m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00745)

Target Name	Metalloproteinase inhibitor 1 (TIMP-1)
Synonyms	Erythroid-potentiating activity; EPA; Fibroblast collagenase inhibitor; Collagenase inhibitor; Tissue inhibitor of metalloproteinases 1; TIMP-1 Click to Show/Hide
Gene Name	TIMP-1
Chromosomal Location	Xp11.3
Family	Protease inhibitor I35 (TIMP) family
Function	Metalloproteinase inhibitor that functions by forming one to one complexes with target metalloproteinases, such as collagenases, and irreversibly inactivates them by binding to their catalytic zinc cofactor. Acts on MMP1, MMP2, MMP3, MMP7, MMP8, MMP9, MMP10, MMP11, MMP12, MMP13 and MMP16. Does not act on MMP14. Also functions as a growth factor that regulates cell differentiation, migration and cell death and activates cellular signaling cascades via CD63 and ITGB1. Plays a role in integrin signaling. Mediates erythropoiesis in vitro; but, unlike IL3, it is species-specific, stimulating the growth and differentiation of only human and murine erythroid progenitors. Click to Show/Hide
Gene ID	7076
Uniprot ID	TIMP1_HUMAN
HGNC ID	HGNC:11820
KEGG ID	hsa:7076

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

TIMP-1 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Methyltransferase-like 3 (METTL3) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by METTL3*
Cell Line	LX2 cell line	Homo sapiens
Treatment: shMETTL3 LX2 cells Control: shLuc LX2 cells		GSE207909
Regulation		logFC: -1.77E+00 p-value: 2.62E-61
More Results	Click to View More RNA-seq Results
*Representative RIP-seq result supporting the interaction between TIMP-1 and the regulator*
Cell Line	MDA-MB-231	Homo sapiens
Regulation	logFC: 2.26E+00	GSE60213

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	METTL3 is involved in OA probably by regulating the inflammatory response. METTL3 overexpression affects extracellular matrix degradation in OA by adjusting the balance between Metalloproteinase inhibitor 1 (TIMP-1) and MMPs.
Target Regulation	Down regulation
Responsed Disease	Osteoarthritis		ICD-11: FA05	Disease Info
Cell Process	Inflammatory response
In-vitro Model	SW1353	Primary central chondrosarcoma	Homo sapiens	CVCL_0543

Osteoarthritis [ICD-11: FA05]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	METTL3 is involved in OA probably by regulating the inflammatory response. METTL3 overexpression affects extracellular matrix degradation in OA by adjusting the balance between Metalloproteinase inhibitor 1 (TIMP-1) and MMPs.
Responsed Disease	Osteoarthritis [ICD-11: FA05]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Down regulation
Cell Process	Inflammatory response
In-vitro Model	SW1353	Primary central chondrosarcoma	Homo sapiens	CVCL_0543

Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator

Non-coding RNA

m6A Regulator: Methyltransferase-like 3 (METTL3)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05189		Crosstalk Info
Epigenetic Regulator	METTL3 binding lncRNA (MetBil)
Regulated Target	Methyltransferase-like protein 3 (METTL3)
Crosstalk relationship	ncRNA → m6A
Disease	Vascular disorders of the liver	Disease Info

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00745)

Metalloproteinase inhibitor 1 (TIMP-1)

N6-methyladenosine (m6A)

