General Information of the m6A Target Gene (ID: M6ATAR01835)
Target Name B-cell lymphoma 6 protein (BCL6)
Synonyms
BCL5; LAZ3; ZBTB27; ZNF51; B-cell lymphoma 5 protein (BCL-5); Protein LAZ-3; Zinc finger and BTB domain-containing protein 27; Zinc finger protein 51
    Click to Show/Hide
Gene Name BCL6
Chromosomal Location 3q27.3
Function
Transcriptional repressor mainly required for germinal center (GC) formation and antibody affinity maturation which has different mechanisms of action specific to the lineage and biological functions. Forms complexes with different corepressors and histone deacetylases to repress the transcriptional expression of different subsets of target genes. Represses its target genes by binding directly to the DNA sequence 5'-TTCCTAGAA-3' (BCL6-binding site) or indirectly by repressing the transcriptional activity of transcription factors. In GC B-cells, represses genes that function in differentiation, inflammation, apoptosis and cell cycle control, also autoregulates its transcriptional expression and up-regulates, indirectly, the expression of some genes important for GC reactions, such as AICDA, through the repression of microRNAs expression, like miR155. An important function is to allow GC B-cells to proliferate very rapidly in response to T-cell dependent antigens and tolerate the physiological DNA breaks required for immunglobulin class switch recombination and somatic hypermutation without inducing a p53/TP53-dependent apoptotic response. In follicular helper CD4+ T-cells (T(FH) cells), promotes the expression of T(FH)-related genes but inhibits the differentiation of T(H)1, T(H)2 and T(H)17 cells. Also required for the establishment and maintenance of immunological memory for both T- and B-cells. Suppresses macrophage proliferation through competition with STAT5 for STAT-binding motifs binding on certain target genes, such as CCL2 and CCND2. In response to genotoxic stress, controls cell cycle arrest in GC B-cells in both p53/TP53-dependedent and -independent manners. Besides, also controls neurogenesis through the alteration of the composition of NOTCH-dependent transcriptional complexes at selective NOTCH targets, such as HES5, including the recruitment of the deacetylase SIRT1 and resulting in an epigenetic silencing leading to neuronal differentiation.
    Click to Show/Hide
Gene ID 604
Uniprot ID
BCL6_HUMAN
HGNC ID
HGNC:1001
KEGG ID
hsa:604
Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator
DNA modification
m6A Regulator: Methyltransferase-like 3 (METTL3)
In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT06007
Epigenetic Regulator Methylcytosine dioxygenase TET1 (TET1)
Regulated Target B-cell lymphoma 6 protein (BCL6)
Crosstalk relationship m6A → DNA modification
Disease Esophageal Squamous Cell Carcinoma
m6A Regulator: RNA-binding protein FXR1 (FXR1)
In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT06008
Epigenetic Regulator Methylcytosine dioxygenase TET1 (TET1)
Regulated Target B-cell lymphoma 6 protein (BCL6)
Crosstalk relationship m6A → DNA modification
Disease Esophageal Squamous Cell Carcinoma
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR01835)
B-cell lymphoma 6 protein (BCL6)
N6-methyladenosine (m6A)
In total 33 m6A sequence/site(s) in this target gene
mod ID: M6ASITE064018 Click to Show/Hide the Full List
mod site chr3:187722054-187722055:- [2]
Sequence GCATTCTTTTAAAAGACAAGACTTCAGTATGTTGTCAAAGA
Motif Score 3.319380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000406870.7; ENST00000419510.6; ENST00000621333.4
External Link RMBase: m6A_site_622478
mod ID: M6ASITE064019 Click to Show/Hide the Full List
mod site chr3:187722059-187722060:- [2]
Sequence AATGTGCATTCTTTTAAAAGACAAGACTTCAGTATGTTGTC
Motif Score 2.897386905
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000621333.4; ENST00000419510.6; ENST00000406870.7
External Link RMBase: m6A_site_622479
mod ID: M6ASITE064020 Click to Show/Hide the Full List
