to-I)
| In total 2 m6A sequence/site(s) in this target gene | |||
| mod ID: A2ISITE008721 | Click to Show/Hide the Full List | ||
| mod site | chr19:2047110-2047111:- | [3] | |
| Sequence | TCTTGCCTTGCTGAGGTGCTAGGAGGCCTCACGCCTTCCAC | ||
| Transcript ID List | ENST00000309340.11; ENST00000250896.7; ENST00000589534.2; ENST00000586828.5; ENST00000591601.5; ENST00000589509.5 | ||
| External Link | RMBase: RNA-editing_site_64250 | ||
| mod ID: A2ISITE008722 | Click to Show/Hide the Full List | ||
| mod site | chr19:2047602-2047603:- | [3] | |
| Sequence | ACCAGGCTGGCAGCCCGCCTAGTGACTCACCTCCTTCCCAC | ||
| Transcript ID List | ENST00000589534.2; ENST00000591601.5; ENST00000250896.7; ENST00000589509.5; ENST00000586828.5; ENST00000309340.11 | ||
| External Link | RMBase: RNA-editing_site_64251 | ||
5-methylcytidine (m5C)
| In total 15 m6A sequence/site(s) in this target gene | |||
| mod ID: M5CSITE001586 | Click to Show/Hide the Full List | ||
| mod site | chr19:2038349-2038350:- | ||
| Sequence | TCACCGCCCGCCCTTCCCGGCGCAGCCCCCGAGCTCCACAG | ||
| Cell/Tissue List | muscle | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000309340.11; ENST00000588014.5; ENST00000591142.5; ENST00000250896.7; ENST00000589441.5; ENST00000591601.5; ENST00000587416.5 | ||
| External Link | RMBase: m5C_site_21751 | ||
| mod ID: M5CSITE001587 | Click to Show/Hide the Full List | ||
| mod site | chr19:2039318-2039319:- | [4] | |
| Sequence | CCCCTCCCCGGTCCCCCGCCCTGCTCACCTCTACTATGAAG | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000591142.5; ENST00000587416.5; ENST00000591601.5; ENST00000309340.11; ENST00000588014.5; ENST00000250896.7; ENST00000589441.5 | ||
| External Link | RMBase: m5C_site_21752 | ||
| mod ID: M5CSITE001588 | Click to Show/Hide the Full List | ||
| mod site | chr19:2040318-2040319:- | ||
| Sequence | CGGGGTGGGCGCTTGGCTCCCGGGGCACCCAGGTGCACTCC | ||
| Cell/Tissue List | lung | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000591588.1; ENST00000585667.1; ENST00000586620.2; ENST00000250896.7; ENST00000591601.5; ENST00000589441.5; ENST00000586828.5; ENST00000588014.5; ENST00000587416.5; ENST00000309340.11; ENST00000591142.5 | ||
| External Link | RMBase: m5C_site_21753 | ||
| mod ID: M5CSITE001589 | Click to Show/Hide the Full List | ||
| mod site | chr19:2040706-2040707:- | ||
| Sequence | GCCTAGCCTGCCGTCAGTCTCAAGCCCAGGCTGTGCCTCCA | ||
| Cell/Tissue List | heart; muscle; spleen | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000250896.7; ENST00000586828.5; ENST00000309340.11; ENST00000591142.5; ENST00000588014.5; ENST00000589441.5; ENST00000591588.1; ENST00000586620.2; ENST00000585667.1; ENST00000591601.5; ENST00000587416.5 | ||
| External Link | RMBase: m5C_site_21754 | ||
| mod ID: M5CSITE001590 | Click to Show/Hide the Full List | ||
| mod site | chr19:2042042-2042043:- | ||
| Sequence | CGGCTGACGCGCCCCTCCCCCGCCCGCAGTGCGGCTCGGCG | ||
| Cell/Tissue List | T24 | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000587416.5; ENST00000591142.5; ENST00000586828.5; ENST00000588014.5; ENST00000309340.11; ENST00000586620.2; ENST00000250896.7; ENST00000591588.1; ENST00000585667.1; ENST00000591601.5 | ||
| External Link | RMBase: m5C_site_21755 | ||
| mod ID: M5CSITE001591 | Click to Show/Hide the Full List | ||
| mod site | chr19:2042043-2042044:- | ||
| Sequence | CCGGCTGACGCGCCCCTCCCCCGCCCGCAGTGCGGCTCGGC | ||
| Cell/Tissue List | T24 | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000591142.5; ENST00000587416.5; ENST00000309340.11; ENST00000585667.1; ENST00000591588.1; ENST00000586828.5; ENST00000586620.2; ENST00000250896.7; ENST00000591601.5; ENST00000588014.5 | ||
| External Link | RMBase: m5C_site_21756 | ||
| mod ID: M5CSITE001592 | Click to Show/Hide the Full List | ||
| mod site | chr19:2042044-2042045:- | ||
| Sequence | CCCGGCTGACGCGCCCCTCCCCCGCCCGCAGTGCGGCTCGG | ||
| Cell/Tissue List | T24 | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000586828.5; ENST00000591601.5; ENST00000250896.7; ENST00000585667.1; ENST00000591142.5; ENST00000587416.5; ENST00000588014.5; ENST00000591588.1; ENST00000586620.2; ENST00000309340.11 | ||
| External Link | RMBase: m5C_site_21757 | ||
| mod ID: M5CSITE001593 | Click to Show/Hide the Full List | ||
| mod site | chr19:2042045-2042046:- | ||
| Sequence | CCCCGGCTGACGCGCCCCTCCCCCGCCCGCAGTGCGGCTCG | ||
| Cell/Tissue List | T24 | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000591142.5; ENST00000591601.5; ENST00000309340.11; ENST00000586620.2; ENST00000587416.5; ENST00000588014.5; ENST00000591588.1; ENST00000585667.1; ENST00000586828.5; ENST00000250896.7 | ||
| External Link | RMBase: m5C_site_21758 | ||
| mod ID: M5CSITE001594 | Click to Show/Hide the Full List | ||
| mod site | chr19:2042046-2042047:- | ||
| Sequence | ACCCCGGCTGACGCGCCCCTCCCCCGCCCGCAGTGCGGCTC | ||
| Cell/Tissue List | T24 | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000587416.5; ENST00000585667.1; ENST00000309340.11; ENST00000591588.1; ENST00000591601.5; ENST00000588014.5; ENST00000250896.7; ENST00000586620.2; ENST00000591142.5; ENST00000586828.5 | ||
| External Link | RMBase: m5C_site_21759 | ||
| mod ID: M5CSITE001595 | Click to Show/Hide the Full List | ||
| mod site | chr19:2042048-2042049:- | ||
| Sequence | AAACCCCGGCTGACGCGCCCCTCCCCCGCCCGCAGTGCGGC | ||
