m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00774)
Target Name Suppressor of cytokine signaling 1 (SOCS1)
Synonyms
SSI1; TIP3; Suppressor of cytokine signaling 1; SOCS-1 ; JAK-binding protein; JAB ; STAT-induced STAT inhibitor 1; SSI-1 ; Tec-interacting protein 3; TIP-3
    Click to Show/Hide
Gene Name SOCS1
Chromosomal Location 16p13.13
Family SOCS1 family
Function
Essential negative regulator of type I and type II interferon (IFN) signaling, as well as that of other cytokines, including IL2, IL4, IL6 and leukemia inhibitory factor (LIF). Downregulates cytokine signaling by inhibiting the JAK/STAT signaling pathway. Acts by binding to JAK proteins and to IFNGR1 and inhibiting their kinase activity. In vitro, suppresses Tec protein-tyrosine activity. Regulates IFN-gamma (IFNG)-mediated sensory neuron survival (By similarity). Probable substrate recognition component of an ECS (Elongin BC-CUL2/5-SOCS-box protein) E3 ubiquitin ligase complex which mediates the ubiquitination and subsequent proteasomal degradation of target proteins.
    Click to Show/Hide
Gene ID 8651
Uniprot ID
SOCS1_HUMAN
HGNC ID
HGNC:19383
KEGG ID
hsa:8651
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
SOCS1 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Fat mass and obesity-associated protein (FTO) [ERASER]
 Regulator Info 
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary Mechanistically, the FTO/Suppressor of cytokine signaling 1 (SOCS1)/JAK-STAT axis promotes diabetic kidney disease(DKD) pathogenesis via promoting inflammation. Moreover, FTO expression is significantly decreased in DKD, and overexpression of FTO can dramatically alleviate kidney inflammation.
Target Regulation Up regulation
Responsed Disease Chronic kidney disease ICD-11: GB61.Z
 Disease Info 
Pathway Response JAK-STAT signaling pathway hsa04630
In-vitro Model HEK293T Normal Homo sapiens CVCL_0063
hMC Normal Homo sapiens CVCL_9Q61
HK-2 [Human kidney] Normal Homo sapiens CVCL_0302
In-vivo Model FTO over-expression db/db mice were generated through injecting the tail vein with Fto-overexpression lentivirus at 12 weeks.
Methyltransferase-like 3 (METTL3) [WRITER]
 Regulator Info 
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [2]
Response Summary METTL3 knock-down experiment revealed that expressions of SOCS family members Suppressor of cytokine signaling 1 (SOCS1), SOCS2, SOCS4, SOCS5, and SOCS6 were increased after METTL3 knock-down. It indicated that METTL3 is involved in the development of Graves' disease (GD) by inducing mRNA m6A methylation modification of SOCS family members.
Target Regulation Down regulation
Responsed Disease Graves disease ICD-11: 5A02.0
 Disease Info 
In-vitro Model PBMCs (Human peripheral blood mononuclear cells (PBMCs) are isolated from peripheral blood and identified as any blood cell with a round nucleus)
Thyrotoxicosis [ICD-11: 5A02]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [2]
Response Summary METTL3 knock-down experiment revealed that expressions of SOCS family members Suppressor of cytokine signaling 1 (SOCS1), SOCS2, SOCS4, SOCS5, and SOCS6 were increased after METTL3 knock-down. It indicated that METTL3 is involved in the development of Graves' disease (GD) by inducing mRNA m6A methylation modification of SOCS family members.
Responsed Disease Graves disease [ICD-11: 5A02.0]
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
 Regulator Info 
Target Regulation Down regulation
In-vitro Model PBMCs (Human peripheral blood mononuclear cells (PBMCs) are isolated from peripheral blood and identified as any blood cell with a round nucleus)
Chronic kidney disease [ICD-11: GB61]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [1]
Response Summary Mechanistically, the FTO/Suppressor of cytokine signaling 1 (SOCS1)/JAK-STAT axis promotes diabetic kidney disease(DKD) pathogenesis via promoting inflammation. Moreover, FTO expression is significantly decreased in DKD, and overexpression of FTO can dramatically alleviate kidney inflammation.
Responsed Disease Chronic kidney disease [ICD-11: GB61.Z]
Target Regulator Fat mass and obesity-associated protein (FTO) ERASER
 Regulator Info 
Target Regulation Up regulation
Pathway Response JAK-STAT signaling pathway hsa04630
In-vitro Model HEK293T Normal Homo sapiens CVCL_0063
hMC Normal Homo sapiens CVCL_9Q61
HK-2 [Human kidney] Normal Homo sapiens CVCL_0302
In-vivo Model FTO over-expression db/db mice were generated through injecting the tail vein with Fto-overexpression lentivirus at 12 weeks.