mod site chr3:187722101-187722102:- [2]
Sequence AATGTATATGTTTTGTGGGAACAGATGTTTCTTTTGTATGT
Motif Score 2.951386905
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000419510.6; ENST00000406870.7; ENST00000621333.4
External Link RMBase: m6A_site_622480
mod ID: M6ASITE064021 Click to Show/Hide the Full List
mod site chr3:187722295-187722296:- [3]
Sequence TGGGGGTCGGGGCCTGGGGGACTGGGAGCCGCAGCAGCTCC
Motif Score 4.065041667
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000621333.4; ENST00000419510.6; ENST00000406870.7
External Link RMBase: m6A_site_622481
mod ID: M6ASITE064022 Click to Show/Hide the Full List
mod site chr3:187724588-187724589:- [3]
Sequence ACTTATTGATTGCCTCCTGGACACCCCATACTGGGCTAGAT
Motif Score 3.643047619
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000232014.8; ENST00000450123.6; ENST00000419510.6; ENST00000621333.4; ENST00000406870.7; ENST00000479110.1
External Link RMBase: m6A_site_622482
mod ID: M6ASITE064023 Click to Show/Hide the Full List
mod site chr3:187724647-187724648:- [3]
Sequence TCTAGACTGTGGATACATAGACTTGATTCACTCCACCTAGA
Motif Score 3.319380952
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000450123.6; ENST00000479110.1; ENST00000232014.8; ENST00000406870.7; ENST00000621333.4; ENST00000419510.6
External Link RMBase: m6A_site_622483
mod ID: M6ASITE064024 Click to Show/Hide the Full List
mod site chr3:187725521-187725522:- [3]
Sequence AGAAGCCCTACAAATGCGAAACCTGCGGAGCCAGATTTGTA
Motif Score 2.185083333
Cell/Tissue List Huh7; endometrial
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000479110.1; ENST00000406870.7; ENST00000621333.4; ENST00000232014.8; ENST00000419510.6; ENST00000450123.6
External Link RMBase: m6A_site_622484
mod ID: M6ASITE064025 Click to Show/Hide the Full List
mod site chr3:187725566-187725567:- [3]
Sequence ACCGGCCAGCCAACCTGAAAACCCACACTCGAATTCACTCT
Motif Score 2.185083333
Cell/Tissue List Huh7; endometrial
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000232014.8; ENST00000419510.6; ENST00000479110.1; ENST00000406870.7; ENST00000621333.4; ENST00000450123.6
External Link RMBase: m6A_site_622485
mod ID: M6ASITE064026 Click to Show/Hide the Full List
mod site chr3:187725621-187725622:- [4]
Sequence TTCTTGGTAATAGGTGAGAAACCCTATCGTTGCAACATCTG
Motif Score 2.185083333
Cell/Tissue List MT4; Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000232014.8; ENST00000450123.6; ENST00000406870.7; ENST00000479110.1; ENST00000621333.4; ENST00000419510.6
External Link RMBase: m6A_site_622486
mod ID: M6ASITE064027 Click to Show/Hide the Full List
mod site chr3:187726742-187726743:- [4]
Sequence GCAACCTCGCCAGCCACAAGACCGTCCATACCGGTATGGCC
Motif Score 2.876744048
Cell/Tissue List MT4; Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000406870.7; ENST00000232014.8; ENST00000419510.6; ENST00000450123.6; ENST00000621333.4
External Link RMBase: m6A_site_622487
mod ID: M6ASITE064028 Click to Show/Hide the Full List
mod site chr3:187726806-187726807:- [4]
Sequence CTGCAGACCCACAGTGACAAACCCTACAAGTGTGACCGCTG
Motif Score 2.185083333
Cell/Tissue List MT4; Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000406870.7; ENST00000450123.6; ENST00000419510.6; ENST00000621333.4; ENST00000232014.8
External Link RMBase: m6A_site_622488
mod ID: M6ASITE064029 Click to Show/Hide the Full List
mod site chr3:187726820-187726821:- [3]
Sequence TCAAGAGGCACACGCTGCAGACCCACAGTGACAAACCCTAC
Motif Score 2.876744048
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000232014.8; ENST00000450123.6; ENST00000419510.6; ENST00000406870.7; ENST00000621333.4
External Link RMBase: m6A_site_622489
mod ID: M6ASITE064030 Click to Show/Hide the Full List
mod site chr3:187728389-187728390:- [2]
Sequence TCCCTGAGGAGATGGGAGAGACCCAGTCTGAGTACTCAGAT
Motif Score 2.876744048
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000450123.6; ENST00000232014.8; ENST00000406870.7; ENST00000419510.6; ENST00000621333.4
External Link RMBase: m6A_site_622490
mod ID: M6ASITE064031 Click to Show/Hide the Full List
