m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR01707)

Target Name	Cytochrome c oxidase subunit 4 isoform 1, mitochondrial (COX4I1)
Synonyms	Cytochrome c oxidase polypeptide IV; Cytochrome c oxidase subunit IV isoform 1; COX IV-1 Click to Show/Hide
Gene Name	COX4I1
Chromosomal Location	16q24.1
Family	Cytochrome c oxidase IV family
Function	Component of the cytochrome c oxidase, the last enzyme in the mitochondrial electron transport chain which drives oxidative phosphorylation. The respiratory chain contains 3 multisubunit complexes succinate dehydrogenase (complex II, CII), ubiquinol-cytochrome c oxidoreductase (cytochrome b-c1 complex, complex III, CIII) and cytochrome c oxidase (complex IV, CIV), that cooperate to transfer electrons derived from NADH and succinate to molecular oxygen, creating an electrochemical gradient over the inner membrane that drives transmembrane transport and the ATP synthase. Cytochrome c oxidase is the component of the respiratory chain that catalyzes the reduction of oxygen to water. Electrons originating from reduced cytochrome c in the intermembrane space (IMS) are transferred via the dinuclear copper A center (CU(A)) of subunit 2 and heme A of subunit 1 to the active site in subunit 1, a binuclear center (BNC) formed by heme A3 and copper B (CU(B)). The BNC reduces molecular oxygen to 2 water molecules using 4 electrons from cytochrome c in the IMS and 4 protons from the mitochondrial matrix. Click to Show/Hide
Gene ID	1327
Uniprot ID	COX41_HUMAN
HGNC ID	HGNC:2265
KEGG ID	hsa:1327

Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator

Non-coding RNA

m6A Regulator: Methyltransferase-like 3 (METTL3)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05095		Crosstalk Info
Epigenetic Regulator	PM2.5-associated exosomal transcript PAET
Regulated Target	Methyltransferase-like protein 3 (METTL3)
Crosstalk relationship	ncRNA → m6A
Disease	Asthma	Disease Info

m6A Regulator: YTH domain-containing family protein 3 (YTHDF3)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05096		Crosstalk Info
Epigenetic Regulator	PM2.5-associated exosomal transcript PAET
Regulated Target	Methyltransferase-like protein 3 (METTL3)
Crosstalk relationship	ncRNA → m6A
Disease	Asthma	Disease Info

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR01707)

Cytochrome c oxidase subunit 4 isoform 1, mitochondrial (COX4I1)

5-methylcytidine (m5C)

In total 3 m6A sequence/site(s) in this target gene
mod ID: M5CSITE000796		Click to Show/Hide the Full List
mod site	chr16:85803453-85803454:+
Sequence	CTGAGCTAATGGAGTTGAAGCATTGTTGCGGGCATTGTACC
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000561569.5; ENST00000570123.5; ENST00000562336.5; ENST00000566115.5; ENST00000253452.6; ENST00000566617.1; ENST00000563774.1; ENST00000568794.5; ENST00000564544.1; ENST00000569997.1; ENST00000567241.5; ENST00000564903.1; ENST00000567266.5; ENST00000564648.1; ENST00000565078.5; ENST00000568339.5; ENST00000566405.5
External Link	RMBase: m5C_site_16944
mod ID: M5CSITE000797		Click to Show/Hide the Full List
mod site	chr16:85805728-85805729:+		[2]
Sequence	AATGGCTGTCCTCTCTGCCCCCAGTGTATCGCATTAAGTTC
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000561569.5; ENST00000564544.1; ENST00000564903.1; ENST00000253452.6; ENST00000562336.5; ENST00000564648.1; ENST00000570123.5; ENST00000568339.5; ENST00000562929.1; ENST00000568794.5; ENST00000566405.5; ENST00000569997.1
External Link	RMBase: m5C_site_16945
mod ID: M5CSITE000798		Click to Show/Hide the Full List
mod site	chr16:85805729-85805730:+		[2]
Sequence	ATGGCTGTCCTCTCTGCCCCCAGTGTATCGCATTAAGTTCA
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000569997.1; ENST00000568339.5; ENST00000564544.1; ENST00000564903.1; ENST00000568794.5; ENST00000566405.5; ENST00000562336.5; ENST00000561569.5; ENST00000562929.1; ENST00000570123.5; ENST00000564648.1; ENST00000253452.6
External Link	RMBase: m5C_site_16946

