m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00919)
Target Name BRAF-activated non-protein coding RNA (BANCR)
Synonyms
LINC00586
    Click to Show/Hide
Gene Name BANCR
Chromosomal Location 9q21.11-q21.12
Gene ID 100885775
HGNC ID
HGNC:43877
Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator
DNA modification
m6A Regulator: Methyltransferase-like 3 (METTL3)
 Regulator Info 
In total 2 item(s) under this m6A regulator
Crosstalk ID: M6ACROT02120
 Crosstalk Info 
Epigenetic Regulator DNA (cytosine-5)-methyltransferase 1 (DNMT1)
Regulated Target Methyltransferase-like protein 3 (METTL3)
Crosstalk relationship DNA modification → m6A
Disease Pancreatic cancer
 Disease Info 
Crosstalk ID: M6ACROT02129
 Crosstalk Info 
Epigenetic Regulator Cysteine methyltransferase DNMT3A (DNMT3A)
Regulated Target Methyltransferase-like protein 3 (METTL3)
Crosstalk relationship DNA modification → m6A
Disease Pancreatic cancer
 Disease Info 
Non-coding RNA
m6A Regulator: Methyltransferase-like 3 (METTL3)
 Regulator Info 
In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05689
 Crosstalk Info 
Epigenetic Regulator BRAF-activated non-protein coding RNA (BANCR)
Crosstalk relationship m6A → ncRNA
Disease Pancreatic cancer
 Disease Info 
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00919)
BRAF-activated non-protein coding RNA (BANCR)
N6-methyladenosine (m6A)
In total 3 m6A sequence/site(s) in this target gene
mod ID: M6ASITE088112 Click to Show/Hide the Full List
mod site chr9:69306979-69306980:- [2]
Sequence TTCTTGTGTGAGATCCAAGAACCTTCTTGTAGGGTCTGGAT
Motif Score 2.930744048
Cell/Tissue List fibroblasts
Seq Type List m6A-seq
Transcript ID List ENST00000625062.4; ENST00000624238.2; rmsk_2768038
External Link RMBase: m6A_site_823513
mod ID: M6ASITE088113 Click to Show/Hide the Full List
mod site chr9:69307034-69307035:- [2]
Sequence TTCCCTTACTTTCTTAATAAACTCGCTTTCACTTTATGGAT
Motif Score 2.627720238
Cell/Tissue List fibroblasts
Seq Type List m6A-seq
Transcript ID List ENST00000624238.2; ENST00000625062.4; rmsk_2768038
External Link RMBase: m6A_site_823514
mod ID: M6ASITE088114 Click to Show/Hide the Full List
mod site chr9:69307097-69307098:- [2]
Sequence CCATAAGTATCAACAGTGGAACAGCCCATGCTGCTGCTCTG
Motif Score 2.951386905
Cell/Tissue List fibroblasts
Seq Type List m6A-seq
Transcript ID List rmsk_2768038; ENST00000624238.2; ENST00000625062.4
External Link RMBase: m6A_site_823515