| Cell/Tissue List | T24 | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000591601.5; ENST00000586620.2; ENST00000250896.7; ENST00000587416.5; ENST00000591588.1; ENST00000309340.11; ENST00000585667.1; ENST00000586828.5; ENST00000591142.5; ENST00000588014.5 | ||
| External Link | RMBase: m5C_site_21760 | ||
| mod ID: M5CSITE001596 | Click to Show/Hide the Full List | ||
| mod site | chr19:2042049-2042050:- | ||
| Sequence | GAAACCCCGGCTGACGCGCCCCTCCCCCGCCCGCAGTGCGG | ||
| Cell/Tissue List | T24 | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000585667.1; ENST00000591142.5; ENST00000586620.2; ENST00000250896.7; ENST00000586828.5; ENST00000591588.1; ENST00000587416.5; ENST00000591601.5; ENST00000309340.11; ENST00000588014.5 | ||
| External Link | RMBase: m5C_site_21761 | ||
| mod ID: M5CSITE001597 | Click to Show/Hide the Full List | ||
| mod site | chr19:2042050-2042051:- | ||
| Sequence | GGAAACCCCGGCTGACGCGCCCCTCCCCCGCCCGCAGTGCG | ||
| Cell/Tissue List | T24 | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000591588.1; ENST00000250896.7; ENST00000588014.5; ENST00000591142.5; ENST00000586620.2; ENST00000587416.5; ENST00000309340.11; ENST00000591601.5; ENST00000585667.1; ENST00000586828.5 | ||
| External Link | RMBase: m5C_site_21762 | ||
| mod ID: M5CSITE001598 | Click to Show/Hide the Full List | ||
| mod site | chr19:2042051-2042052:- | ||
| Sequence | GGGAAACCCCGGCTGACGCGCCCCTCCCCCGCCCGCAGTGC | ||
| Cell/Tissue List | T24 | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000586620.2; ENST00000586828.5; ENST00000591588.1; ENST00000250896.7; ENST00000585667.1; ENST00000587416.5; ENST00000591142.5; ENST00000591601.5; ENST00000588014.5; ENST00000309340.11 | ||
| External Link | RMBase: m5C_site_21763 | ||
| mod ID: M5CSITE001599 | Click to Show/Hide the Full List | ||
| mod site | chr19:2042097-2042098:- | ||
| Sequence | GCGCAGGTGACCCGCAGTTACCCGGGCTCGGTTCCCACGTA | ||
| Cell/Tissue List | liver | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000585667.1; ENST00000588014.5; ENST00000250896.7; ENST00000587416.5; ENST00000586828.5; ENST00000309340.11; ENST00000591142.5; ENST00000591601.5 | ||
| External Link | RMBase: m5C_site_21764 | ||
| mod ID: M5CSITE001600 | Click to Show/Hide the Full List | ||
| mod site | chr19:2050803-2050804:- | ||
| Sequence | CAGGGTTTCCACCGTTCGTTCAAGGTGAGGCCCGGGGTCGG | ||
| Cell/Tissue List | muscle; testis | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000589509.5; ENST00000586828.5; ENST00000591601.5; ENST00000309340.11; ENST00000589534.2; ENST00000250896.7 | ||
| External Link | RMBase: m5C_site_21765 | ||
N6-methyladenosine (m6A)
| In total 72 m6A sequence/site(s) in this target gene | |||
| mod ID: M6ASITE037986 | Click to Show/Hide the Full List | ||
| mod site | chr19:2037475-2037476:- | [5] | |
| Sequence | GATTTAATAAAAGTCAAAAAACTTGCTGTGTGCCTGAGTTT | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa; Huh7 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000591142.5; ENST00000587416.5; ENST00000591601.5; ENST00000589441.5; ENST00000309340.11 | ||
| External Link | RMBase: m6A_site_408847 | ||
| mod ID: M6ASITE037987 | Click to Show/Hide the Full List | ||
| mod site | chr19:2037538-2037539:- | [6] | |
| Sequence | GAGCTCAGAAGTTTTCCTTTACACCAACTGTCAATGCCGGA | ||
| Motif Score | 2.07285119 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000591601.5; ENST00000250896.7; ENST00000587416.5; ENST00000309340.11; ENST00000591142.5; ENST00000589441.5 | ||
| External Link | RMBase: m6A_site_408848 | ||
| mod ID: M6ASITE037988 | Click to Show/Hide the Full List | ||
| mod site | chr19:2037565-2037566:- | [5] | |
| Sequence | AATTCCAATGTACCAGGTGAACTGACGGAGCTCAGAAGTTT | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa; Huh7 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000591142.5; ENST00000309340.11; ENST00000587416.5; ENST00000591601.5; ENST00000250896.7; ENST00000589441.5 | ||
| External Link | RMBase: m6A_site_408849 | ||
| mod ID: M6ASITE037989 | Click to Show/Hide the Full List | ||
| mod site | chr19:2037600-2037601:- | [6] | |
| Sequence | TTTTTTAAAGTGGGGGAAAAACATCCAAGCACTTTAATTCC | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HEK293T; hESC-HEK293T; Huh7 | ||
| Seq Type List | MeRIP-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000591142.5; ENST00000587416.5; ENST00000589441.5; ENST00000250896.7; ENST00000309340.11; ENST00000591601.5 | ||
| External Link | RMBase: m6A_site_408850 | ||
| mod ID: M6ASITE037990 | Click to Show/Hide the Full List | ||
| mod site | chr19:2037631-2037632:- | [7] | |
| Sequence | AAGACAAAAAAAAAAAAAAAACCTCAAAAGTTTTTTTAAAG | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HEK293T; A549; MM6; Huh7 | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000587416.5; ENST00000309340.11; ENST00000591601.5; ENST00000591142.5; ENST00000250896.7; ENST00000589441.5 | ||
| External Link | RMBase: m6A_site_408851 | ||
| mod ID: M6ASITE037991 | Click to Show/Hide the Full List | ||
| mod site | chr19:2037648-2037649:- | [5] | |
| Sequence | TGTTACGATGTTTTTAAAAGACAAAAAAAAAAAAAAAACCT | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa; HEK293T; hESC-HEK293T; A549; MM6; Huh7; TREX | ||