In total 14 m6A sequence/site(s) in this target gene
mod ID: M6ASITE091141		Click to Show/Hide the Full List
mod site	chrX:47582465-47582466:+		[4]
Sequence	CAGATCCAGCGCCCAGAGAGACACCAGAGGTAAGCAGGGCC
Motif Score	2.897386905
Cell/Tissue List	HeLa; hESC-HEK293T; HepG2; fibroblasts; A549; HEK293A-TOA; iSLK; MSC; TIME; endometrial
Seq Type List	m6A-seq; MeRIP-seq; MAZTER-seq
Transcript ID List	ENST00000377017.5; ENST00000456754.6; ENST00000218388.9
External Link	RMBase: m6A_site_858022
mod ID: M6ASITE091142		Click to Show/Hide the Full List
mod site	chrX:47584958-47584959:+		[5]
Sequence	TCAGGGCCAAGTTCGTGGGGACACCAGAAGTCAACCAGACC
Motif Score	3.643047619
Cell/Tissue List	A549; hESC-HEK293T; HepG2; HeLa; MT4; MM6; Huh7; CD4T; peripheral-blood; GSC-11; iSLK; MSC; TIME; endometrial; HEC-1-A; NB4
Seq Type List	MeRIP-seq; MAZTER-seq; m6A-seq
Transcript ID List	ENST00000441738.1; ENST00000456754.6; ENST00000218388.9; ENST00000377017.5
External Link	RMBase: m6A_site_858023
mod ID: M6ASITE091143		Click to Show/Hide the Full List
mod site	chrX:47584976-47584977:+		[5]
Sequence	GGACACCAGAAGTCAACCAGACCACCTTATACCAGCGTTAT
Motif Score	2.876744048
Cell/Tissue List	A549; HepG2; HeLa; MT4; MM6; Huh7; CD4T; peripheral-blood; GSC-11; iSLK; MSC; TIME; endometrial; HEC-1-A; NB4
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000218388.9; ENST00000456754.6; ENST00000441738.1; ENST00000377017.5
External Link	RMBase: m6A_site_858024
mod ID: M6ASITE091144		Click to Show/Hide the Full List
mod site	chrX:47585241-47585242:+		[6]
Sequence	AGCCTTAGGGGATGCCGCTGACATCCGGTTCGTCTACACCC
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000377017.5; ENST00000218388.9; ENST00000441738.1; ENST00000456754.6
External Link	RMBase: m6A_site_858025
mod ID: M6ASITE091145		Click to Show/Hide the Full List
mod site	chrX:47585256-47585257:+		[7]
Sequence	CGCTGACATCCGGTTCGTCTACACCCCCGCCATGGAGAGTG
Motif Score	2.078666667
Cell/Tissue List	liver
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000377017.5; ENST00000218388.9; ENST00000456754.6
External Link	RMBase: m6A_site_858026
mod ID: M6ASITE091146		Click to Show/Hide the Full List
mod site	chrX:47585301-47585302:+		[6]
Sequence	CGGATACTTCCACAGGTCCCACAACCGCAGCGAGGAGTTTC
Motif Score	2.053113095
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000218388.9; ENST00000456754.6; ENST00000377017.5
External Link	RMBase: m6A_site_858027
mod ID: M6ASITE091147		Click to Show/Hide the Full List
mod site	chrX:47585558-47585559:+		[8]
Sequence	TTAGGAAAACTGCAGGATGGACTCTTGCACATCACTACCTG
Motif Score	4.065041667
Cell/Tissue List	endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000218388.9; ENST00000377017.5; ENST00000445623.1; ENST00000456754.6
External Link	RMBase: m6A_site_858028
mod ID: M6ASITE091148		Click to Show/Hide the Full List
mod site	chrX:47585566-47585567:+		[9]
Sequence	ACTGCAGGATGGACTCTTGCACATCACTACCTGCAGTTTTG
Motif Score	2.830589286
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000456754.6; ENST00000445623.1; ENST00000218388.9; ENST00000377017.5
External Link	RMBase: m6A_site_858029
mod ID: M6ASITE091149		Click to Show/Hide the Full List
mod site	chrX:47585599-47585600:+		[7]
Sequence	CAGTTTTGTGGCTCCCTGGAACAGCCTGAGCTTAGCTCAGC
Motif Score	2.951386905
Cell/Tissue List	liver; HEK293T; endometrial
Seq Type List	m6A-REF-seq; DART-seq; m6A-seq
Transcript ID List	ENST00000445623.1; ENST00000377017.5; ENST00000456754.6; ENST00000218388.9
External Link	RMBase: m6A_site_858030
mod ID: M6ASITE091150		Click to Show/Hide the Full List
mod site	chrX:47585637-47585638:+		[8]
Sequence	AGCGCCGGGGCTTCACCAAGACCTACACTGTTGGCTGTGAG
Motif Score	2.876744048
Cell/Tissue List	endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000456754.6; ENST00000218388.9; ENST00000445623.1; ENST00000377017.5
External Link	RMBase: m6A_site_858031
mod ID: M6ASITE091151		Click to Show/Hide the Full List
mod site	chrX:47585641-47585642:+		[6]
Sequence	CCGGGGCTTCACCAAGACCTACACTGTTGGCTGTGAGGAAT
Motif Score	2.078666667
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000445623.1; ENST00000218388.9; ENST00000377017.5; ENST00000456754.6
External Link	RMBase: m6A_site_858032
mod ID: M6ASITE091152		Click to Show/Hide the Full List
mod site	chrX:47586581-47586582:+		[10]
Sequence	CACTCATTGCTTGTGGACGGACCAGCTCCTCCAAGGCTCTG
Motif Score	3.622404762
Cell/Tissue List	HepG2
Seq Type List	m6A-seq
Transcript ID List	ENST00000445623.1; ENST00000377017.5; ENST00000218388.9
External Link	RMBase: m6A_site_858033
mod ID: M6ASITE091153		Click to Show/Hide the Full List
mod site	chrX:47586721-47586722:+		[7]
Sequence	GAGTGGAAGCTGAAGCCTGCACAGTGTCCACCCTGTTCCCA
Motif Score	2.830589286
Cell/Tissue List	liver
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000218388.9; ENST00000377017.5; ENST00000445623.1
External Link	RMBase: m6A_site_858034
mod ID: M6ASITE091154		Click to Show/Hide the Full List
mod site	chrX:47586760-47586761:+		[11]
Sequence	CACTCCCATCTTTCTTCCGGACAATGAAATAAAGAGTTACC
Motif Score	3.643047619
Cell/Tissue List	Huh7; endometrial
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000218388.9; ENST00000445623.1; ENST00000377017.5
External Link	RMBase: m6A_site_858035