N6-methyladenosine (m6A)

In total 26 m6A sequence/site(s) in this target gene
mod ID: M6ASITE028743		Click to Show/Hide the Full List
mod site	chr16:85798678-85798679:+		[3]
Sequence	GCTCTGCGAAGGTGCGAAGAACCAAATCCTAGCGATTAATG
Motif Score	2.930744048
Cell/Tissue List	HepG2; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000565078.5
External Link	RMBase: m6A_site_334961
mod ID: M6ASITE028744		Click to Show/Hide the Full List
mod site	chr16:85798713-85798714:+		[3]
Sequence	TTAATGTCCCAACAACGTGAACACTTCCTGCAACTCGAAAT
Motif Score	2.951386905
Cell/Tissue List	HepG2; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000565078.5
External Link	RMBase: m6A_site_334962
mod ID: M6ASITE028745		Click to Show/Hide the Full List
mod site	chr16:85798745-85798746:+		[3]
Sequence	ACTCGAAATCCTCAAGGGAAACTCTGTCGAATCCCCACCAA
Motif Score	2.627720238
Cell/Tissue List	HepG2; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000565078.5
External Link	RMBase: m6A_site_334963
mod ID: M6ASITE028746		Click to Show/Hide the Full List
mod site	chr16:85798809-85798810:+		[3]
Sequence	AAGGCTACTGATTTCAGGAAACTAACGTATAACTCGTCGCC
Motif Score	2.627720238
Cell/Tissue List	HepG2; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000565078.5
External Link	RMBase: m6A_site_334964
mod ID: M6ASITE028747		Click to Show/Hide the Full List
mod site	chr16:85798904-85798905:+		[3]
Sequence	GCTATTTATTCAGCGCCAAGACCCAAGCGCCATCGTGGATC
Motif Score	2.876744048
Cell/Tissue List	HepG2; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000565078.5
External Link	RMBase: m6A_site_334965
mod ID: M6ASITE028748		Click to Show/Hide the Full List
mod site	chr16:85799710-85799711:+		[4]
Sequence	TGCTCTCTTCCGGTCGCGGGACACCGGGTGTAGAGGGCGGT
Motif Score	3.643047619
Cell/Tissue List	HepG2; hESC-HEK293T; MT4
Seq Type List	m6A-seq; MAZTER-seq; MeRIP-seq
Transcript ID List	ENST00000253452.6; ENST00000568794.5; ENST00000567241.5; ENST00000561569.5; ENST00000570123.5; ENST00000562336.5; ENST00000567266.5; ENST00000566405.5; ENST00000566115.5; ENST00000564544.1; ENST00000568339.5; ENST00000563774.1; ENST00000565078.5
External Link	RMBase: m6A_site_334969
mod ID: M6ASITE028749		Click to Show/Hide the Full List
mod site	chr16:85799757-85799758:+		[3]
Sequence	GGGCAGTGGCGGCAGGTGAGACAGGAGGTGGCCGGTGCGGC
Motif Score	2.897386905
Cell/Tissue List	HepG2; MT4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000565078.5; ENST00000564544.1; ENST00000562336.5; ENST00000568794.5; ENST00000563774.1; ENST00000567266.5; ENST00000253452.6; ENST00000568339.5; ENST00000566405.5; ENST00000570123.5; ENST00000567241.5; ENST00000566115.5; ENST00000561569.5
External Link	RMBase: m6A_site_334970
mod ID: M6ASITE028750		Click to Show/Hide the Full List
mod site	chr16:85804990-85804991:+		[5]
Sequence	AGCTTATATGGATCGGCGTGACCACCCCTTGCCGGAGGTGG
Motif Score	2.839113095
Cell/Tissue List	AML
Seq Type List	miCLIP
Transcript ID List	ENST00000564903.1; ENST00000564544.1; ENST00000569997.1; ENST00000564648.1; ENST00000562336.5; ENST00000568339.5; ENST00000565078.5; ENST00000566405.5; ENST00000567266.5; ENST00000570123.5; ENST00000567241.5; ENST00000253452.6; ENST00000566115.5; ENST00000563774.1; ENST00000566617.1; ENST00000561569.5; ENST00000568794.5
External Link	RMBase: m6A_site_334971
mod ID: M6ASITE028751		Click to Show/Hide the Full List
mod site	chr16:85805119-85805120:+		[6]
Sequence	CGAGTGTGGGTATTGAAGGGACCCACAGGCGCGCCCAGCAG
Motif Score	3.622404762
Cell/Tissue List	HepG2; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000566405.5; ENST00000563774.1; ENST00000562336.5; ENST00000564903.1; ENST00000567266.5; ENST00000561569.5; ENST00000567241.5; ENST00000570123.5; ENST00000568794.5; ENST00000564648.1; ENST00000562929.1; ENST00000566617.1; ENST00000564544.1; ENST00000253452.6; ENST00000568339.5; ENST00000569997.1
External Link	RMBase: m6A_site_334972
mod ID: M6ASITE028752		Click to Show/Hide the Full List
mod site	chr16:85805771-85805772:+		[7]