| Seq Type List | m6A-seq; MeRIP-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000591601.5; ENST00000591142.5; ENST00000587416.5; ENST00000309340.11; ENST00000589441.5; ENST00000250896.7 | ||
| External Link | RMBase: m6A_site_408852 | ||
| mod ID: M6ASITE037992 | Click to Show/Hide the Full List | ||
| mod site | chr19:2037725-2037726:- | [5] | |
| Sequence | ATGAGTGAAGATCCTGGAGGACCCTGGGCCCCAGGCCAGCT | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; MM6; Huh7; TREX; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000309340.11; ENST00000589441.5; ENST00000591601.5; ENST00000591142.5; ENST00000587416.5; ENST00000250896.7 | ||
| External Link | RMBase: m6A_site_408853 | ||
| mod ID: M6ASITE037993 | Click to Show/Hide the Full List | ||
| mod site | chr19:2037758-2037759:- | [5] | |
| Sequence | GACCTGGAGGACTGGTCAGAACCGTTACTGTGAATGAGTGA | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; MM6; Huh7; TREX; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000589441.5; ENST00000591601.5; ENST00000587416.5; ENST00000591142.5; ENST00000309340.11; ENST00000250896.7 | ||
| External Link | RMBase: m6A_site_408854 | ||
| mod ID: M6ASITE037994 | Click to Show/Hide the Full List | ||
| mod site | chr19:2037768-2037769:- | [5] | |
| Sequence | ATCCACGTGCGACCTGGAGGACTGGTCAGAACCGTTACTGT | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; MM6; Huh7; TREX; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000591601.5; ENST00000587416.5; ENST00000250896.7; ENST00000589441.5; ENST00000591142.5; ENST00000309340.11 | ||
| External Link | RMBase: m6A_site_408855 | ||
| mod ID: M6ASITE037995 | Click to Show/Hide the Full List | ||
| mod site | chr19:2037823-2037824:- | [5] | |
| Sequence | TTTTTTTTTCTGAAGGTGGGACAGTCACTTCCTCCTCCCTC | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; hESC-HEK293T; HepG2; A549; HEC-1-A; AML | ||
| Seq Type List | m6A-seq; MAZTER-seq; miCLIP | ||
| Transcript ID List | ENST00000589441.5; ENST00000591142.5; ENST00000309340.11; ENST00000250896.7; ENST00000591601.5; ENST00000587416.5 | ||
| External Link | RMBase: m6A_site_408856 | ||
| mod ID: M6ASITE037996 | Click to Show/Hide the Full List | ||
| mod site | chr19:2037922-2037923:- | [8] | |
| Sequence | ATCAAAGAACAAGCAAATGGACCCCCGCCCGCTGCAGGCGC | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000587416.5; ENST00000591142.5; ENST00000309340.11; ENST00000589441.5; ENST00000591601.5; ENST00000250896.7 | ||
| External Link | RMBase: m6A_site_408857 | ||
| mod ID: M6ASITE037997 | Click to Show/Hide the Full List | ||
| mod site | chr19:2037934-2037935:- | [6] | |
| Sequence | CTGCCTTTTTGTATCAAAGAACAAGCAAATGGACCCCCGCC | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | hESC-HEK293T; HeLa | ||
| Seq Type List | MAZTER-seq; m6A-seq | ||
| Transcript ID List | ENST00000250896.7; ENST00000309340.11; ENST00000589441.5; ENST00000587416.5; ENST00000591601.5; ENST00000591142.5 | ||
| External Link | RMBase: m6A_site_408858 | ||
| mod ID: M6ASITE037998 | Click to Show/Hide the Full List | ||
| mod site | chr19:2038044-2038045:- | [5] | |
| Sequence | GTGGACTGCCCCTTCCAAAGACCCCTGGGGGGGGTGGGGCA | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000309340.11; ENST00000591142.5; ENST00000589441.5; ENST00000250896.7; ENST00000587416.5; ENST00000591601.5 | ||
| External Link | RMBase: m6A_site_408859 | ||
| mod ID: M6ASITE037999 | Click to Show/Hide the Full List | ||
| mod site | chr19:2038060-2038061:- | [5] | |
| Sequence | CCCACTGCCCATATCTGTGGACTGCCCCTTCCAAAGACCCC | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000587416.5; ENST00000591601.5; ENST00000591142.5; ENST00000250896.7; ENST00000309340.11; ENST00000589441.5 | ||
| External Link | RMBase: m6A_site_408860 | ||
| mod ID: M6ASITE038000 | Click to Show/Hide the Full List | ||
| mod site | chr19:2038167-2038168:- | [5] | |
| Sequence | TGGGGGTGGGGGCCTCGGAGACCGTCTGCCTGGCCCTGCTG | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa; MM6 | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000591601.5; ENST00000589441.5; ENST00000591142.5; ENST00000309340.11; ENST00000250896.7; ENST00000587416.5 | ||
| External Link | RMBase: m6A_site_408861 | ||
| mod ID: M6ASITE038001 | Click to Show/Hide the Full List | ||
| mod site | chr19:2038232-2038233:- | [5] | |
| Sequence | AAAAAACAACACATCGATGGACTTTGCTTCCCTGTTCTTGA | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa; A549; AML | ||
| Seq Type List | m6A-seq; m6A-CLIP/IP; miCLIP | ||
| Transcript ID List | ENST00000591601.5; ENST00000309340.11; ENST00000591142.5; ENST00000250896.7; ENST00000589441.5; ENST00000587416.5 | ||
| External Link | RMBase: m6A_site_408862 | ||
| mod ID: M6ASITE038002 | Click to Show/Hide the Full List | ||
| mod site | chr19:2038247-2038248:- | [5] | |
| Sequence | TAGTTTTTCCTTAAAAAAAAACAACACATCGATGGACTTTG | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa; hESC-HEK293T | ||
| Seq Type List | m6A-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000587416.5; ENST00000309340.11; ENST00000589441.5; ENST00000591601.5; ENST00000250896.7; ENST00000588014.5; ENST00000591142.5 | ||
| External Link | RMBase: m6A_site_408863 | ||
| mod ID: M6ASITE038003 | Click to Show/Hide the Full List | ||
| mod site | chr19:2038605-2038606:- | [5] | |