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00774)
Suppressor of cytokine signaling 1 (SOCS1)
N6-methyladenosine (m6A)
In total 10 m6A sequence/site(s) in this target gene
mod ID: M6ASITE026074 Click to Show/Hide the Full List
mod site chr16:11254527-11254528:- [4]
Sequence TACCCAGTATCTTTGCACAAACCAGGGGTTGGGGGAGGGTC
Motif Score 2.185083333
Cell/Tissue List hESCs; LCLs; HEK293A-TOA; TIME; iSLK
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000332029.2; ENST00000644787.1
External Link RMBase: m6A_site_308181
mod ID: M6ASITE026075 Click to Show/Hide the Full List
mod site chr16:11254579-11254580:- [5]
Sequence TATCTGGAGCCAGGACCTGAACTCGCACCTCCTACCTCTTC
Motif Score 3.373380952
Cell/Tissue List A549; hESCs; MM6; HEK293A-TOA; MSC; iSLK
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000332029.2; ENST00000644787.1
External Link RMBase: m6A_site_308182
mod ID: M6ASITE026076 Click to Show/Hide the Full List
mod site chr16:11254585-11254586:- [5]
Sequence TAACTGTATCTGGAGCCAGGACCTGAACTCGCACCTCCTAC
Motif Score 3.622404762
Cell/Tissue List A549; hESCs; MM6; HEK293A-TOA; MSC
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000644787.1; ENST00000332029.2
External Link RMBase: m6A_site_308183
mod ID: M6ASITE026077 Click to Show/Hide the Full List
mod site chr16:11254680-11254681:- [6]
Sequence GGCTGGAGACGAGGCCGCAGACCCCTTCTCACCTCTTGAGG
Motif Score 2.876744048
Cell/Tissue List U2OS; hESCs; MM6; HEK293A-TOA; iSLK; MSC
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000644787.1; ENST00000332029.2
External Link RMBase: m6A_site_308184
mod ID: M6ASITE026078 Click to Show/Hide the Full List
mod site chr16:11254773-11254774:- [6]
Sequence TTTGTTATTACTTGCCTGGAACCATGTGGGTACCCTCCCCG
Motif Score 2.930744048
Cell/Tissue List U2OS; hESCs; MSC
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000332029.2; ENST00000644787.1
External Link RMBase: m6A_site_308185
mod ID: M6ASITE026079 Click to Show/Hide the Full List
mod site chr16:11254909-11254910:- [6]
Sequence GGCCACCGTGGGCCGCGAGAACCTGGCTCGCATCCCCCTCA
Motif Score 2.930744048
Cell/Tissue List U2OS; H1B; hESCs; LCLs
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000644787.1; ENST00000332029.2
External Link RMBase: m6A_site_308186
mod ID: M6ASITE026080 Click to Show/Hide the Full List
mod site chr16:11255112-11255113:- [7]
Sequence AGCGTGAAGATGGCCTCGGGACCCACGAGCATCCGCGTGCA
Motif Score 3.622404762
Cell/Tissue List HeLa; HepG2; A549; H1A; H1B; hESCs; GM12878; LCLs; MM6; CD4T; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000332029.2; ENST00000644787.1
External Link RMBase: m6A_site_308187
mod ID: M6ASITE026081 Click to Show/Hide the Full List
mod site chr16:11255149-11255150:- [7]
Sequence GCGCGACAGCCGCCAGCGGAACTGCTTTTTCGCCCTTAGCG
Motif Score 3.373380952
Cell/Tissue List HeLa; HepG2; A549; H1A; H1B; hESCs; GM12878; LCLs; MM6; CD4T; HEK293A-TOA; iSLK; MSC; TIME; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000644787.1; ENST00000332029.2
External Link RMBase: m6A_site_308188
mod ID: M6ASITE026082 Click to Show/Hide the Full List
mod site chr16:11255164-11255165:- [8]
Sequence GGGCACCTTCCTGGTGCGCGACAGCCGCCAGCGGAACTGCT
Motif Score 2.865571429
Cell/Tissue List hESC-HEK293T; CD8T
Seq Type List MAZTER-seq; m6A-CLIP/IP
Transcript ID List ENST00000644787.1; ENST00000332029.2
External Link RMBase: m6A_site_308189
mod ID: M6ASITE026083 Click to Show/Hide the Full List
mod site chr16:11255406-11255407:- [6]
Sequence GAGCCCCGACGGCGGCCAGAACCTTCCTCCTCTTCCTCCTC
Motif Score 2.930744048
Cell/Tissue List U2OS; LCLs; MT4; MM6; CD4T
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000332029.2; ENST00000644787.1
External Link RMBase: m6A_site_308190