General Information of the m6A Target Gene (ID: M6ATAR00800)
Target Name SUMO specific peptidase 1 (SENP1)
Synonyms
Sentrin-specific protease 1; EC:3.4.22.-; Sentrin/SUMO-specific protease SENP1
    Click to Show/Hide
Gene Name SENP1
Chromosomal Location 12q13.11
Family Peptidase C48 family
Function
Protease that catalyzes two essential functions in the SUMO pathway. The first is the hydrolysis of an alpha-linked peptide bond at the C-terminal end of the small ubiquitin-like modifier (SUMO) propeptides, SUMO1, SUMO2 and SUMO3 leading to the mature form of the proteins. The second is the deconjugation of SUMO1, SUMO2 and SUMO3 from targeted proteins, by cleaving an epsilon-linked peptide bond between the C-terminal glycine of the mature SUMO and the lysine epsilon-amino group of the target protein. Deconjugates SUMO1 from HIPK2. Deconjugates SUMO1 from HDAC1 and BHLHE40/DEC1, which decreases its transcriptional repression activity. Deconjugates SUMO1 from CLOCK, which decreases its transcriptional activation activity. Deconjugates SUMO2 from MTA1. Deconjugates SUMO1 from METTL3. Desumoylates CCAR2 which decreases its interaction with SIRT1. Deconjugates SUMO1 from GPS2.
    Click to Show/Hide
Gene ID 29843
Uniprot ID
SENP1_HUMAN
HGNC ID
HGNC:17927
KEGG ID
hsa:29843
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
SENP1 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
RNA demethylase ALKBH5 (ALKBH5) [ERASER]
Representative RNA-seq result indicating the expression of this target gene regulated by ALKBH5
Cell Line NOMO-1 cell line Homo sapiens
Treatment: shALKBH5 NOMO-1 cells
Control: shNS NOMO-1 cells
GSE144968
Regulation
logFC: -8.95E-01
p-value: 1.12E-02
More Results Click to View More RNA-seq Results
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary ROS promotes ALKBH5 SUMOylation through activating ERK/EPHB2/JNK signaling, leading to inhibition of ALKBH5 m6A demethylase activity by blocking substrate accessibility. Post-translational modification of ALKBH5 regulates ROS-induced DNA damage response. ROS specifically promotes ALKBH5 but not FTO, METTL3 and METTL14 SUMOylation by enhancing the interaction of ALKBH5 and UBC9 and inhibiting the association between ALKBH5 and SUMO specific peptidase 1 (SENP1).
Target Regulation Down regulation
Responsed Disease Diseases of the circulatory system ICD-11: BE2Z
Pathway Response Apoptosis hsa04210
Chemical carcinogenesis - reactive oxygen species hsa05208
Cell Process Oxygen species(ROS)-induced stress
In-vitro Model HEK293T Normal Homo sapiens CVCL_0063
In-vivo Model For the ROS-induced DNA damage analysis, the indicated cell lines were treated with or without 100 uM hydrogen peroxide (H2O2), or 80 uM Carbonyl cyanide m-chlorophenylhydrazone (CCCP) for 6 hours. For the in vivo ROS study, DMSO and 5 mg/kg CCCP was intraperitoneally injected in to three pairs of mice.
Diseases of the circulatory system [ICD-11: BE2Z]
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [1]
Response Summary ROS promotes ALKBH5 SUMOylation through activating ERK/EPHB2/JNK signaling, leading to inhibition of ALKBH5 m6A demethylase activity by blocking substrate accessibility. Post-translational modification of ALKBH5 regulates ROS-induced DNA damage response. ROS specifically promotes ALKBH5 but not FTO, METTL3 and METTL14 SUMOylation by enhancing the interaction of ALKBH5 and UBC9 and inhibiting the association between ALKBH5 and SUMO specific peptidase 1 (SENP1).
Responsed Disease Diseases of the circulatory system [ICD-11: BE2Z]
Target Regulator RNA demethylase ALKBH5 (ALKBH5) ERASER
Target Regulation Down regulation
Pathway Response Apoptosis hsa04210
Chemical carcinogenesis - reactive oxygen species hsa05208
Cell Process Oxygen species(ROS)-induced stress
In-vitro Model HEK293T Normal Homo sapiens CVCL_0063
In-vivo Model For the ROS-induced DNA damage analysis, the indicated cell lines were treated with or without 100 uM hydrogen peroxide (H2O2), or 80 uM Carbonyl cyanide m-chlorophenylhydrazone (CCCP) for 6 hours. For the in vivo ROS study, DMSO and 5 mg/kg CCCP was intraperitoneally injected in to three pairs of mice.
Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator
Histone modification
m6A Regulator: Insulin-like growth factor 2 mRNA-binding protein 3 (IGF2BP3)
In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03115
Epigenetic Regulator Histone deacetylase 2 (HDAC2)
Regulated Target Epidermal growth factor receptor (EGFR)
Crosstalk relationship m6A → Histone modification
Disease Acute myeloid leukaemia
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00800)
SUMO specific peptidase 1 (SENP1)
N4-acetylcytidine (ac4C)
In total 1 m6A sequence/site(s) in this target gene
mod ID: AC4SITE000171 Click to Show/Hide the Full List
mod site chr12:48074368-48074369:-
Sequence CCCATCATCACCACTCTGTTCCACATCAGCCAGATAACTTA
Cell/Tissue List DLD1
Seq Type List acRIP-seq
Transcript ID List ENST00000549518.6; ENST00000552189.5; ENST00000448372.5; ENST00000549595.5
External Link RMBase: ac4C_site_404
Adenosine-to-Inosine editing (A-to-I)
In total 2 m6A sequence/site(s) in this target gene
mod ID: A2ISITE005518 Click to Show/Hide the Full List
mod site chr12:48054530-48054531:- [3]
Sequence TCCCAAAGTGCTGGGATTACAGATGTGAGCCACTGCGCCTG
Transcript ID List ENST00000549518.6; ENST00000448372.5; ENST00000549595.5; ENST00000552189.5
External Link RMBase: RNA-editing_site_28023
mod ID: A2ISITE005519 Click to Show/Hide the Full List
mod site chr12:48085638-48085639:- [3]
Sequence ACAGGGAAGAGGTAGTGGAGAGAGATGGTCAGGCTTCCTGT
Transcript ID List ENST00000552189.5; ENST00000551592.5; ENST00000448372.5; ENST00000551798.1; ENST00000549595.5; ENST00000549518.6; ENST00000547886.5
External Link RMBase: RNA-editing_site_28024
N6-methyladenosine (m6A)
In total 71 m6A sequence/site(s) in this target gene
mod ID: M6ASITE011629 Click to Show/Hide the Full List
mod site chr12:48043420-48043421:- [4]
Sequence GCAATATGGTGTCGATTTGGACTATGAATCAAAAGACCTTT
Motif Score 4.065041667
Cell/Tissue List A549
Seq Type List m6A-seq
Transcript ID List ENST00000549518.6; rmsk_3781433; ENST00000552189.5; ENST00000448372.5
External Link RMBase: m6A_site_185264
mod ID: M6ASITE011630 Click to Show/Hide the Full List
mod site chr12:48043746-48043747:- [5]
Sequence TCCATTGTTAACTGAATGTTACTGTTTCCACTCCAGCAACT
Motif Score 2.494845238
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000549518.6; ENST00000552189.5; ENST00000448372.5
External Link RMBase: m6A_site_185265
mod ID: M6ASITE011631 Click to Show/Hide the Full List
mod site chr12:48043904-48043905:- [5]
Sequence CTTTTCTCCTCTCCCGTTGTACCGCATTCTTTCCAGCATTG
Motif Score 2.8355
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000448372.5; ENST00000549518.6; ENST00000552189.5
External Link RMBase: m6A_site_185266
mod ID: M6ASITE011632 Click to Show/Hide the Full List
mod site chr12:48044089-48044090:- [6]
Sequence GATCAACTTGAGATTTAAAAACTGCTATTCCTTTTGTTCTT
Motif Score 2.627720238
Cell/Tissue List HeLa; hNPCs
Seq Type List m6A-seq
Transcript ID List ENST00000552189.5; ENST00000549518.6; ENST00000448372.5
External Link RMBase: m6A_site_185267
mod ID: M6ASITE011633 Click to Show/Hide the Full List
mod site chr12:48044112-48044113:- [6]
Sequence AAAAAACGGGTGGAGTTTGGACTGATCAACTTGAGATTTAA
Motif Score 4.065041667
Cell/Tissue List HeLa; hNPCs; AML
Seq Type List m6A-seq; miCLIP
Transcript ID List ENST00000549518.6; ENST00000448372.5; ENST00000552189.5
External Link RMBase: m6A_site_185268
mod ID: M6ASITE011634 Click to Show/Hide the Full List
mod site chr12:48044301-48044302:- [5]
Sequence TTTAAAGACTGAATGTGTTCACCATTTAGCCTGTAGATTTA
Motif Score 2.026654762
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000549518.6; ENST00000552189.5; ENST00000448372.5
External Link RMBase: m6A_site_185269
mod ID: M6ASITE011635 Click to Show/Hide the Full List
mod site chr12:48044500-48044501:- [5]
Sequence TCTGACCAAGAAGAAAAAGGACCTTAGTATTTAGCATAAAA
Motif Score 3.622404762
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000552189.5; ENST00000549518.6; ENST00000448372.5
External Link RMBase: m6A_site_185270
mod ID: M6ASITE011636 Click to Show/Hide the Full List
