m6A Target Gene Information
General Information of the m6A Target Gene (ID: M6ATAR01369)
Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator
Histone modification
m6A Regulator: Methyltransferase-like 3 (METTL3)
| In total 1 item(s) under this m6A regulator | ||
| Crosstalk ID: M6ACROT03150 | ||
| Epigenetic Regulator | Histone-lysine N-methyltransferase EHMT2 (EHMT2) | |
| Regulated Target | Histone H3 lysine 9 dimethylation (H3K9me2) | |
| Crosstalk relationship | Histone modification → m6A | |
| Disease | Inflammatory response | |
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR01369)
| In total 9 m6A sequence/site(s) in this target gene | |||
| mod ID: M6ASITE060179 | Click to Show/Hide the Full List | ||
| mod site | chr3:39265171-39265172:- | [3] | |
| Sequence | ATGACAAAAATTCAACTCAGACTAGTTTAGTTAAATGAGGG | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | peripheral-blood | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000399220.2; ENST00000541347.5; ENST00000358309.3; ENST00000542107.5 | ||
| External Link | RMBase: m6A_site_584024 | ||
| mod ID: M6ASITE060180 | Click to Show/Hide the Full List | ||
| mod site | chr3:39265207-39265208:- | [4] | |
| Sequence | TTACTGCAAATGTCATCAGAACTTTTTGGTTTGCAGATGAC | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | CD8T; peripheral-blood | ||
| Seq Type List | m6A-CLIP/IP; m6A-seq | ||
| Transcript ID List | ENST00000358309.3; ENST00000399220.2; ENST00000541347.5; ENST00000542107.5 | ||
| External Link | RMBase: m6A_site_584025 | ||
| mod ID: M6ASITE060181 | Click to Show/Hide the Full List | ||
| mod site | chr3:39265236-39265237:- | [3] | |
| Sequence | CTTTGAATGACAAAGAGTAGACATTTCTCTTACTGCAAATG | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | peripheral-blood | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000541347.5; ENST00000358309.3; ENST00000542107.5; ENST00000399220.2 | ||
| External Link | RMBase: m6A_site_584026 | ||
| mod ID: M6ASITE060182 | Click to Show/Hide the Full List | ||
| mod site | chr3:39265259-39265260:- | [3] | |
| Sequence | TTGAAGAATGAACAAATTGAACTCTTTGAATGACAAAGAGT | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | peripheral-blood | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000542107.5; ENST00000541347.5; ENST00000399220.2; ENST00000358309.3 | ||
| External Link | RMBase: m6A_site_584027 | ||
| mod ID: M6ASITE060183 | Click to Show/Hide the Full List | ||
| mod site | chr3:39265268-39265269:- | [5] | |
| Sequence | GCTCAAAATTTGAAGAATGAACAAATTGAACTCTTTGAATG | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | brain; hESC-HEK293T; CD8T; peripheral-blood | ||
| Seq Type List | m6A-REF-seq; MAZTER-seq; m6A-CLIP/IP; m6A-seq | ||
| Transcript ID List | ENST00000542107.5; ENST00000541347.5; ENST00000358309.3; ENST00000399220.2 | ||
| External Link | RMBase: m6A_site_584028 | ||
| mod ID: M6ASITE060184 | Click to Show/Hide the Full List | ||
| mod site | chr3:39265383-39265384:- | [4] | |
| Sequence | AGTTCCTGAACCTGATGCTGACTAGTGAGGAAAGATTTTTG | ||
| Motif Score | 3.28175 | ||
| Cell/Tissue List | CD8T | ||
| Seq Type List | m6A-CLIP/IP | ||
| Transcript ID List | ENST00000358309.3; ENST00000399220.2; ENST00000541347.5; ENST00000542107.5 | ||
| External Link | RMBase: m6A_site_584029 | ||
| mod ID: M6ASITE060186 | Click to Show/Hide the Full List | ||
| mod site | chr3:39265712-39265713:- | [5] | |
| Sequence | TGACTTCTTTCCCAGTTGTGACATGAGGAAGGATCTGAGGC | ||
| Motif Score | 2.859755952 | ||
| Cell/Tissue List | brain | ||
| Seq Type List | m6A-REF-seq | ||
| Transcript ID List | ENST00000399220.2; ENST00000541347.5; ENST00000358309.3; ENST00000542107.5 | ||
| External Link | RMBase: m6A_site_584030 | ||
| mod ID: M6ASITE060187 | Click to Show/Hide the Full List | ||
| mod site | chr3:39265766-39265767:- | [4] | |
| Sequence | CCTCTTCTGGACACCCTACAACGTTATGATTTTCCTGGAGA | ||
| Motif Score | 2.147845238 | ||
| Cell/Tissue List | CD8T | ||
| Seq Type List | m6A-CLIP/IP | ||
| Transcript ID List | ENST00000541347.5; ENST00000358309.3; ENST00000399220.2; ENST00000542107.5 | ||
| External Link | RMBase: m6A_site_584031 | ||
| mod ID: M6ASITE060188 | Click to Show/Hide the Full List | ||
| mod site | chr3:39265841-39265842:- | [4] | |
| Sequence | GACGCTGTTTTCCTGCAAGAACCACAAGAAAGCCAAAGCCA | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | CD8T | ||
| Seq Type List | m6A-CLIP/IP | ||
| Transcript ID List | ENST00000542107.5; ENST00000541347.5; ENST00000399220.2; ENST00000358309.3 | ||
| External Link | RMBase: m6A_site_584032 | ||
References