| Sequence | GTCCTTAGAGCTGAGCCCAGACCCCGGGGTCTGGCCGAATC | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa; CD34 | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000591601.5; ENST00000589441.5; ENST00000588014.5; ENST00000250896.7; ENST00000591142.5; ENST00000587416.5; ENST00000309340.11 | ||
| External Link | RMBase: m6A_site_408864 | ||
| mod ID: M6ASITE038004 | Click to Show/Hide the Full List | ||
| mod site | chr19:2038739-2038740:- | [5] | |
| Sequence | CAATGTGGGGGGTCCTGAAGACACCCCCTTGGGGCACCCGA | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa; CD34; A549; MM6; peripheral-blood; TREX; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000591601.5; ENST00000589441.5; ENST00000587416.5; ENST00000591142.5; ENST00000588014.5; ENST00000309340.11; ENST00000250896.7 | ||
| External Link | RMBase: m6A_site_408865 | ||
| mod ID: M6ASITE038005 | Click to Show/Hide the Full List | ||
| mod site | chr19:2038774-2038775:- | [5] | |
| Sequence | GCAGCAGGCAGAGGGGCTGGACAGGCACTGTCAGCCAATGT | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; CD34; A549; MM6; peripheral-blood; TREX; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000588014.5; ENST00000309340.11; ENST00000250896.7; ENST00000587416.5; ENST00000591601.5; ENST00000589441.5; ENST00000591142.5 | ||
| External Link | RMBase: m6A_site_408866 | ||
| mod ID: M6ASITE038006 | Click to Show/Hide the Full List | ||
| mod site | chr19:2038832-2038833:- | [9] | |
| Sequence | CCTCCACACCAAGGCCTGAGACAGCAGGAGCCCCGCCTGGC | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | CD34; HepG2; HeLa; A549; MM6; peripheral-blood; TREX | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000309340.11; ENST00000587416.5; ENST00000591601.5; ENST00000591142.5; ENST00000250896.7; ENST00000589441.5; ENST00000588014.5 | ||
| External Link | RMBase: m6A_site_408867 | ||
| mod ID: M6ASITE038007 | Click to Show/Hide the Full List | ||
| mod site | chr19:2038847-2038848:- | [6] | |
| Sequence | CGCCGCTGCCCCTCCCCTCCACACCAAGGCCTGAGACAGCA | ||
| Motif Score | 2.053113095 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000588014.5; ENST00000591142.5; ENST00000250896.7; ENST00000589441.5; ENST00000309340.11; ENST00000587416.5; ENST00000591601.5 | ||
| External Link | RMBase: m6A_site_408868 | ||
| mod ID: M6ASITE038008 | Click to Show/Hide the Full List | ||
| mod site | chr19:2038889-2038890:- | [10] | |
| Sequence | GCCTCCGACCTTGACCTTAAACTGCAGCTGACCCCAGGGGC | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HepG2; HeLa; A549; MM6; Huh7; peripheral-blood; TREX | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000309340.11; ENST00000589441.5; ENST00000250896.7; ENST00000587416.5; ENST00000591142.5; ENST00000591601.5; ENST00000588014.5 | ||
| External Link | RMBase: m6A_site_408869 | ||
| mod ID: M6ASITE038009 | Click to Show/Hide the Full List | ||
| mod site | chr19:2038929-2038930:- | [8] | |
| Sequence | GGCCCGTCTGTCTGTCCAGGACTCCTGGTGGCCAGATTCGG | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa; A549; Huh7; peripheral-blood; AML | ||
| Seq Type List | m6A-seq; MeRIP-seq; miCLIP | ||
| Transcript ID List | ENST00000250896.7; ENST00000587416.5; ENST00000591601.5; ENST00000591142.5; ENST00000588014.5; ENST00000309340.11; ENST00000589441.5 | ||
| External Link | RMBase: m6A_site_408870 | ||
| mod ID: M6ASITE038010 | Click to Show/Hide the Full List | ||
| mod site | chr19:2038969-2038970:- | [6] | |
| Sequence | CCTTGTCCCCATGATAGTTGACAATCGGGGCTTCCTGCAAG | ||
| Motif Score | 2.859755952 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000588014.5; ENST00000589441.5; ENST00000250896.7; ENST00000309340.11; ENST00000591142.5; ENST00000591601.5; ENST00000587416.5 | ||
| External Link | RMBase: m6A_site_408871 | ||
| mod ID: M6ASITE038011 | Click to Show/Hide the Full List | ||
| mod site | chr19:2039145-2039146:- | [5] | |
| Sequence | CAGCCCGCAGTATTTCAGGGACAGGCTCTTCCCCTCTATCC | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000589441.5; ENST00000250896.7; ENST00000591142.5; ENST00000587416.5; ENST00000591601.5; ENST00000588014.5; ENST00000309340.11 | ||
| External Link | RMBase: m6A_site_408872 | ||
| mod ID: M6ASITE038012 | Click to Show/Hide the Full List | ||
| mod site | chr19:2039187-2039188:- | [5] | |
| Sequence | GAGCTGGGGAGGGGCACAGGACCCTGCCCTCGTGTTCCCTC | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000591142.5; ENST00000309340.11; ENST00000591601.5; ENST00000588014.5; ENST00000587416.5; ENST00000250896.7; ENST00000589441.5 | ||
| External Link | RMBase: m6A_site_408873 | ||
| mod ID: M6ASITE038013 | Click to Show/Hide the Full List | ||
| mod site | chr19:2039622-2039623:- | [11] | |
| Sequence | CCCAGTGGTCCTGGTGGGAGACCACGCCTGACCCTCCCATC | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HepG2; HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000591601.5; ENST00000250896.7; ENST00000588014.5; ENST00000586828.5; ENST00000587416.5; ENST00000309340.11; ENST00000591142.5; ENST00000589441.5 | ||
| External Link | RMBase: m6A_site_408874 | ||
| mod ID: M6ASITE038014 | Click to Show/Hide the Full List | ||
| mod site | chr19:2039775-2039776:- | [5] | |
| Sequence | GCTGGCCCAGCACGACGAGGACCTGGCTGAGGAGGAGGCCG | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa; CD34; HepG2; peripheral-blood; HEK293T; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000587416.5; ENST00000309340.11; ENST00000591142.5; ENST00000250896.7; ENST00000591601.5; ENST00000586828.5; ENST00000589441.5; ENST00000588014.5 | ||