mod site chr12:48044549-48044550:- [5]
Sequence GGAGCGGTTTCAGTGGCGCAACAAAGCACCACTTTTACTGT
Motif Score 2.173910714
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000448372.5; ENST00000549518.6; ENST00000552189.5
External Link RMBase: m6A_site_185271
mod ID: M6ASITE011637 Click to Show/Hide the Full List
mod site chr12:48044579-48044580:- [6]
Sequence CAACACATGATACGGGGAAGACCCACCCAGGGAGCGGTTTC
Motif Score 2.876744048
Cell/Tissue List HeLa; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000552189.5; ENST00000549518.6; ENST00000448372.5
External Link RMBase: m6A_site_185272
mod ID: M6ASITE011638 Click to Show/Hide the Full List
mod site chr12:48044601-48044602:- [5]
Sequence AGCAGGGGTTTGCATGTGCTACCAACACATGATACGGGGAA
Motif Score 2.05802381
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000448372.5; ENST00000552189.5; ENST00000549518.6
External Link RMBase: m6A_site_185273
mod ID: M6ASITE011639 Click to Show/Hide the Full List
mod site chr12:48044657-48044658:- [6]
Sequence GCACAGCACATGAGCCCTGGACAGGTCCCAAAGTTCCAAGC
Motif Score 3.643047619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000552189.5; ENST00000448372.5; ENST00000549518.6
External Link RMBase: m6A_site_185274
mod ID: M6ASITE011640 Click to Show/Hide the Full List
mod site chr12:48044764-48044765:- [6]
Sequence CATAAGTCCCTTCCTCCAGGACCTTTCCTATTTATATGTCC
Motif Score 3.622404762
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000552189.5; ENST00000549518.6; ENST00000448372.5
External Link RMBase: m6A_site_185275
mod ID: M6ASITE011641 Click to Show/Hide the Full List
mod site chr12:48044799-48044800:- [6]
Sequence GGAATGTGACTGTAAACTGGACTTTGGGGCCCAGGCATAAG
Motif Score 4.065041667
Cell/Tissue List HeLa; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000448372.5; ENST00000549518.6; ENST00000552189.5
External Link RMBase: m6A_site_185276
mod ID: M6ASITE011642 Click to Show/Hide the Full List
mod site chr12:48044804-48044805:- [6]
Sequence GGTCAGGAATGTGACTGTAAACTGGACTTTGGGGCCCAGGC
Motif Score 2.627720238
Cell/Tissue List HeLa; HEK293T; Huh7
Seq Type List m6A-seq; DART-seq; MeRIP-seq
Transcript ID List ENST00000552189.5; ENST00000448372.5; ENST00000549518.6
External Link RMBase: m6A_site_185277
mod ID: M6ASITE011643 Click to Show/Hide the Full List
mod site chr12:48044856-48044857:- [6]
Sequence ACACACACCCACACACACAAACACACACACACACACAATTT
Motif Score 2.20572619
Cell/Tissue List HeLa; HEK293T; MT4; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000552189.5; ENST00000549518.6; ENST00000448372.5
External Link RMBase: m6A_site_185278
mod ID: M6ASITE011644 Click to Show/Hide the Full List
mod site chr12:48044882-48044883:- [6]
Sequence AACCACCAGCATATACATGGACATACACACACACCCACACA
Motif Score 3.643047619
Cell/Tissue List HeLa; HEK293T; MT4; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000448372.5; ENST00000549518.6; ENST00000552189.5
External Link RMBase: m6A_site_185279
mod ID: M6ASITE011645 Click to Show/Hide the Full List
mod site chr12:48044901-48044902:- [6]
Sequence GGCAAAAGGTAGGGATAAAAACCACCAGCATATACATGGAC
Motif Score 2.185083333
Cell/Tissue List HeLa; HEK293T; MT4; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000549518.6; ENST00000552189.5; ENST00000448372.5
External Link RMBase: m6A_site_185280
mod ID: M6ASITE011646 Click to Show/Hide the Full List
mod site chr12:48044944-48044945:- [5]
Sequence AATTCTTGTTGTTAGGCCTTACTAAGAAGTAGGAAAGGGCA
Motif Score 2.494845238
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000448372.5; ENST00000549518.6; ENST00000552189.5
External Link RMBase: m6A_site_185281
mod ID: M6ASITE011647 Click to Show/Hide the Full List
mod site chr12:48045001-48045002:- [6]
Sequence ACTCAGTCCCTAATTATGGGACTGAGAAAAGCTTGGAAAGA
Motif Score 4.065041667
Cell/Tissue List HeLa; CD34; HEK293T; U2OS; H1A; H1B; hESCs; fibroblasts; A549; GM12878; Huh7; iSLK; TIME; MSC
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000448372.5; ENST00000549518.6; ENST00000552189.5
External Link RMBase: m6A_site_185282
mod ID: M6ASITE011648 Click to Show/Hide the Full List
