General Information of the m6A Target Gene (ID: M6ATAR01369)
Target Name CX3C chemokine receptor 1 (CX3CR1)
Synonyms
C-X3-C CKR-1; CX3CR1; Beta chemokine receptor-like 1; CMK-BRL-1; CMK-BRL1; Fractalkine receptor; G-protein coupled receptor 13; V28
    Click to Show/Hide
Gene Name CX3CR1
Chromosomal Location 3p22.2
Family G-protein coupled receptor 1 family
Function
Receptor for the C-X3-C chemokine fractalkine (CX3CL1) present on many early leukocyte cells; CX3CR1-CX3CL1 signaling exerts distinct functions in different tissue compartments, such as immune response, inflammation, cell adhesion and chemotaxis (PubMed:9390561, PubMed:9782118, PubMed:12055230, PubMed:23125415). CX3CR1-CX3CL1 signaling mediates cell migratory functions (By similarity). Responsible for the recruitment of natural killer (NK) cells to inflamed tissues (By similarity). Acts as a regulator of inflammation process leading to atherogenesis by mediating macrophage and monocyte recruitment to inflamed atherosclerotic plaques, promoting cell survival (By similarity). Involved in airway inflammation by promoting interleukin 2-producing T helper (Th2) cell survival in inflamed lung (By similarity). Involved in the migration of circulating monocytes to non-inflamed tissues, where they differentiate into macrophages and dendritic cells (By similarity). Acts as a negative regulator of angiogenesis, probably by promoting macrophage chemotaxis (PubMed:14581400, PubMed:18971423). Plays a key role in brain microglia by regulating inflammatory response in the central nervous system (CNS) and regulating synapse maturation (By similarity). Required to restrain the microglial inflammatory response in the CNS and the resulting parenchymal damage in response to pathological stimuli (By similarity). Involved in brain development by participating in synaptic pruning, a natural process during which brain microglia eliminates extra synapses during postnatal development (By similarity). Synaptic pruning by microglia is required to promote the maturation of circuit connectivity during brain development (By similarity). Acts as an important regulator of the gut microbiota by controlling immunity to intestinal bacteria and fungi (By similarity). Expressed in lamina propria dendritic cells in the small intestine, which form transepithelial dendrites capable of taking up bacteria in order to provide defense against pathogenic bacteria (By similarity). Required to initiate innate and adaptive immune responses against dissemination of commensal fungi (mycobiota) component of the gut: expressed in mononuclear phagocytes (MNPs) and acts by promoting induction of antifungal IgG antibodies response to confer protection against disseminated C.albicans or C.auris infection (PubMed:29326275). Also acts as a receptor for C-C motif chemokine CCL26, inducing cell chemotaxis (PubMed:20974991).
    Click to Show/Hide
Gene ID 1524
Uniprot ID
CX3C1_HUMAN
HGNC ID
HGNC:2558
KEGG ID
hsa:1524
Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator
Histone modification
m6A Regulator: Methyltransferase-like 3 (METTL3)
In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03150
Epigenetic Regulator Histone-lysine N-methyltransferase EHMT2 (EHMT2)
Regulated Target Histone H3 lysine 9 dimethylation (H3K9me2)
Crosstalk relationship Histone modification → m6A
Disease Inflammatory response