| External Link | RMBase: m6A_site_408875 | ||
| mod ID: M6ASITE038015 | Click to Show/Hide the Full List | ||
| mod site | chr19:2039802-2039803:- | [5] | |
| Sequence | GGCTGAGGCCATTGCCATGAACCGGCAGCTGGCCCAGCACG | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HeLa; CD34; HepG2; peripheral-blood; HEK293T; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000591142.5; ENST00000250896.7; ENST00000309340.11; ENST00000588014.5; ENST00000591601.5; ENST00000587416.5; ENST00000586828.5; ENST00000589441.5 | ||
| External Link | RMBase: m6A_site_408876 | ||
| mod ID: M6ASITE038016 | Click to Show/Hide the Full List | ||
| mod site | chr19:2039838-2039839:- | [5] | |
| Sequence | CAGGAACAGCTGTGCCAAAGACCTCACGTCCTTCGCGGCTG | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa; HepG2; peripheral-blood; HEK293T; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000586828.5; ENST00000591601.5; ENST00000589441.5; ENST00000250896.7; ENST00000591142.5; ENST00000588014.5; ENST00000587416.5; ENST00000309340.11 | ||
| External Link | RMBase: m6A_site_408877 | ||
| mod ID: M6ASITE038017 | Click to Show/Hide the Full List | ||
| mod site | chr19:2039853-2039854:- | [5] | |
| Sequence | CCCCACCCCGTTTCCCAGGAACAGCTGTGCCAAAGACCTCA | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000250896.7; ENST00000591601.5; ENST00000587416.5; ENST00000591142.5; ENST00000309340.11; ENST00000589441.5; ENST00000588014.5; ENST00000586828.5 | ||
| External Link | RMBase: m6A_site_408878 | ||
| mod ID: M6ASITE038018 | Click to Show/Hide the Full List | ||
| mod site | chr19:2039916-2039917:- | [5] | |
| Sequence | TTCCCCCAGGGCCTTCACAGACCCCAGGGGTCCCCTGAGGG | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa; HEK293T; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000586828.5; ENST00000587416.5; ENST00000591142.5; ENST00000591601.5; ENST00000589441.5; ENST00000588014.5; ENST00000250896.7; ENST00000309340.11 | ||
| External Link | RMBase: m6A_site_408879 | ||
| mod ID: M6ASITE038019 | Click to Show/Hide the Full List | ||
| mod site | chr19:2040050-2040051:- | [5] | |
| Sequence | ATTTGTGAAAGACCCGGAGAACTGCTTTGGGGTCGGGGAGG | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000588014.5; ENST00000586828.5; ENST00000309340.11; ENST00000587416.5; ENST00000589441.5; ENST00000591588.1; ENST00000250896.7; ENST00000591601.5; ENST00000591142.5 | ||
| External Link | RMBase: m6A_site_408880 | ||
| mod ID: M6ASITE038020 | Click to Show/Hide the Full List | ||
| mod site | chr19:2040059-2040060:- | [5] | |
| Sequence | GGTTAAGACATTTGTGAAAGACCCGGAGAACTGCTTTGGGG | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000309340.11; ENST00000588014.5; ENST00000589441.5; ENST00000591142.5; ENST00000591588.1; ENST00000591601.5; ENST00000250896.7; ENST00000586828.5; ENST00000587416.5 | ||
| External Link | RMBase: m6A_site_408881 | ||
| mod ID: M6ASITE038021 | Click to Show/Hide the Full List | ||
| mod site | chr19:2040072-2040073:- | [5] | |
| Sequence | GGCGGGGTTTCCAGGTTAAGACATTTGTGAAAGACCCGGAG | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000250896.7; ENST00000586828.5; ENST00000587416.5; ENST00000591142.5; ENST00000591601.5; ENST00000309340.11; ENST00000588014.5; ENST00000589441.5; ENST00000591588.1 | ||
| External Link | RMBase: m6A_site_408882 | ||
| mod ID: M6ASITE038022 | Click to Show/Hide the Full List | ||
| mod site | chr19:2040108-2040109:- | [12] | |
| Sequence | GGCCCGCAGGGGTGCTCGGGACCCCTGAGTCCAGGGGGCGG | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HEK293T; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000588014.5; ENST00000591588.1; ENST00000250896.7; ENST00000591601.5; ENST00000309340.11; ENST00000591142.5; ENST00000587416.5; ENST00000589441.5; ENST00000586828.5 | ||
| External Link | RMBase: m6A_site_408883 | ||
| mod ID: M6ASITE038023 | Click to Show/Hide the Full List | ||
| mod site | chr19:2040163-2040164:- | [5] | |
| Sequence | GTTGCAGTGCGCCCCGGAGAACACCTTGCCCACTCCCATGG | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa; HEK293T; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000589441.5; ENST00000587416.5; ENST00000591601.5; ENST00000250896.7; ENST00000588014.5; ENST00000586828.5; ENST00000591588.1; ENST00000585667.1; ENST00000591142.5; ENST00000309340.11 | ||
| External Link | RMBase: m6A_site_408884 | ||
| mod ID: M6ASITE038024 | Click to Show/Hide the Full List | ||
| mod site | chr19:2040245-2040246:- | [5] | |
| Sequence | GCATGGCATCCCTTGGCCAGACACCCCACCCAGCGCCCCAG | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa; HEK293T; endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000591588.1; ENST00000589441.5; ENST00000250896.7; ENST00000586828.5; ENST00000585667.1; ENST00000587416.5; ENST00000591142.5; ENST00000309340.11; ENST00000588014.5; ENST00000591601.5 | ||
| External Link | RMBase: m6A_site_408885 | ||
| mod ID: M6ASITE038025 | Click to Show/Hide the Full List | ||
| mod site | chr19:2040732-2040733:- | [13] | |
| Sequence | AGCGAGCCCAGCTCACATAGACCCCAGCCTAGCCTGCCGTC | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000588014.5; ENST00000586828.5; ENST00000585667.1; ENST00000591588.1; ENST00000591142.5; ENST00000309340.11; ENST00000250896.7; ENST00000587416.5; ENST00000586620.2; ENST00000591601.5; ENST00000589441.5 | ||