mod site chr12:48045075-48045076:- [6]
Sequence TCCCTAAGCTGAAGAGAGAGACTGCTTTTCACTTCTTCAGT
Motif Score 3.319380952
Cell/Tissue List HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hESCs; fibroblasts; GM12878; LCLs; H1299; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; NB4; MM6
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000448372.5; ENST00000552189.5; ENST00000549518.6
External Link RMBase: m6A_site_185283
mod ID: M6ASITE011649 Click to Show/Hide the Full List
mod site chr12:48045098-48045099:- [6]
Sequence TGCTGTGAAAGGGGTGAGGGACATCCCTAAGCTGAAGAGAG
Motif Score 3.643047619
Cell/Tissue List HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hESCs; fibroblasts; GM12878; LCLs; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; NB4; MM6
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000549518.6; ENST00000448372.5; ENST00000552189.5
External Link RMBase: m6A_site_185284
mod ID: M6ASITE011650 Click to Show/Hide the Full List
mod site chr12:48045125-48045126:- [6]
Sequence GATACTATTTTTGCAAAGAAACTTTGGTGCTGTGAAAGGGG
Motif Score 2.627720238
Cell/Tissue List HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hESCs; fibroblasts; GM12878; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; NB4; MM6
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000549518.6; ENST00000448372.5; ENST00000552189.5
External Link RMBase: m6A_site_185285
mod ID: M6ASITE011651 Click to Show/Hide the Full List
mod site chr12:48045177-48045178:- [5]
Sequence GGCCCTGGCGAGATGCATTCACAAGCACATCTGCCTTTCCT
Motif Score 2.047297619
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000552189.5; ENST00000549518.6; ENST00000448372.5
External Link RMBase: m6A_site_185286
mod ID: M6ASITE011652 Click to Show/Hide the Full List
mod site chr12:48045201-48045202:- [6]
Sequence TGTAACACCCTTGATCCTGGACCAGGCCCTGGCGAGATGCA
Motif Score 3.622404762
Cell/Tissue List HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hESCs; fibroblasts; GM12878; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000549518.6; ENST00000552189.5; ENST00000448372.5
External Link RMBase: m6A_site_185287
mod ID: M6ASITE011653 Click to Show/Hide the Full List
mod site chr12:48045246-48045247:- [6]
Sequence TACAGCCAGAGACCTTGGAAACAGCTGCTCCCAGCCCTCTG
Motif Score 2.20572619
Cell/Tissue List HeLa; HepG2; HEK293T; A549; U2OS; fibroblasts; GM12878; Huh7; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; MM6
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000552189.5; ENST00000549518.6; ENST00000448372.5
External Link RMBase: m6A_site_185288
mod ID: M6ASITE011654 Click to Show/Hide the Full List
mod site chr12:48045255-48045256:- [6]
Sequence TTTGTTGTCTACAGCCAGAGACCTTGGAAACAGCTGCTCCC
Motif Score 2.876744048
Cell/Tissue List HeLa; HepG2; HEK293T; A549; U2OS; fibroblasts; GM12878; Huh7; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; MM6
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000552189.5; ENST00000549518.6; ENST00000448372.5
External Link RMBase: m6A_site_185289
mod ID: M6ASITE011655 Click to Show/Hide the Full List
mod site chr12:48045283-48045284:- [6]
Sequence AGACCTTGACCATGTGGGGGACCAGCTCTTTGTTGTCTACA
Motif Score 3.622404762
Cell/Tissue List HeLa; HepG2; HEK293T; A549; U2OS; fibroblasts; GM12878; Huh7; peripheral-blood; HEK293A-TOA; iSLK
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000448372.5; ENST00000552189.5; ENST00000549518.6
External Link RMBase: m6A_site_185290
mod ID: M6ASITE011656 Click to Show/Hide the Full List
mod site chr12:48045301-48045302:- [6]
Sequence AAGACTGTCTCACTTAGCAGACCTTGACCATGTGGGGGACC
Motif Score 2.876744048
Cell/Tissue List HeLa; HEK293T; HepG2; U2OS; fibroblasts; A549; GM12878; Huh7; HEK293A-TOA; TREX
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000448372.5; ENST00000552189.5; ENST00000549518.6
External Link RMBase: m6A_site_185291
mod ID: M6ASITE011657 Click to Show/Hide the Full List
mod site chr12:48045318-48045319:- [6]
Sequence CACCGAAAACTCTTGTGAAGACTGTCTCACTTAGCAGACCT