Sequence	GGAGAGCTTTGCTGAGATGAACAGGGGCTCGAACGAGTGGA
Motif Score	2.951386905
Cell/Tissue List	MM6; Huh7; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000561569.5; ENST00000562336.5; ENST00000564903.1; ENST00000564544.1; ENST00000568339.5; ENST00000562929.1; ENST00000569997.1; ENST00000564648.1; ENST00000568794.5; ENST00000566405.5; ENST00000253452.6
External Link	RMBase: m6A_site_334973
mod ID: M6ASITE028753		Click to Show/Hide the Full List
mod site	chr16:85805898-85805899:+		[8]
Sequence	AGGAAGGCATGGGCGCCTGGACTGGGGCTCCAGCCTGCAGT
Motif Score	4.065041667
Cell/Tissue List	Huh7; endometrial
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000561569.5; ENST00000562336.5; ENST00000568339.5; ENST00000253452.6; ENST00000564903.1; ENST00000564648.1; ENST00000562929.1; ENST00000568794.5; ENST00000569997.1; ENST00000566405.5; ENST00000564544.1
External Link	RMBase: m6A_site_334974
mod ID: M6ASITE028754		Click to Show/Hide the Full List
mod site	chr16:85805941-85805942:+		[8]
Sequence	CCATTGGTGGGCTGTCGGGGACCTCCATACCTTGAGGCTAT
Motif Score	3.622404762
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000564903.1; ENST00000562929.1; ENST00000569997.1; ENST00000568794.5; ENST00000561569.5; ENST00000564544.1; ENST00000253452.6; ENST00000568339.5; ENST00000566405.5; ENST00000562336.5; ENST00000564648.1
External Link	RMBase: m6A_site_334975
mod ID: M6ASITE028755		Click to Show/Hide the Full List
mod site	chr16:85806241-85806242:+		[9]
Sequence	CTGTCTGGACTGTTGTGAGGACTGCATCTCAACAGCCAGCA
Motif Score	4.065041667
Cell/Tissue List	TREX
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000562929.1; ENST00000568794.5; ENST00000568339.5; ENST00000569997.1; ENST00000561569.5; ENST00000564648.1; ENST00000253452.6; ENST00000564903.1; ENST00000562336.5; ENST00000566405.5; ENST00000564544.1
External Link	RMBase: m6A_site_334976
mod ID: M6ASITE028756		Click to Show/Hide the Full List
mod site	chr16:85806358-85806359:+		[9]
Sequence	GTTCTTTCTGTCCAGGCAGAACAGGCATTTTTGCATTCTGA
Motif Score	2.951386905
Cell/Tissue List	TREX
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000562929.1; ENST00000569997.1; ENST00000561569.5; ENST00000566405.5; ENST00000568339.5; ENST00000564648.1; ENST00000564544.1; ENST00000564903.1; ENST00000568794.5; ENST00000562336.5; ENST00000253452.6
External Link	RMBase: m6A_site_334977
mod ID: M6ASITE028757		Click to Show/Hide the Full List
mod site	chr16:85806690-85806691:+		[10]
Sequence	TGTGAGGGATTGGCCTAGAAACAACCTGTTGAGATAGTCTT
Motif Score	2.20572619
Cell/Tissue List	HeLa; MM6; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000253452.6; ENST00000561569.5; ENST00000562929.1; ENST00000568794.5; ENST00000564544.1; ENST00000569997.1; ENST00000568339.5; ENST00000564903.1; ENST00000564648.1; ENST00000562336.5; ENST00000566405.5
External Link	RMBase: m6A_site_334978
mod ID: M6ASITE028758		Click to Show/Hide the Full List
mod site	chr16:85806764-85806765:+		[11]
Sequence	CCCCCTCCCGCAAAGCTTTGACAAAGAGTGGGTGGCCAAGC
Motif Score	2.859755952
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000568339.5; ENST00000568794.5; ENST00000253452.6; ENST00000562336.5; ENST00000562929.1; ENST00000564544.1; ENST00000561569.5; ENST00000564903.1; ENST00000569997.1; ENST00000566405.5; ENST00000564648.1
External Link	RMBase: m6A_site_334979
mod ID: M6ASITE028759		Click to Show/Hide the Full List
mod site	chr16:85806787-85806788:+		[10]
Sequence	AAGAGTGGGTGGCCAAGCAGACCAAGAGGATGCTGGACATG
Motif Score	2.876744048
Cell/Tissue List	HeLa; HepG2; H1299; MM6; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000564648.1; ENST00000569997.1; ENST00000253452.6; ENST00000562336.5; ENST00000561569.5; ENST00000568794.5; ENST00000566405.5; ENST00000564903.1; ENST00000564544.1; ENST00000568339.5; ENST00000562929.1
External Link	RMBase: m6A_site_334980
mod ID: M6ASITE028760		Click to Show/Hide the Full List
mod site	chr16:85806803-85806804:+		[10]
