m6A Target Gene Information
General Information of the m6A Target Gene (ID: M6ATAR01628)
Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator
Histone modification
m6A Regulator: Methyltransferase-like 14 (METTL14)
| In total 1 item(s) under this m6A regulator | ||
| Crosstalk ID: M6ACROT03152 | ||
| Regulated Target | Histone H3 lysine 27 acetylation (H3K27ac) | |
| Crosstalk relationship | Histone modification → m6A | |
| Disease | Nasopharyngeal carcinoma | |
m6A Regulator: Insulin-like growth factor 2 mRNA-binding protein 2 (IGF2BP2)
| In total 1 item(s) under this m6A regulator | ||
| Crosstalk ID: M6ACROT03153 | ||
| Regulated Target | Histone H3 lysine 27 acetylation (H3K27ac) | |
| Crosstalk relationship | Histone modification → m6A | |
| Disease | Nasopharyngeal carcinoma | |
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR01628)
| In total 4 m6A sequence/site(s) in this target gene | |||
| mod ID: M6ASITE001272 | Click to Show/Hide the Full List | ||
| mod site | chr10:88831990-88831991:- | [2] | |
| Sequence | GCCTATCAGAATGACTTTGGACAAGTGTGGCGGTGGGTGAA | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | peripheral-blood | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000371930.5 | ||
| External Link | RMBase: m6A_site_109435 | ||
| mod ID: M6ASITE001273 | Click to Show/Hide the Full List | ||
| mod site | chr10:88851612-88851613:- | [3] | |
| Sequence | GTGAAGTAAGCCTGTGAAGGACCAGCATGGGAATCCTATAC | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | CD4T; peripheral-blood | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000371930.5 | ||
| External Link | RMBase: m6A_site_109436 | ||
| mod ID: M6ASITE001274 | Click to Show/Hide the Full List | ||
| mod site | chr10:88851704-88851705:- | [3] | |
| Sequence | ACCAGCTTGGACTTCTAGGGACTTTCCTCTCAGCCAGGAAG | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | CD4T; peripheral-blood | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000371930.5 | ||
| External Link | RMBase: m6A_site_109437 | ||
| mod ID: M6ASITE001275 | Click to Show/Hide the Full List | ||
| mod site | chr10:88851714-88851715:- | [3] | |
| Sequence | GGAGCTTGCCACCAGCTTGGACTTCTAGGGACTTTCCTCTC | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | CD4T; peripheral-blood | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000371930.5 | ||
| External Link | RMBase: m6A_site_109438 | ||
References