Motif Score 3.319380952
Cell/Tissue List HeLa; HEK293T; HepG2; U2OS; fibroblasts; A549; GM12878; Huh7; HEK293A-TOA; TREX
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000448372.5; ENST00000552189.5; ENST00000549518.6
External Link RMBase: m6A_site_185292
mod ID: M6ASITE011658 Click to Show/Hide the Full List
mod site chr12:48045330-48045331:- [6]
Sequence TGGGAGATCCTCCACCGAAAACTCTTGTGAAGACTGTCTCA
Motif Score 2.627720238
Cell/Tissue List HeLa; HEK293T; HepG2; U2OS; fibroblasts; A549; HEK293A-TOA
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000549518.6; ENST00000549595.5; ENST00000552189.5; ENST00000448372.5
External Link RMBase: m6A_site_185293
mod ID: M6ASITE011659 Click to Show/Hide the Full List
mod site chr12:48046377-48046378:- [4]
Sequence TGCTGACTGTATTACCAAAGACAGACCAATCAACTTCACAC
Motif Score 2.897386905
Cell/Tissue List HEK293T; A549
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000549518.6; ENST00000549595.5; ENST00000552189.5; ENST00000448372.5
External Link RMBase: m6A_site_185294
mod ID: M6ASITE011660 Click to Show/Hide the Full List
mod site chr12:48048052-48048053:- [5]
Sequence ACTTTAGAAAGAAGAATATTACCTATTACGACTCCATGGGT
Motif Score 2.052208333
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000448372.5; ENST00000552189.5; ENST00000549518.6; ENST00000549595.5
External Link RMBase: m6A_site_185295
mod ID: M6ASITE011661 Click to Show/Hide the Full List
mod site chr12:48048974-48048975:- [5]
Sequence AGTAGATGTATTTTCTGTTGACATTCTTTTGGTGCCCATTC
Motif Score 2.859755952
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000552189.5; ENST00000549518.6; ENST00000448372.5; ENST00000549595.5
External Link RMBase: m6A_site_185296
mod ID: M6ASITE011662 Click to Show/Hide the Full List
mod site chr12:48054906-48054907:- [7]
Sequence TAAAAATGTATATATTTTAAACATATATATGTTTATATGTA
Motif Score 2.20572619
Cell/Tissue List GM12878; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000549595.5; ENST00000468202.1; ENST00000448372.5; ENST00000549518.6; ENST00000552189.5
External Link RMBase: m6A_site_185297
mod ID: M6ASITE011663 Click to Show/Hide the Full List
mod site chr12:48055017-48055018:- [6]
Sequence GGCATGGATTCTTTGCAGGAACAACACCTACACCCAAGAGG
Motif Score 2.951386905
Cell/Tissue List HeLa; HEK293T; A549; HepG2; GM12878; Huh7; HEK293A-TOA; iSLK; TIME; TREX
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000552189.5; ENST00000549595.5; ENST00000463559.1; ENST00000448372.5; ENST00000468202.1; ENST00000549518.6
External Link RMBase: m6A_site_185298
mod ID: M6ASITE011664 Click to Show/Hide the Full List
mod site chr12:48055058-48055059:- [6]
Sequence TGGTTGAATGAAGCACCTAAACATTGTATACTGCAGATTTA
Motif Score 2.20572619
Cell/Tissue List HeLa; HEK293T; A549; HepG2; GM12878; Huh7; HEK293A-TOA; iSLK; TIME; TREX
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000549595.5; ENST00000463559.1; ENST00000549518.6; ENST00000552189.5; ENST00000468202.1; ENST00000448372.5
External Link RMBase: m6A_site_185299
mod ID: M6ASITE011665 Click to Show/Hide the Full List
mod site chr12:48055111-48055112:- [6]
Sequence GCAAGAGAAAGTGTAACTGGACTGCCACGGCTAAAAGAAAA
Motif Score 4.065041667
Cell/Tissue List HeLa; HEK293T; HepG2; GM12878; Huh7; HEK293A-TOA; iSLK; TIME; TREX
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000549595.5; ENST00000552189.5; ENST00000549518.6; ENST00000463559.1; ENST00000448372.5; ENST00000468202.1
External Link RMBase: m6A_site_185300
mod ID: M6ASITE011666 Click to Show/Hide the Full List
mod site chr12:48055116-48055117:- [8]
Sequence CAAGCGCAAGAGAAAGTGTAACTGGACTGCCACGGCTAAAA
Motif Score 2.590089286
Cell/Tissue List CD8T
Seq Type List m6A-CLIP/IP
Transcript ID List ENST00000549518.6; ENST00000448372.5; ENST00000463559.1; ENST00000468202.1; ENST00000552189.5; ENST00000549595.5
External Link RMBase: m6A_site_185301
mod ID: M6ASITE011667 Click to Show/Hide the Full List
mod site chr12:48055246-48055247:- [6]
Sequence AAGATAATAAGATGAAGGGAACATCGCCGTTTGGAAAGTGT
Motif Score 2.951386905