Sequence	GCAGACCAAGAGGATGCTGGACATGAAGGTGAACCCCATCC
Motif Score	3.643047619
Cell/Tissue List	HeLa; HepG2; hESC-HEK293T; H1299; MM6; endometrial
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000564648.1; ENST00000562929.1; ENST00000564544.1; ENST00000568794.5; ENST00000569997.1; ENST00000568339.5; ENST00000564903.1; ENST00000562336.5; ENST00000561569.5; ENST00000253452.6
External Link	RMBase: m6A_site_334981
mod ID: M6ASITE028761		Click to Show/Hide the Full List
mod site	chr16:85806815-85806816:+		[10]
Sequence	GATGCTGGACATGAAGGTGAACCCCATCCAGGGCTTAGCCT
Motif Score	2.930744048
Cell/Tissue List	HeLa; HepG2; H1299; MM6; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000564648.1; ENST00000562336.5; ENST00000564544.1; ENST00000564903.1; ENST00000561569.5; ENST00000253452.6; ENST00000568339.5; ENST00000569997.1; ENST00000562929.1
External Link	RMBase: m6A_site_334982
mod ID: M6ASITE028762		Click to Show/Hide the Full List
mod site	chr16:85806845-85806846:+		[10]
Sequence	GGGCTTAGCCTCCAAGTGGGACTACGAAAAGAACGAGTGGA
Motif Score	4.065041667
Cell/Tissue List	HeLa; HepG2; H1299; MM6; Huh7; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000562929.1; ENST00000564648.1; ENST00000568339.5; ENST00000562336.5; ENST00000561569.5; ENST00000253452.6; ENST00000564903.1; ENST00000569997.1; ENST00000564544.1
External Link	RMBase: m6A_site_334983
mod ID: M6ASITE028763		Click to Show/Hide the Full List
mod site	chr16:85806940-85806941:+		[11]
Sequence	ATGCAACTCCATGCCTATTTACTGGAAACCTGTTATGCCAA
Motif Score	2.494845238
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000562336.5; ENST00000569997.1; ENST00000568339.5; ENST00000564544.1; ENST00000564903.1; ENST00000564648.1; ENST00000561569.5; ENST00000562929.1; ENST00000253452.6
External Link	RMBase: m6A_site_334984
mod ID: M6ASITE028764		Click to Show/Hide the Full List
mod site	chr16:85806947-85806948:+		[10]
Sequence	TCCATGCCTATTTACTGGAAACCTGTTATGCCAAACAGTTG
Motif Score	2.185083333
Cell/Tissue List	HeLa; HepG2; H1299; MM6; Huh7; endometrial; AML
Seq Type List	m6A-seq; MeRIP-seq; miCLIP
Transcript ID List	ENST00000562336.5; ENST00000564648.1; ENST00000569997.1; ENST00000562929.1; ENST00000561569.5; ENST00000253452.6; ENST00000564544.1; ENST00000568339.5; ENST00000564903.1
External Link	RMBase: m6A_site_334985
mod ID: M6ASITE028765		Click to Show/Hide the Full List
mod site	chr16:85806961-85806962:+		[10]
Sequence	CTGGAAACCTGTTATGCCAAACAGTTGTACCACTGCTAATA
Motif Score	2.20572619
Cell/Tissue List	HeLa; HepG2; H1299; MM6; Huh7; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000253452.6; ENST00000564544.1; ENST00000564903.1; ENST00000564648.1; ENST00000568339.5; ENST00000569997.1; ENST00000562336.5; ENST00000561569.5; ENST00000562929.1
External Link	RMBase: m6A_site_334986
mod ID: M6ASITE028766		Click to Show/Hide the Full List
mod site	chr16:85806969-85806970:+		[11]
Sequence	CTGTTATGCCAAACAGTTGTACCACTGCTAATAAATGACCA
Motif Score	2.8355
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000564544.1; ENST00000562929.1; ENST00000562336.5; ENST00000561569.5; ENST00000569997.1; ENST00000568339.5; ENST00000253452.6
External Link	RMBase: m6A_site_334987
mod ID: M6ASITE028767		Click to Show/Hide the Full List
mod site	chr16:85806972-85806973:+		[11]
Sequence	TTATGCCAAACAGTTGTACCACTGCTAATAAATGACCAGTT
Motif Score	2.475107143
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000568339.5; ENST00000564544.1; ENST00000569997.1; ENST00000561569.5; ENST00000562336.5; ENST00000253452.6; ENST00000562929.1
External Link	RMBase: m6A_site_334988
mod ID: M6ASITE028768		Click to Show/Hide the Full List
mod site	chr16:85807001-85807002:+		[10]
Sequence	AAATGACCAGTTTACCTGAAACCCTTTGTGATCAGTTCTTT
Motif Score	2.185083333
Cell/Tissue List	HeLa; H1299; MM6; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000561569.5; ENST00000568339.5; ENST00000569997.1; ENST00000562336.5; ENST00000253452.6; ENST00000562929.1
External Link	RMBase: m6A_site_334989