Ref 1	METTL3 involves the progression of osteoarthritis probably by affecting ECM degradation and regulating the inflammatory response. Life Sci. 2021 Aug 1;278:119528. doi: 10.1016/j.lfs.2021.119528. Epub 2021 Apr 21.
Ref 2	Passive permeability and P-glycoprotein-mediated efflux differentiate central nervous system (CNS) and non-CNS marketed drugs. J Pharmacol Exp Ther. 2002 Dec;303(3):1029-37. doi: 10.1124/jpet.102.039255.
Ref 3	Small molecule-based reversible reprogramming of cellular lifespan. Nat Chem Biol. 2006 Jul;2(7):369-74. doi: 10.1038/nchembio800. Epub 2006 Jun 11.
Ref 4	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 5	Viral N(6)-methyladenosine upregulates replication and pathogenesis of human respiratory syncytial virus. Nat Commun. 2019 Oct 9;10(1):4595. doi: 10.1038/s41467-019-12504-y.
Ref 6	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.
Ref 7	Single-base mapping of m(6)A by an antibody-independent method. Sci Adv. 2019 Jul 3;5(7):eaax0250. doi: 10.1126/sciadv.aax0250. eCollection 2019 Jul.
Ref 8	m(6)A mRNA methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer. Nat Cell Biol. 2018 Sep;20(9):1074-1083. doi: 10.1038/s41556-018-0174-4. Epub 2018 Aug 27.
Ref 9	DART-seq: an antibody-free method for global m(6)A detection. Nat Methods. 2019 Dec;16(12):1275-1280. doi: 10.1038/s41592-019-0570-0. Epub 2019 Sep 23.
Ref 10	Topology of the human and mouse m6A RNA methylomes revealed by m6A-seq. Nature. 2012 Apr 29;485(7397):201-6. doi: 10.1038/nature11112.
Ref 11	N6-Methyladenosine in Flaviviridae Viral RNA Genomes Regulates Infection. Cell Host Microbe. 2016 Nov 9;20(5):654-665. doi: 10.1016/j.chom.2016.09.015. Epub 2016 Oct 20.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map