mod site chr3:187729094-187729095:- [2]
Sequence GCTGAGTGCCAGCGGGGAGGACTCCACCATCCCACAAGCCA
Motif Score 4.065041667
Cell/Tissue List HeLa; MM6; Huh7; CD4T; GSC-11; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000450123.6; ENST00000232014.8; ENST00000406870.7; ENST00000419510.6; ENST00000621333.4
External Link RMBase: m6A_site_622491
mod ID: M6ASITE064032 Click to Show/Hide the Full List
mod site chr3:187729139-187729140:- [2]
Sequence GCCACCCATGGAGCCTGAGAACCTTGACCTCCAGTCCCCAA
Motif Score 2.930744048
Cell/Tissue List HeLa; MM6; Huh7; CD4T; GSC-11; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000406870.7; ENST00000450123.6; ENST00000419510.6; ENST00000232014.8; ENST00000621333.4
External Link RMBase: m6A_site_622492
mod ID: M6ASITE064033 Click to Show/Hide the Full List
mod site chr3:187729231-187729232:- [2]
Sequence AGCCTCAACCAGAATGCCAAACCAGAGGGGCCTGAGCAGGC
Motif Score 2.185083333
Cell/Tissue List HeLa; HepG2; HEK293T; MM6; Huh7; CD4T; GSC-11; MSC; endometrial; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000232014.8; ENST00000621333.4; ENST00000450123.6; ENST00000419510.6; ENST00000406870.7
External Link RMBase: m6A_site_622493
mod ID: M6ASITE064034 Click to Show/Hide the Full List
mod site chr3:187729371-187729372:- [5]
Sequence ACTGCCAGCCCAACTCGCCCACAGAGTCCTGCAGCAGTAAG
Motif Score 2.053113095
Cell/Tissue List brain
Seq Type List m6A-REF-seq
Transcript ID List ENST00000419510.6; ENST00000621333.4; ENST00000450123.6; ENST00000406870.7; ENST00000232014.8
External Link RMBase: m6A_site_622494
mod ID: M6ASITE064035 Click to Show/Hide the Full List
mod site chr3:187729433-187729434:- [2]
Sequence GCCCCCCAATGCACCCCTGAACCGGAAGGGTCTGGTTAGTC
Motif Score 2.930744048
Cell/Tissue List HeLa; HepG2; HEK293T; U2OS; A549; MT4; MM6; Huh7; HEK293A-TOA; MSC; endometrial; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000419510.6; ENST00000450123.6; ENST00000232014.8; ENST00000406870.7; ENST00000621333.4
External Link RMBase: m6A_site_622495
mod ID: M6ASITE064036 Click to Show/Hide the Full List
mod site chr3:187729489-187729490:- [2]
Sequence GCCAGCAAAGAAGAAGAGAGACCCTCCTCGGAAGATGAGAT
Motif Score 2.876744048
Cell/Tissue List HeLa; CD34; HEK293T; MT4; MM6; Huh7; HEK293A-TOA; MSC; endometrial; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000450123.6; ENST00000621333.4; ENST00000419510.6; ENST00000232014.8; ENST00000406870.7
External Link RMBase: m6A_site_622496
mod ID: M6ASITE064037 Click to Show/Hide the Full List
mod site chr3:187729558-187729559:- [2]
Sequence AGTGTGGCTGAGGGCCTCAAACCTGCTGCCCCCTCAGCCCG
Motif Score 2.185083333
Cell/Tissue List HeLa; CD34; HEK293T; MT4; MM6; Huh7; HEK293A-TOA
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000232014.8; ENST00000406870.7; ENST00000450123.6; ENST00000621333.4; ENST00000419510.6
External Link RMBase: m6A_site_622497
mod ID: M6ASITE064038 Click to Show/Hide the Full List
mod site chr3:187729614-187729615:- [6]
Sequence ATATCTATTCACCCAAGGAAACAATCCCAGAAGAGGCACGA
Motif Score 2.20572619
Cell/Tissue List CD34; HEK293T; HeLa; MT4; MM6; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000406870.7; ENST00000232014.8; ENST00000419510.6; ENST00000621333.4; ENST00000450123.6
External Link RMBase: m6A_site_622498
mod ID: M6ASITE064039 Click to Show/Hide the Full List
mod site chr3:187729679-187729680:- [5]
Sequence CAGGCCAGTCCCTGGTGAGTACAGCCGGCCGACTTTGGAGG
Motif Score 2.856142857
Cell/Tissue List kidney
Seq Type List m6A-REF-seq
Transcript ID List ENST00000406870.7; ENST00000450123.6; ENST00000232014.8; ENST00000419510.6; ENST00000621333.4
External Link RMBase: m6A_site_622499
mod ID: M6ASITE064040 Click to Show/Hide the Full List
mod site chr3:187729910-187729911:- [3]
Sequence GGGTCGTGAGGTGGTGGAGAACAACCTGCCACTGAGGAGCG
Motif Score 2.951386905
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000621333.4; ENST00000419510.6; ENST00000406870.7; ENST00000232014.8; ENST00000450123.6
External Link RMBase: m6A_site_622500