Ref 1	TAS6417, A Novel EGFR Inhibitor Targeting Exon 20 Insertion Mutations. Mol Cancer Ther. 2018 Aug;17(8):1648-1658. doi: 10.1158/1535-7163.MCT-17-1206. Epub 2018 May 10.
Ref 2	5-methylcytosine promotes mRNA export - NSUN2 as the methyltransferase and ALYREF as an m(5)C reader. Cell Res. 2017 May;27(5):606-625. doi: 10.1038/cr.2017.55. Epub 2017 Apr 18.
Ref 3	Efficacy of MEK inhibition in patients with histiocytic neoplasms. Nature. 2019 Mar;567(7749):521-524. doi: 10.1038/s41586-019-1012-y. Epub 2019 Mar 13.
Ref 4	Histone H3 trimethylation at lysine 36 guides m(6)A RNA modification co-transcriptionally. Nature. 2019 Mar;567(7748):414-419. doi: 10.1038/s41586-019-1016-7. Epub 2019 Mar 13.
Ref 5	The N(6)-methyladenosine (m(6)A)-forming enzyme METTL3 controls myeloid differentiation of normal hematopoietic and leukemia cells. Nat Med. 2017 Nov;23(11):1369-1376. doi: 10.1038/nm.4416. Epub 2017 Sep 18.
Ref 6	Topology of the human and mouse m6A RNA methylomes revealed by m6A-seq. Nature. 2012 Apr 29;485(7397):201-6. doi: 10.1038/nature11112.
Ref 7	FTO Plays an Oncogenic Role in Acute Myeloid Leukemia as a N(6)-Methyladenosine RNA Demethylase. Cancer Cell. 2017 Jan 9;31(1):127-141. doi: 10.1016/j.ccell.2016.11.017. Epub 2016 Dec 22.
Ref 8	N6-Methyladenosine in Flaviviridae Viral RNA Genomes Regulates Infection. Cell Host Microbe. 2016 Nov 9;20(5):654-665. doi: 10.1016/j.chom.2016.09.015. Epub 2016 Oct 20.
Ref 9	Viral and cellular N(6)-methyladenosine and N(6),2'-O-dimethyladenosine epitranscriptomes in the KSHV life cycle. Nat Microbiol. 2018 Jan;3(1):108-120. doi: 10.1038/s41564-017-0056-8. Epub 2017 Nov 6.
Ref 10	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 11	DART-seq: an antibody-free method for global m(6)A detection. Nat Methods. 2019 Dec;16(12):1275-1280. doi: 10.1038/s41592-019-0570-0. Epub 2019 Sep 23.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map