Cell/Tissue List HeLa; HEK293T; HepG2; Huh7; HEK293A-TOA
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000549595.5; ENST00000552189.5; ENST00000448372.5; ENST00000468202.1; ENST00000549518.6; ENST00000463559.1
External Link RMBase: m6A_site_185302
mod ID: M6ASITE011668 Click to Show/Hide the Full List
mod site chr12:48055442-48055443:- [6]
Sequence TGCTGACTGATGCCTGGGGGACCAAGCCCATAATTGTGGAG
Motif Score 3.622404762
Cell/Tissue List HeLa; HEK293T; HepG2; GM12878; HEK293A-TOA
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000468202.1; ENST00000549518.6; ENST00000549595.5; ENST00000448372.5; ENST00000552189.5
External Link RMBase: m6A_site_185303
mod ID: M6ASITE011669 Click to Show/Hide the Full List
mod site chr12:48055580-48055581:- [6]
Sequence TACTAAACAGTATAGGGTAAACATCCAATTAAAAGGCAGAT
Motif Score 2.20572619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000552189.5; ENST00000468202.1; ENST00000549595.5; ENST00000448372.5; ENST00000549518.6
External Link RMBase: m6A_site_185304
mod ID: M6ASITE011670 Click to Show/Hide the Full List
mod site chr12:48058621-48058622:- [8]
Sequence ATCACAGCACAAAGAAGGAGACAAAATGGACAAATATACTG
Motif Score 2.897386905
Cell/Tissue List CD8T
Seq Type List m6A-CLIP/IP
Transcript ID List rmsk_3781455; ENST00000549595.5; ENST00000549518.6; ENST00000448372.5; ENST00000552189.5
External Link RMBase: m6A_site_185305
mod ID: M6ASITE011671 Click to Show/Hide the Full List
mod site chr12:48058700-48058701:- [8]
Sequence ATACCTCTAGAAGACAGGTGACTAAGGCAGAACTAAAACAA
Motif Score 3.28175
Cell/Tissue List CD8T
Seq Type List m6A-CLIP/IP
Transcript ID List rmsk_3781455; ENST00000552189.5; ENST00000448372.5; ENST00000549595.5; ENST00000549518.6
External Link RMBase: m6A_site_185306
mod ID: M6ASITE011672 Click to Show/Hide the Full List
mod site chr12:48058707-48058708:- [8]
Sequence TTTTTTCATACCTCTAGAAGACAGGTGACTAAGGCAGAACT
Motif Score 2.897386905
Cell/Tissue List CD8T
Seq Type List m6A-CLIP/IP
Transcript ID List rmsk_3781455; ENST00000552189.5; ENST00000549595.5; ENST00000448372.5; ENST00000549518.6
External Link RMBase: m6A_site_185307
mod ID: M6ASITE011673 Click to Show/Hide the Full List
mod site chr12:48063673-48063674:- [6]
Sequence TTTTTACATACAAATAGTAAACATTAAGTGGCAGTTAAATT
Motif Score 2.20572619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000549518.6; ENST00000549595.5; ENST00000551358.1; ENST00000448372.5; ENST00000552189.5
External Link RMBase: m6A_site_185308
mod ID: M6ASITE011674 Click to Show/Hide the Full List
mod site chr12:48065069-48065070:- [9]
Sequence AAGATGAATTTCCTGAAATTACAGAGGTAAGTTACATACAC
Motif Score 2.07285119
Cell/Tissue List HEK293
Seq Type List m6A-REF-seq
Transcript ID List ENST00000551358.1; ENST00000552189.5; ENST00000549595.5; ENST00000448372.5; ENST00000549518.6
External Link RMBase: m6A_site_185309
mod ID: M6ASITE011675 Click to Show/Hide the Full List
mod site chr12:48071679-48071680:- [6]
Sequence TGAAAGTGAAAGATTCCCAGACTCCAACTCCCAGGTAAACT
Motif Score 3.319380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000552189.5; ENST00000549518.6; ENST00000448372.5; ENST00000549595.5
External Link RMBase: m6A_site_185310
mod ID: M6ASITE011676 Click to Show/Hide the Full List
mod site chr12:48071714-48071715:- [6]
Sequence TTGTGTTTCTTTAGGATCAGACTCTGTGATTTTACTGAAAG
Motif Score 3.319380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000448372.5; ENST00000549595.5; ENST00000549518.6; ENST00000552189.5
External Link RMBase: m6A_site_185311
mod ID: M6ASITE011677 Click to Show/Hide the Full List
mod site chr12:48074474-48074475:- [6]
Sequence AGCATTTTAACTAACCAGGAACAGCTGTCCCACAGTGTATA
Motif Score 2.951386905
Cell/Tissue List HeLa; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000549595.5; ENST00000549518.6; ENST00000552189.5; ENST00000448372.5
External Link RMBase: m6A_site_185312
mod ID: M6ASITE011678 Click to Show/Hide the Full List
mod site chr12:48074547-48074548:- [6]
Sequence CTCACTGTTTAAAAATGGAAACTCTTGTGCATCTCAGATCA
Motif Score 2.627720238