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR01369)
CX3C chemokine receptor 1 (CX3CR1)
N6-methyladenosine (m6A)
In total 9 m6A sequence/site(s) in this target gene
mod ID: M6ASITE060179 Click to Show/Hide the Full List
mod site chr3:39265171-39265172:- [3]
Sequence ATGACAAAAATTCAACTCAGACTAGTTTAGTTAAATGAGGG
Motif Score 3.319380952
Cell/Tissue List peripheral-blood
Seq Type List m6A-seq
Transcript ID List ENST00000399220.2; ENST00000541347.5; ENST00000358309.3; ENST00000542107.5
External Link RMBase: m6A_site_584024
mod ID: M6ASITE060180 Click to Show/Hide the Full List
mod site chr3:39265207-39265208:- [4]
Sequence TTACTGCAAATGTCATCAGAACTTTTTGGTTTGCAGATGAC
Motif Score 3.373380952
Cell/Tissue List CD8T; peripheral-blood
Seq Type List m6A-CLIP/IP; m6A-seq
Transcript ID List ENST00000358309.3; ENST00000399220.2; ENST00000541347.5; ENST00000542107.5
External Link RMBase: m6A_site_584025
mod ID: M6ASITE060181 Click to Show/Hide the Full List
mod site chr3:39265236-39265237:- [3]
Sequence CTTTGAATGACAAAGAGTAGACATTTCTCTTACTGCAAATG
Motif Score 2.897386905
Cell/Tissue List peripheral-blood
Seq Type List m6A-seq
Transcript ID List ENST00000541347.5; ENST00000358309.3; ENST00000542107.5; ENST00000399220.2
External Link RMBase: m6A_site_584026
mod ID: M6ASITE060182 Click to Show/Hide the Full List
mod site chr3:39265259-39265260:- [3]
Sequence TTGAAGAATGAACAAATTGAACTCTTTGAATGACAAAGAGT
Motif Score 3.373380952
Cell/Tissue List peripheral-blood
Seq Type List m6A-seq
Transcript ID List ENST00000542107.5; ENST00000541347.5; ENST00000399220.2; ENST00000358309.3
External Link RMBase: m6A_site_584027
mod ID: M6ASITE060183 Click to Show/Hide the Full List
mod site chr3:39265268-39265269:- [5]
Sequence GCTCAAAATTTGAAGAATGAACAAATTGAACTCTTTGAATG
Motif Score 2.951386905
Cell/Tissue List brain; hESC-HEK293T; CD8T; peripheral-blood
Seq Type List m6A-REF-seq; MAZTER-seq; m6A-CLIP/IP; m6A-seq
Transcript ID List ENST00000542107.5; ENST00000541347.5; ENST00000358309.3; ENST00000399220.2
External Link RMBase: m6A_site_584028
mod ID: M6ASITE060184 Click to Show/Hide the Full List
mod site chr3:39265383-39265384:- [4]
Sequence AGTTCCTGAACCTGATGCTGACTAGTGAGGAAAGATTTTTG
Motif Score 3.28175
Cell/Tissue List CD8T
Seq Type List m6A-CLIP/IP
Transcript ID List ENST00000358309.3; ENST00000399220.2; ENST00000541347.5; ENST00000542107.5
External Link RMBase: m6A_site_584029
mod ID: M6ASITE060186 Click to Show/Hide the Full List
mod site chr3:39265712-39265713:- [5]
Sequence TGACTTCTTTCCCAGTTGTGACATGAGGAAGGATCTGAGGC
Motif Score 2.859755952
Cell/Tissue List brain
Seq Type List m6A-REF-seq
Transcript ID List ENST00000399220.2; ENST00000541347.5; ENST00000358309.3; ENST00000542107.5
External Link RMBase: m6A_site_584030
mod ID: M6ASITE060187 Click to Show/Hide the Full List
mod site chr3:39265766-39265767:- [4]
Sequence CCTCTTCTGGACACCCTACAACGTTATGATTTTCCTGGAGA
Motif Score 2.147845238
Cell/Tissue List CD8T
Seq Type List m6A-CLIP/IP
Transcript ID List ENST00000541347.5; ENST00000358309.3; ENST00000399220.2; ENST00000542107.5
External Link RMBase: m6A_site_584031
mod ID: M6ASITE060188 Click to Show/Hide the Full List
mod site chr3:39265841-39265842:- [4]
Sequence GACGCTGTTTTCCTGCAAGAACCACAAGAAAGCCAAAGCCA
Motif Score 2.930744048
Cell/Tissue List CD8T
Seq Type List m6A-CLIP/IP
Transcript ID List ENST00000542107.5; ENST00000541347.5; ENST00000399220.2; ENST00000358309.3
External Link RMBase: m6A_site_584032