| External Link | RMBase: m6A_site_408886 | ||
| mod ID: M6ASITE038026 | Click to Show/Hide the Full List | ||
| mod site | chr19:2040787-2040788:- | [13] | |
| Sequence | CTTCCTGGAGGGTGGTGGGGACCCACAGCCTGCAGCAGGCT | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000586828.5; ENST00000591601.5; ENST00000250896.7; ENST00000309340.11; ENST00000591588.1; ENST00000586620.2; ENST00000585667.1; ENST00000587416.5; ENST00000591142.5; ENST00000589441.5; ENST00000588014.5 | ||
| External Link | RMBase: m6A_site_408887 | ||
| mod ID: M6ASITE038027 | Click to Show/Hide the Full List | ||
| mod site | chr19:2040809-2040810:- | [13] | |
| Sequence | CAGGAGCAGCTACTCAGAGAACCTTCCTGGAGGGTGGTGGG | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000589441.5; ENST00000591601.5; ENST00000591588.1; ENST00000585667.1; ENST00000250896.7; ENST00000588014.5; ENST00000591142.5; ENST00000587416.5; ENST00000586828.5; ENST00000586620.2; ENST00000309340.11 | ||
| External Link | RMBase: m6A_site_408888 | ||
| mod ID: M6ASITE038028 | Click to Show/Hide the Full List | ||
| mod site | chr19:2040945-2040946:- | [5] | |
| Sequence | GCCCTGAGGGTGTAGCCTGGACACCCTGAGATGCACTGAGG | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000309340.11; ENST00000585667.1; ENST00000586620.2; ENST00000589441.5; ENST00000591601.5; ENST00000591588.1; ENST00000591142.5; ENST00000588014.5; ENST00000587416.5; ENST00000250896.7; ENST00000586828.5 | ||
| External Link | RMBase: m6A_site_408889 | ||
| mod ID: M6ASITE038029 | Click to Show/Hide the Full List | ||
| mod site | chr19:2041121-2041122:- | [5] | |
| Sequence | CATCTCCTGCGCTGCCAAAGACCTCATCTCCAAGCTGCTGG | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa; HEK293T | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000587416.5; ENST00000591142.5; ENST00000586828.5; ENST00000589441.5; ENST00000588014.5; ENST00000591601.5; ENST00000591588.1; ENST00000250896.7; ENST00000309340.11; ENST00000585667.1; ENST00000586620.2 | ||
| External Link | RMBase: m6A_site_408890 | ||
| mod ID: M6ASITE038030 | Click to Show/Hide the Full List | ||
| mod site | chr19:2041151-2041152:- | [5] | |
| Sequence | GTACGAGTTCCCCGACAAGGACTGGGCCCACATCTCCTGCG | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa; peripheral-blood; HEK293T | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000586828.5; ENST00000591601.5; ENST00000585667.1; ENST00000589441.5; ENST00000591142.5; ENST00000586620.2; ENST00000250896.7; ENST00000588014.5; ENST00000591588.1; ENST00000309340.11; ENST00000587416.5 | ||
| External Link | RMBase: m6A_site_408891 | ||
| mod ID: M6ASITE038031 | Click to Show/Hide the Full List | ||
| mod site | chr19:2041867-2041868:- | [5] | |
| Sequence | TGGCAGCGACTGCGGCTGGGACCGCGGCGAGGCCTGCCCTG | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000585667.1; ENST00000250896.7; ENST00000591588.1; ENST00000591142.5; ENST00000591601.5; ENST00000587416.5; ENST00000586828.5; ENST00000586620.2; ENST00000309340.11; ENST00000588014.5 | ||
| External Link | RMBase: m6A_site_408892 | ||
| mod ID: M6ASITE038032 | Click to Show/Hide the Full List | ||
| mod site | chr19:2041966-2041967:- | [6] | |
| Sequence | CGAGGAGGCTAGCATCTACGACAAGCGCTGCGACCTGTGGA | ||
| Motif Score | 2.865571429 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000585667.1; ENST00000250896.7; ENST00000586828.5; ENST00000591142.5; ENST00000588014.5; ENST00000309340.11; ENST00000587416.5; ENST00000591588.1; ENST00000591601.5; ENST00000586620.2 | ||
| External Link | RMBase: m6A_site_408893 | ||
| mod ID: M6ASITE038033 | Click to Show/Hide the Full List | ||
| mod site | chr19:2042017-2042018:- | [14] | |
| Sequence | GCAGTGCGGCTCGGCGGAGTACATGGCCCCGGAGGTAGTGG | ||
| Motif Score | 2.856142857 | ||
| Cell/Tissue List | brain; hESC-HEK293T | ||
| Seq Type List | m6A-REF-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000586828.5; ENST00000585667.1; ENST00000587416.5; ENST00000591588.1; ENST00000591142.5; ENST00000591601.5; ENST00000586620.2; ENST00000309340.11; ENST00000250896.7; ENST00000588014.5 | ||
| External Link | RMBase: m6A_site_408894 | ||
| mod ID: M6ASITE038034 | Click to Show/Hide the Full List | ||
| mod site | chr19:2042066-2042067:- | [5] | |
| Sequence | TTCCCACGTAATGCTGGGAAACCCCGGCTGACGCGCCCCTC | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa; peripheral-blood | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000309340.11; ENST00000591588.1; ENST00000588014.5; ENST00000586828.5; ENST00000250896.7; ENST00000587416.5; ENST00000591601.5; ENST00000585667.1; ENST00000591142.5; ENST00000586620.2 | ||
| External Link | RMBase: m6A_site_408895 | ||
| mod ID: M6ASITE038035 | Click to Show/Hide the Full List | ||
| mod site | chr19:2042463-2042464:- | [15] | |
| Sequence | CGGCATCAAACTCAACGGGGACTGCTCCCCTATCTCCACCC | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | peripheral-blood; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000586828.5; ENST00000309340.11; ENST00000588014.5; ENST00000587416.5; ENST00000585667.1; ENST00000591601.5; ENST00000250896.7 | ||
| External Link | RMBase: m6A_site_408896 | ||
| mod ID: M6ASITE038036 | Click to Show/Hide the Full List | ||
| mod site | chr19:2042474-2042475:- | [15] | |
