m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00729)
Target Name Aspartate--tRNA ligase, cytoplasmic (DARS)
Synonyms
Aspartyl-tRNA synthetase; AspRS; Cell proliferation-inducing gene 40 protein
    Click to Show/Hide
Gene Name DARS
Chromosomal Location 2q21.3
Family Class-II aminoacyl-tRNA synthetase family, Type 2 subfamily
Function
Catalyzes the specific attachment of an amino acid to its cognate tRNA in a 2 step reaction: the amino acid (AA) is first activated by ATP to form AA-AMP and then transferred to the acceptor end of the tRNA.
    Click to Show/Hide
Gene ID 1615
Uniprot ID
SYDC_HUMAN
HGNC ID
HGNC:2678
KEGG ID
hsa:1615
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
DARS can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Methyltransferase-like 3 (METTL3) [WRITER]
 Regulator Info 
Representative RNA-seq result indicating the expression of this target gene regulated by METTL3
Cell Line Liver Mus musculus
Treatment: Mettl3 knockout liver
Control: Wild type liver cells
 GSE198513
Regulation
logFC: -5.90E-01
p-value: 7.45E-13
More Results Click to View More RNA-seq Results
Representative RIP-seq result supporting the interaction between DARS and the regulator
Cell Line MDA-MB-231 Homo sapiens
Regulation logFC: 2.22E+00 GSE60213
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary DARS-AS1 was validated to facilitate DARS translation via recruiting METTL3 and METTL14, which bound with DARS mRNA Aspartate--tRNA ligase, cytoplasmic (DARS) mRNA 5' untranslated region (5'UTR) and promoting its translation. The present study demonstrated that the 'HIF1-Alpha/DARS-AS1/DARS/ATG5/ATG3' pathway regulated the hypoxia-induced cytoprotective autophagy of cervical cancer(CC) and is a promising target of therapeutic strategies for patients afflicted with CC.
Responsed Disease Cervical cancer ICD-11: 2C77
 Disease Info 
Pathway Response Autophagy hsa04140
Cell Process Cell autophagy
In-vitro Model SiHa Cervical squamous cell carcinoma Homo sapiens CVCL_0032
HeLa Endocervical adenocarcinoma Homo sapiens CVCL_0030
End1/E6E7 Normal Homo sapiens CVCL_3684
DoTc2 4510 Cervical carcinoma Homo sapiens CVCL_1181
Ca Ski Cervical squamous cell carcinoma Homo sapiens CVCL_1100
C-33 A Cervical squamous cell carcinoma Homo sapiens CVCL_1094
Methyltransferase-like 14 (METTL14) [WRITER]
 Regulator Info 
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary DARS-AS1 was validated to facilitate DARS translation via recruiting METTL3 and METTL14, which bound with DARS mRNA Aspartate--tRNA ligase, cytoplasmic (DARS) mRNA 5' untranslated region (5'UTR) and promoting its translation. The present study demonstrated that the 'HIF1-Alpha/DARS-AS1/DARS/ATG5/ATG3' pathway regulated the hypoxia-induced cytoprotective autophagy of cervical cancer(CC) and is a promising target of therapeutic strategies for patients afflicted with CC.
Responsed Disease Cervical cancer ICD-11: 2C77
 Disease Info 
Pathway Response Autophagy hsa04140
Cell Process Cell autophagy
In-vitro Model SiHa Cervical squamous cell carcinoma Homo sapiens CVCL_0032
HeLa Endocervical adenocarcinoma Homo sapiens CVCL_0030
End1/E6E7 Normal Homo sapiens CVCL_3684
DoTc2 4510 Cervical carcinoma Homo sapiens CVCL_1181
Ca Ski Cervical squamous cell carcinoma Homo sapiens CVCL_1100
C-33 A Cervical squamous cell carcinoma Homo sapiens CVCL_1094
Cervical cancer [ICD-11: 2C77]
 Disease Info 
In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [1]
Response Summary DARS-AS1 was validated to facilitate DARS translation via recruiting METTL3 and METTL14, which bound with DARS mRNA Aspartate--tRNA ligase, cytoplasmic (DARS) mRNA 5' untranslated region (5'UTR) and promoting its translation. The present study demonstrated that the 'HIF1-Alpha/DARS-AS1/DARS/ATG5/ATG3' pathway regulated the hypoxia-induced cytoprotective autophagy of cervical cancer(CC) and is a promising target of therapeutic strategies for patients afflicted with CC.
Responsed Disease Cervical cancer [ICD-11: 2C77]
Target Regulator Methyltransferase-like 14 (METTL14) WRITER
 Regulator Info 
Pathway Response Autophagy hsa04140
Cell Process Cell autophagy
In-vitro Model SiHa Cervical squamous cell carcinoma Homo sapiens CVCL_0032
HeLa Endocervical adenocarcinoma Homo sapiens CVCL_0030
End1/E6E7 Normal Homo sapiens CVCL_3684
DoTc2 4510 Cervical carcinoma Homo sapiens CVCL_1181
Ca Ski Cervical squamous cell carcinoma Homo sapiens CVCL_1100
C-33 A Cervical squamous cell carcinoma Homo sapiens CVCL_1094
Experiment 2 Reporting the m6A-centered Disease Response [1]
Response Summary DARS-AS1 was validated to facilitate DARS translation via recruiting METTL3 and METTL14, which bound with DARS mRNA Aspartate--tRNA ligase, cytoplasmic (DARS) mRNA 5' untranslated region (5'UTR) and promoting its translation. The present study demonstrated that the 'HIF1-Alpha/DARS-AS1/DARS/ATG5/ATG3' pathway regulated the hypoxia-induced cytoprotective autophagy of cervical cancer(CC) and is a promising target of therapeutic strategies for patients afflicted with CC.