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000552189.5; ENST00000549595.5; ENST00000448372.5; ENST00000549518.6
External Link RMBase: m6A_site_185313
mod ID: M6ASITE011679 Click to Show/Hide the Full List
mod site chr12:48074568-48074569:- [6]
Sequence CAGTAAAAATACTTTGAAAGACTCACTGTTTAAAAATGGAA
Motif Score 3.319380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000448372.5; ENST00000549595.5; ENST00000552189.5; ENST00000549518.6
External Link RMBase: m6A_site_185314
mod ID: M6ASITE011680 Click to Show/Hide the Full List
mod site chr12:48074715-48074716:- [6]
Sequence AAACAGTTTACTATAGCCAAACCCACCACACATTTTCCTTT
Motif Score 2.185083333
Cell/Tissue List HeLa; fibroblasts
Seq Type List m6A-seq
Transcript ID List ENST00000549595.5; ENST00000552189.5; ENST00000448372.5; ENST00000549518.6
External Link RMBase: m6A_site_185315
mod ID: M6ASITE011681 Click to Show/Hide the Full List
mod site chr12:48074733-48074734:- [6]
Sequence CTACAGATGGTCACAGGGAAACAGTTTACTATAGCCAAACC
Motif Score 2.20572619
Cell/Tissue List HeLa; fibroblasts
Seq Type List m6A-seq
Transcript ID List ENST00000549595.5; ENST00000549518.6; ENST00000552189.5; ENST00000448372.5
External Link RMBase: m6A_site_185316
mod ID: M6ASITE011682 Click to Show/Hide the Full List
mod site chr12:48074760-48074761:- [6]
Sequence GAAGAAAGAGAGATTTACAGACAGCTGCTACAGATGGTCAC
Motif Score 2.897386905
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000552189.5; ENST00000549518.6; ENST00000448372.5; ENST00000549595.5
External Link RMBase: m6A_site_185317
mod ID: M6ASITE011683 Click to Show/Hide the Full List
mod site chr12:48083683-48083684:- [6]
Sequence GAAAAATCTTTTCCTATTAAACCTGTTCCAAGTCCATCTTG
Motif Score 2.185083333
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000448372.5; ENST00000547886.5; ENST00000549518.6; ENST00000551592.5; ENST00000552189.5; ENST00000549595.5
External Link RMBase: m6A_site_185318
mod ID: M6ASITE011684 Click to Show/Hide the Full List
mod site chr12:48083729-48083730:- [6]
Sequence CAGTTTTGCGGGAAAGTCAAACCATCACTGCCATGTATCTG
Motif Score 2.185083333
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000551798.1; ENST00000552189.5; ENST00000549595.5; ENST00000551592.5; ENST00000549518.6; ENST00000547886.5; ENST00000448372.5
External Link RMBase: m6A_site_185319
mod ID: M6ASITE011685 Click to Show/Hide the Full List
mod site chr12:48083750-48083751:- [6]
Sequence TTTTTTTAGTGGATTATCAAACAGTTTTGCGGGAAAGTCAA
Motif Score 2.20572619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000549595.5; ENST00000551592.5; ENST00000551798.1; ENST00000552189.5; ENST00000547886.5; ENST00000549518.6; ENST00000448372.5
External Link RMBase: m6A_site_185320
mod ID: M6ASITE011686 Click to Show/Hide the Full List
mod site chr12:48096398-48096399:- [6]
Sequence TTCCAGGCAAGGACATTTGGACCGATCTTTTACATGTTCCA
Motif Score 3.622404762
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000549518.6; ENST00000551798.1; ENST00000547886.5; ENST00000448372.5; ENST00000552189.5; ENST00000549595.5; ENST00000547181.5; ENST00000551592.5
External Link RMBase: m6A_site_185322
mod ID: M6ASITE011687 Click to Show/Hide the Full List
mod site chr12:48096406-48096407:- [6]
Sequence ATTTTATCTTCCAGGCAAGGACATTTGGACCGATCTTTTAC
Motif Score 3.643047619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000549518.6; ENST00000551798.1; ENST00000547181.5; ENST00000448372.5; ENST00000547886.5; ENST00000549595.5; ENST00000551592.5; ENST00000552189.5
External Link RMBase: m6A_site_185323
mod ID: M6ASITE011688 Click to Show/Hide the Full List
mod site chr12:48097765-48097766:- [6]
Sequence AGAACAGTACGTTTTAGAAAACTCATTGTTCCTCTGAATTT
Motif Score 2.627720238
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000552189.5; ENST00000549595.5; ENST00000448372.5; ENST00000547181.5; ENST00000549882.1; ENST00000549518.6; ENST00000551592.5; ENST00000551798.1
External Link RMBase: m6A_site_185324
mod ID: M6ASITE011689 Click to Show/Hide the Full List
mod site chr12:48097782-48097783:- [6]
Sequence TATGTATGAGTTCTTTGAGAACAGTACGTTTTAGAAAACTC
Motif Score 2.951386905