| Sequence | GACCTGGGCAGCGGCATCAAACTCAACGGGGACTGCTCCCC | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | peripheral-blood; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000309340.11; ENST00000588014.5; ENST00000585667.1; ENST00000591601.5; ENST00000587416.5; ENST00000586828.5; ENST00000250896.7 | ||
| External Link | RMBase: m6A_site_408897 | ||
| mod ID: M6ASITE038037 | Click to Show/Hide the Full List | ||
| mod site | chr19:2042631-2042632:- | [16] | |
| Sequence | CAGGGACCTAAAGCCGGAAAACATCCTCTGTGAGCACCCCA | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HepG2; hESC-HEK293T; peripheral-blood; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000588014.5; ENST00000591601.5; ENST00000587416.5; ENST00000309340.11; ENST00000586828.5; ENST00000250896.7; ENST00000585667.1 | ||
| External Link | RMBase: m6A_site_408898 | ||
| mod ID: M6ASITE038038 | Click to Show/Hide the Full List | ||
| mod site | chr19:2042646-2042647:- | [11] | |
| Sequence | CCCAGGCATCGCCCACAGGGACCTAAAGCCGGAAAACATCC | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HepG2; peripheral-blood; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000585667.1; ENST00000250896.7; ENST00000587416.5; ENST00000591601.5; ENST00000586828.5; ENST00000309340.11 | ||
| External Link | RMBase: m6A_site_408899 | ||
| mod ID: M6ASITE038040 | Click to Show/Hide the Full List | ||
| mod site | chr19:2042699-2042700:- | [11] | |
| Sequence | GACTCCTGGAAGACCTCCAGACCCTCACCCCGTCGTGGTTC | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HepG2; peripheral-blood; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000250896.7; ENST00000585667.1; ENST00000586828.5; ENST00000309340.11; ENST00000591601.5 | ||
| External Link | RMBase: m6A_site_408900 | ||
| mod ID: M6ASITE038041 | Click to Show/Hide the Full List | ||
| mod site | chr19:2042707-2042708:- | [11] | |
| Sequence | CTGCCAAGGACTCCTGGAAGACCTCCAGACCCTCACCCCGT | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HepG2; peripheral-blood; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000250896.7; ENST00000309340.11; ENST00000586828.5; ENST00000591601.5; ENST00000585667.1 | ||
| External Link | RMBase: m6A_site_408901 | ||
| mod ID: M6ASITE038042 | Click to Show/Hide the Full List | ||
| mod site | chr19:2042718-2042719:- | [11] | |
| Sequence | CCTAGGGCCGCCTGCCAAGGACTCCTGGAAGACCTCCAGAC | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HepG2; peripheral-blood; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000250896.7; ENST00000585667.1; ENST00000591601.5; ENST00000309340.11; ENST00000586828.5 | ||
| External Link | RMBase: m6A_site_408902 | ||
| mod ID: M6ASITE038043 | Click to Show/Hide the Full List | ||
| mod site | chr19:2042770-2042771:- | [6] | |
| Sequence | CGCCTTGGACTTTCTGCATAACAAAGGTAGGTGGTGACCCC | ||
| Motif Score | 2.168095238 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000309340.11; ENST00000250896.7; ENST00000591601.5; ENST00000585667.1; ENST00000586828.5 | ||
| External Link | RMBase: m6A_site_408903 | ||
| mod ID: M6ASITE038044 | Click to Show/Hide the Full List | ||
| mod site | chr19:2042782-2042783:- | [11] | |
| Sequence | GGACGTGGCCAGCGCCTTGGACTTTCTGCATAACAAAGGTA | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HepG2; MT4; peripheral-blood; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000586828.5; ENST00000250896.7; ENST00000585667.1; ENST00000309340.11; ENST00000591601.5 | ||
| External Link | RMBase: m6A_site_408904 | ||
| mod ID: M6ASITE038045 | Click to Show/Hide the Full List | ||
| mod site | chr19:2042848-2042849:- | [6] | |
| Sequence | CTCCATCCTGAGCCACATCCACAAGCGCCGGCACTTCAACG | ||
| Motif Score | 2.053113095 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000309340.11; ENST00000586828.5; ENST00000591601.5; ENST00000250896.7; ENST00000585667.1 | ||
| External Link | RMBase: m6A_site_408905 | ||
| mod ID: M6ASITE038046 | Click to Show/Hide the Full List | ||
| mod site | chr19:2042854-2042855:- | [6] | |
| Sequence | CCCAGGCTCCATCCTGAGCCACATCCACAAGCGCCGGCACT | ||
| Motif Score | 2.053113095 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000591601.5; ENST00000309340.11; ENST00000586828.5; ENST00000585667.1; ENST00000250896.7 | ||
| External Link | RMBase: m6A_site_408906 | ||
| mod ID: M6ASITE038047 | Click to Show/Hide the Full List | ||
| mod site | chr19:2043158-2043159:- | [5] | |
| Sequence | TGAGTTCTTCGAGGAGGAGGACCGCTTCTACCTGGTGTTTG | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa; HepG2; U2OS; MT4; Huh7; peripheral-blood; HEK293T; endometrial; HEC-1-A; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000309340.11; ENST00000250896.7; ENST00000585667.1; ENST00000586828.5; ENST00000591601.5 | ||
| External Link | RMBase: m6A_site_408907 | ||
| mod ID: M6ASITE038048 | Click to Show/Hide the Full List | ||
| mod site | chr19:2043507-2043508:- | [5] | |
| Sequence | ATGCTGTACCAGTGCCAGGGACACAGGTAGGTGAGCCACCC | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; HepG2; hESC-HEK293T; U2OS; MT4; Huh7; peripheral-blood; endometrial; HEC-1-A; NB4 | ||
| Seq Type List | m6A-seq; MAZTER-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000250896.7; ENST00000309340.11; ENST00000586828.5; ENST00000591601.5; ENST00000585667.1 | ||
| External Link | RMBase: m6A_site_408908 | ||
