m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00744)
Target Name Interstitial collagenase (MMP1)
Synonyms
Fibroblast collagenase; Matrix metalloproteinase-1; MMP-1
    Click to Show/Hide
Gene Name MMP1
Chromosomal Location 11q22.2
Family Peptidase M10A family
Function
Cleaves collagens of types I, II, and III at one site in the helical domain. Also cleaves collagens of types VII and X. In case of HIV infection, interacts and cleaves the secreted viral Tat protein, leading to a decrease in neuronal Tat's mediated neurotoxicity.
    Click to Show/Hide
Gene ID 4312
Uniprot ID
MMP1_HUMAN
HGNC ID
HGNC:7155
KEGG ID
hsa:4312
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
MMP1 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Methyltransferase-like 3 (METTL3) [WRITER]
 Regulator Info 
Representative RNA-seq result indicating the expression of this target gene regulated by METTL3
Cell Line Caco-2 cell line Homo sapiens
Treatment: shMETTL3 Caco-2 cells
Control: shNTC Caco-2 cells
 GSE167075
Regulation
logFC: -1.11E+00
p-value: 1.30E-35
More Results Click to View More RNA-seq Results
Representative RIP-seq result supporting the interaction between MMP1 and the regulator
Cell Line MDA-MB-231 Homo sapiens
Regulation logFC: 8.91E+00 GSE60213
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary METTL3 is involved in OA probably by regulating the inflammatory response. METTL3 overexpression affects extracellular matrix degradation in OA by adjusting the balance between TIMPs and Interstitial collagenase (MMP1).
Target Regulation Up regulation
Responsed Disease Osteoarthritis ICD-11: FA05
 Disease Info 
Cell Process Inflammatory response
In-vitro Model SW1353 Primary central chondrosarcoma Homo sapiens CVCL_0543
Osteoarthritis [ICD-11: FA05]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [1]
Response Summary METTL3 is involved in OA probably by regulating the inflammatory response. METTL3 overexpression affects extracellular matrix degradation in OA by adjusting the balance between TIMPs and Interstitial collagenase (MMP1).
Responsed Disease Osteoarthritis [ICD-11: FA05]
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
 Regulator Info 
Target Regulation Up regulation
Cell Process Inflammatory response
In-vitro Model SW1353 Primary central chondrosarcoma Homo sapiens CVCL_0543
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00744)
Interstitial collagenase (MMP1)
N6-methyladenosine (m6A)
In total 3 m6A sequence/site(s) in this target gene
mod ID: M6ASITE008320 Click to Show/Hide the Full List
mod site chr11:102797997-102797998:- [2]
Sequence AACACAAGAGCAAGATGTGGACTTAGTCCAGGTAAATGCTG
Motif Score 4.065041667
Cell/Tissue List A549; fibroblasts; peripheral-blood; iSLK; MSC; TIME
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000315274.7
External Link RMBase: m6A_site_161252
mod ID: M6ASITE008321 Click to Show/Hide the Full List
mod site chr11:102798016-102798017:- [2]
Sequence GCTTCCCAGCGACTCTAGAAACACAAGAGCAAGATGTGGAC
Motif Score 2.20572619
Cell/Tissue List A549; fibroblasts; peripheral-blood; iSLK; MSC; TIME
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000315274.7
External Link RMBase: m6A_site_161253
mod ID: M6ASITE008322 Click to Show/Hide the Full List
mod site chr11:102798103-102798104:- [2]
Sequence ACCTTGCACTGAGAAAGAAGACAAAGGCCAGTATGCACAGC
Motif Score 2.897386905
Cell/Tissue List A549; fibroblasts; peripheral-blood; iSLK; MSC; TIME
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000315274.7
External Link RMBase: m6A_site_161256