mod ID: M6ASITE064041 Click to Show/Hide the Full List
mod site chr3:187733697-187733698:- [2]
Sequence GCCTCTTTTTTCAAGTGAAGACAAAATGGCCTCGCCGGCTG
Motif Score 2.897386905
Cell/Tissue List HeLa; CD4T; TIME
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000419510.6; ENST00000232014.8; ENST00000438077.1; ENST00000406870.7; ENST00000480458.5; ENST00000430339.5; ENST00000450123.6; ENST00000621333.4
External Link RMBase: m6A_site_622503
mod ID: M6ASITE064042 Click to Show/Hide the Full List
mod site chr3:187734562-187734563:- [2]
Sequence AAGCCTAACAGTAGAGAGAGACCAATGGTGACTGAGATGAT
Motif Score 2.876744048
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000406870.7; ENST00000621333.4; ENST00000470319.1; ENST00000232014.8; ENST00000450123.6; ENST00000419510.6; ENST00000430339.5; ENST00000438077.1; ENST00000480458.5
External Link RMBase: m6A_site_622506
mod ID: M6ASITE064043 Click to Show/Hide the Full List
mod site chr3:187734831-187734832:- [7]
Sequence ATATGCTTTAAAATGTTGGGACAAACTGTTTCTTTTGAATT
Motif Score 3.643047619
Cell/Tissue List MSC
Seq Type List MeRIP-seq
Transcript ID List ENST00000450123.6; ENST00000232014.8; ENST00000470319.1; ENST00000430339.5; ENST00000406870.7; ENST00000438077.1; ENST00000419510.6; ENST00000480458.5; ENST00000621333.4
External Link RMBase: m6A_site_622507
mod ID: M6ASITE064044 Click to Show/Hide the Full List
mod site chr3:187734887-187734888:- [7]
Sequence GGTTTTGAGCAAAATTTTGGACTGTGAAGCAAGGCATTGGG
Motif Score 4.065041667
Cell/Tissue List MSC
Seq Type List MeRIP-seq
Transcript ID List ENST00000438077.1; ENST00000232014.8; ENST00000480458.5; ENST00000406870.7; ENST00000430339.5; ENST00000419510.6; ENST00000621333.4; ENST00000470319.1
External Link RMBase: m6A_site_622508
mod ID: M6ASITE064045 Click to Show/Hide the Full List
mod site chr3:187736114-187736115:- [2]
Sequence TTGGTTACAGACTCAAGGAAACCTCTCATTTTAGAGTGCTC
Motif Score 2.185083333
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000470319.1; ENST00000232014.8; ENST00000419510.6; ENST00000438077.1; ENST00000406870.7; ENST00000480458.5; ENST00000621333.4
External Link RMBase: m6A_site_622509
mod ID: M6ASITE064046 Click to Show/Hide the Full List
mod site chr3:187736124-187736125:- [2]
Sequence GTCAGAGTGTTTGGTTACAGACTCAAGGAAACCTCTCATTT
Motif Score 3.319380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000406870.7; ENST00000470319.1; ENST00000480458.5; ENST00000232014.8; ENST00000419510.6; ENST00000438077.1; ENST00000621333.4
External Link RMBase: m6A_site_622510
mod ID: M6ASITE064047 Click to Show/Hide the Full List
mod site chr3:187736157-187736158:- [2]
Sequence TTGAGTGACTGGCACTTGGGACCACAGAGAAATGTCAGAGT
Motif Score 3.622404762
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000232014.8; ENST00000406870.7; ENST00000480458.5; ENST00000438077.1; ENST00000470319.1; ENST00000419510.6; ENST00000621333.4
External Link RMBase: m6A_site_622511
mod ID: M6ASITE064048 Click to Show/Hide the Full List
mod site chr3:187739888-187739889:- [8]
Sequence AGTGCCTTCCATCTTCATTAACGTGAATAAGGACCTTGGCT
Motif Score 2.142029762
Cell/Tissue List A549
Seq Type List m6A-CLIP/IP
Transcript ID List ENST00000496823.1; ENST00000480458.5; ENST00000406870.7; ENST00000621333.4; ENST00000470319.1
External Link RMBase: m6A_site_622512
mod ID: M6ASITE064049 Click to Show/Hide the Full List
mod site chr3:187745415-187745416:- [2]
Sequence AAGTTTCTAGGAAAGGCCGGACACCAGGTGATTATTGCTGT
Motif Score 3.643047619
Cell/Tissue List HeLa; MSC
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000496823.1; ENST00000406870.7; ENST00000470319.1; ENST00000480458.5; ENST00000621333.4
External Link RMBase: m6A_site_622514
mod ID: M6ASITE064050 Click to Show/Hide the Full List
mod site chr3:187745464-187745465:- [2]
Sequence GAGCTCTGTTGATTCTTAGAACTGGGGTTCTTAGAAGTGGT
Motif Score 3.373380952
Cell/Tissue List HeLa
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000621333.4; ENST00000470319.1; ENST00000406870.7
External Link RMBase: m6A_site_622515