| mod ID: M6ASITE038049 | Click to Show/Hide the Full List | ||
| mod site | chr19:2043559-2043560:- | [14] | |
| Sequence | CATTGAGAAGCAGCCAGGCCACATTCGGAGCAGGGTTTTCA | ||
| Motif Score | 2.053113095 | ||
| Cell/Tissue List | liver; hESC-HEK293T | ||
| Seq Type List | m6A-REF-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000309340.11; ENST00000250896.7; ENST00000591601.5; ENST00000586828.5 | ||
| External Link | RMBase: m6A_site_408909 | ||
| mod ID: M6ASITE038050 | Click to Show/Hide the Full List | ||
| mod site | chr19:2046226-2046227:- | [5] | |
| Sequence | GCGCTCATGCCCGAGTGCAGACCTGCATCAACCTGATCACC | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa; CD34; HepG2; U2OS; MT4; MM6; Huh7; peripheral-blood; HEK293T; endometrial; HEC-1-A; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000250896.7; ENST00000591601.5; ENST00000586828.5; ENST00000309340.11 | ||
| External Link | RMBase: m6A_site_408910 | ||
| mod ID: M6ASITE038051 | Click to Show/Hide the Full List | ||
| mod site | chr19:2046443-2046444:- | [6] | |
| Sequence | GCCCGCCAGCCAGCCCATTGACATCCCGGACGCCAAGAAGA | ||
| Motif Score | 2.859755952 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000250896.7; ENST00000591601.5; ENST00000586828.5; ENST00000309340.11 | ||
| External Link | RMBase: m6A_site_408911 | ||
| mod ID: M6ASITE038052 | Click to Show/Hide the Full List | ||
| mod site | chr19:2046467-2046468:- | [6] | |
| Sequence | GGGCGTGCCTCCTGGAACAGACATGCCCGCCAGCCAGCCCA | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000309340.11; ENST00000250896.7; ENST00000589509.5; ENST00000591601.5; ENST00000586828.5 | ||
| External Link | RMBase: m6A_site_408912 | ||
| mod ID: M6ASITE038053 | Click to Show/Hide the Full List | ||
| mod site | chr19:2046638-2046639:- | [5] | |
| Sequence | AGACCAGCCCGACCACGGAGACTCTGACTTTGGCCTGCAGT | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa; CD34; HEK293T; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000589509.5; ENST00000586828.5; ENST00000309340.11; ENST00000250896.7; ENST00000589534.2; ENST00000591601.5 | ||
| External Link | RMBase: m6A_site_408913 | ||
| mod ID: M6ASITE038054 | Click to Show/Hide the Full List | ||
| mod site | chr19:2046656-2046657:- | [5] | |
| Sequence | CGAGCTGGCCTTCTCCCTAGACCAGCCCGACCACGGAGACT | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa; CD34; HEK293T; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000309340.11; ENST00000586828.5; ENST00000591601.5; ENST00000589509.5; ENST00000589534.2; ENST00000250896.7 | ||
| External Link | RMBase: m6A_site_408914 | ||
| mod ID: M6ASITE038055 | Click to Show/Hide the Full List | ||
| mod site | chr19:2046683-2046684:- | [5] | |
| Sequence | CTCTCCCCTGCAGGGGCAGAACCCCTTCGAGCTGGCCTTCT | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HeLa; CD34; HEK293T; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000589534.2; ENST00000589509.5; ENST00000250896.7; ENST00000309340.11; ENST00000586828.5; ENST00000591601.5 | ||
| External Link | RMBase: m6A_site_408915 | ||
| mod ID: M6ASITE038056 | Click to Show/Hide the Full List | ||
| mod site | chr19:2050827-2050828:- | [5] | |
| Sequence | GTGCAGAAGAAACCAGCCGAACTTCAGGGTTTCCACCGTTC | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa; HEK293T | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000586828.5; ENST00000250896.7; ENST00000591601.5; ENST00000589509.5; ENST00000309340.11; ENST00000589534.2 | ||
| External Link | RMBase: m6A_site_408916 | ||
| mod ID: M6ASITE038057 | Click to Show/Hide the Full List | ||
| mod site | chr19:2050836-2050837:- | [5] | |
| Sequence | CAGAAGATGGTGCAGAAGAAACCAGCCGAACTTCAGGGTTT | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa; HEK293T | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000589509.5; ENST00000589534.2; ENST00000586828.5; ENST00000309340.11; ENST00000591601.5; ENST00000250896.7 | ||
| External Link | RMBase: m6A_site_408917 | ||
| mod ID: M6ASITE038058 | Click to Show/Hide the Full List | ||
| mod site | chr19:2050857-2050858:- | [5] | |
| Sequence | CCCCCGCTGGCGGGGCCCGGACAGAAGATGGTGCAGAAGAA | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; HEK293T | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000250896.7; ENST00000589534.2; ENST00000309340.11; ENST00000589509.5; ENST00000591601.5 | ||
| External Link | RMBase: m6A_site_408918 | ||
2'-O-Methylation (2'-O-Me)
| In total 1 m6A sequence/site(s) in this target gene | |||
| mod ID: 2OMSITE000185 | Click to Show/Hide the Full List | ||
| mod site | chr19:2037754-2037755:- | [17] | |
| Sequence | TGGAGGACTGGTCAGAACCGTTACTGTGAATGAGTGAAGAT | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | Nm-seq | ||
| Transcript ID List | ENST00000250896.7; ENST00000591601.5; ENST00000587416.5; ENST00000309340.11; ENST00000589441.5; ENST00000591142.5 | ||
| External Link | RMBase: Nm_site_2732 | ||
Pseudouridine (Pseudo)
| In total 1 m6A sequence/site(s) in this target gene | |||
| mod ID: PSESITE000117 | Click to Show/Hide the Full List | ||
| mod site | chr19:2037587-2037588:- | [18] | |
| Sequence | GGGAAAAACATCCAAGCACTTTAATTCCAATGTACCAGGTG | ||
| Transcript ID List | ENST00000589441.5; ENST00000250896.7; ENST00000587416.5; ENST00000309340.11; ENST00000591142.5; ENST00000591601.5 | ||
| External Link | RMBase: Pseudo_site_2404 | ||
References