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000551798.1; ENST00000448372.5; ENST00000549518.6; ENST00000549595.5; ENST00000552189.5; ENST00000551592.5; ENST00000549882.1; ENST00000547181.5
External Link RMBase: m6A_site_185325
mod ID: M6ASITE011690 Click to Show/Hide the Full List
mod site chr12:48097813-48097814:- [6]
Sequence ATTAAGACAAGGACGTTAAGACAAAATAGGCTATGTATGAG
Motif Score 2.897386905
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000549595.5; ENST00000551592.5; ENST00000448372.5; ENST00000551798.1; ENST00000549518.6; ENST00000552189.5; ENST00000547181.5; ENST00000549882.1
External Link RMBase: m6A_site_185326
mod ID: M6ASITE011691 Click to Show/Hide the Full List
mod site chr12:48098018-48098019:- [6]
Sequence ACAAACAGGTTTTCCAGAGGACCAGCTTTCGCTTTCTGACC
Motif Score 3.622404762
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000547181.5; ENST00000549595.5; ENST00000549882.1; ENST00000552189.5; ENST00000448372.5; ENST00000551592.5; ENST00000551798.1; ENST00000549518.6
External Link RMBase: m6A_site_185327
mod ID: M6ASITE011692 Click to Show/Hide the Full List
mod site chr12:48098034-48098035:- [6]
Sequence AAACCCACCTCCTGCCACAAACAGGTTTTCCAGAGGACCAG
Motif Score 2.20572619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000551798.1; ENST00000547181.5; ENST00000549882.1; ENST00000552189.5; ENST00000448372.5; ENST00000549518.6; ENST00000549595.5
External Link RMBase: m6A_site_185328
mod ID: M6ASITE011693 Click to Show/Hide the Full List
mod site chr12:48098052-48098053:- [6]
Sequence ACCACAACTCCGTATTCAAAACCCACCTCCTGCCACAAACA
Motif Score 2.185083333
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000552189.5; ENST00000448372.5; ENST00000549518.6; ENST00000551798.1; ENST00000549882.1; ENST00000547181.5; ENST00000549595.5
External Link RMBase: m6A_site_185329
mod ID: M6ASITE011694 Click to Show/Hide the Full List
mod site chr12:48098072-48098073:- [6]
Sequence TGGAGAAGTGACTTTAGTGAACCACAACTCCGTATTCAAAA
Motif Score 2.930744048
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000547181.5; ENST00000549595.5; ENST00000549518.6; ENST00000549882.1; ENST00000552189.5; ENST00000448372.5; ENST00000551798.1
External Link RMBase: m6A_site_185330
mod ID: M6ASITE011695 Click to Show/Hide the Full List
mod site chr12:48105469-48105470:- [6]
Sequence CATCAGAAAGAAACGTCTGGACCCTCCTGCTCAGGTTATGA
Motif Score 3.622404762
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000547181.5; ENST00000552189.5; ENST00000448372.5; ENST00000549518.6; ENST00000549882.1; ENST00000551798.1
External Link RMBase: m6A_site_185331
mod ID: M6ASITE011696 Click to Show/Hide the Full List
mod site chr12:48105550-48105551:- [6]
Sequence TACTTCTGCGTCTCACGTAAACATTTCTCCAACTCTCCTAC
Motif Score 2.20572619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000551798.1; ENST00000547181.5; ENST00000549518.6; ENST00000549882.1; ENST00000448372.5; ENST00000552189.5
External Link RMBase: m6A_site_185332
mod ID: M6ASITE011697 Click to Show/Hide the Full List
mod site chr12:48105591-48105592:- [6]
Sequence CATCTCCCGCCTTCCTTGAGACCCGAGTGATATTTCTTGAC
Motif Score 2.876744048
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000549882.1; ENST00000448372.5; ENST00000552189.5; ENST00000551798.1; ENST00000549518.6; ENST00000547181.5
External Link RMBase: m6A_site_185333
mod ID: M6ASITE011700 Click to Show/Hide the Full List
mod site chr12:48105765-48105766:- [10]
Sequence CTCTCCTGGGCCGCGGAGAGACCGTCTCCCTGCCGTTACAG
Motif Score 2.876744048
Cell/Tissue List HEK293T
Seq Type List m6A-seq
Transcript ID List ENST00000549882.1; ENST00000549518.6; ENST00000551798.1; ENST00000552189.5; ENST00000547181.5; ENST00000448372.5
External Link RMBase: m6A_site_185336
mod ID: M6ASITE011705 Click to Show/Hide the Full List
mod site chr12:48106057-48106058:- [6]
Sequence CGTTCCGCGCCCGGCCGGAAACCCCTTCGCATGGCAGCCGG
Motif Score 2.185083333
Cell/Tissue List HeLa; HEK293T
Seq Type List m6A-seq
Transcript ID List ENST00000549882.1; ENST00000549518.6
External Link RMBase: m6A_site_185341