Responsed Disease Cervical cancer [ICD-11: 2C77]
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
 Regulator Info 
Pathway Response Autophagy hsa04140
Cell Process Cell autophagy
In-vitro Model SiHa Cervical squamous cell carcinoma Homo sapiens CVCL_0032
HeLa Endocervical adenocarcinoma Homo sapiens CVCL_0030
End1/E6E7 Normal Homo sapiens CVCL_3684
DoTc2 4510 Cervical carcinoma Homo sapiens CVCL_1181
Ca Ski Cervical squamous cell carcinoma Homo sapiens CVCL_1100
C-33 A Cervical squamous cell carcinoma Homo sapiens CVCL_1094
Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator
Histone modification
m6A Regulator: Methyltransferase-like 3 (METTL3)
 Regulator Info 
In total 2 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03510
 Crosstalk Info 
Epigenetic Regulator Histone acetyltransferase p300 (P300)
Regulated Target Histone H3 lysine 27 acetylation (H3K27ac)
Crosstalk relationship Histone modification → m6A
Disease Cervical cancer
 Disease Info 
Crosstalk ID: M6ACROT03523
 Crosstalk Info 
Epigenetic Regulator WD repeat-containing protein 5 (WDR5)
Regulated Target Histone H3 lysine 4 trimethylation (H3K4me3)
Crosstalk relationship Histone modification → m6A
Disease Cervical cancer
 Disease Info 
Non-coding RNA
m6A Regulator: Methyltransferase-like 3 (METTL3)
 Regulator Info 
In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05356
 Crosstalk Info 
Epigenetic Regulator DARS1 antisense RNA 1 (DARS1-AS1)
Regulated Target Methyltransferase-like protein 3 (METTL3)
Crosstalk relationship ncRNA → m6A
Disease Cervical cancer
 Disease Info 
m6A Regulator: Methyltransferase-like 14 (METTL14)
 Regulator Info 
In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05357
 Crosstalk Info 
Epigenetic Regulator DARS1 antisense RNA 1 (DARS1-AS1)
Regulated Target Methyltransferase-like protein 14 (METTL14)
Crosstalk relationship ncRNA → m6A
Disease Cervical cancer
 Disease Info 
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00729)
Aspartate--tRNA ligase, cytoplasmic (DARS)
Adenosine-to-Inosine editing (A-to-I)
In total 11 m6A sequence/site(s) in this target gene
mod ID: A2ISITE010028 Click to Show/Hide the Full List
mod site chr2:135908908-135908909:- [2]
Sequence ATATGTACTACGTTTACTTTATCCAGTCTATCATTGATGGG
Transcript ID List ENST00000478212.5; ENST00000489964.5; ENST00000422708.3; ENST00000264161.9
External Link RMBase: RNA-editing_site_80411
mod ID: A2ISITE010029 Click to Show/Hide the Full List
mod site chr2:135909622-135909623:- [2]
Sequence CTTTTAAAAGTTGAACCCATAGACAAAGAGTAGAATGGTTG
Transcript ID List rmsk_683690; ENST00000264161.9; ENST00000422708.3; ENST00000489964.5; ENST00000478212.5
External Link RMBase: RNA-editing_site_80412
mod ID: A2ISITE010030 Click to Show/Hide the Full List
mod site chr2:135909679-135909680:- [2]
Sequence ATTAGCACATCAGGCACAGAAAGACAAATACTGTGTGATCT
Transcript ID List rmsk_683690; ENST00000489964.5; ENST00000264161.9; ENST00000422708.3; ENST00000478212.5
External Link RMBase: RNA-editing_site_80413
mod ID: A2ISITE010031 Click to Show/Hide the Full List
mod site chr2:135909720-135909721:- [2]
Sequence GTAGCAATGTAGATGAACATAGAGGACATCATGCTAAACAA
Transcript ID List rmsk_683690; ENST00000264161.9; ENST00000422708.3; ENST00000478212.5; ENST00000489964.5
External Link RMBase: RNA-editing_site_80414
mod ID: A2ISITE010032 Click to Show/Hide the Full List
mod site chr2:135910119-135910120:- [3]
Sequence ATTTGTGCACTCTGATGTTCAATGCAGCATTATTTACAATA
Transcript ID List ENST00000489964.5; ENST00000478212.5; rmsk_683692; ENST00000264161.9; ENST00000422708.3
External Link RMBase: RNA-editing_site_80415
mod ID: A2ISITE010033 Click to Show/Hide the Full List
mod site chr2:135912971-135912972:- [4]
Sequence GCACTTTGGGAGGCCAAGGTAGGAGGATCATTTGAGGCCAG
Transcript ID List ENST00000489964.5; ENST00000264161.9; ENST00000422708.3; rmsk_683697
External Link RMBase: RNA-editing_site_80416
mod ID: A2ISITE010034 Click to Show/Hide the Full List
mod site chr2:135917076-135917077:- [4]
Sequence CCTTCACCTCTCAGGCCCAAACAATTCTCCTGCCTCAGCCT
Transcript ID List ENST00000422708.3; ENST00000264161.9
External Link RMBase: RNA-editing_site_80417
mod ID: A2ISITE010035 Click to Show/Hide the Full List
mod site chr2:135917156-135917157:- [4]
Sequence TTTTCTTTTTCTTTTTTTTGAGACGAGTCTTGCTCTGTCGC
Transcript ID List ENST00000264161.9; ENST00000422708.3
External Link RMBase: RNA-editing_site_80418
mod ID: A2ISITE010036 Click to Show/Hide the Full List
mod site chr2:135918278-135918279:- [2]
Sequence ATTTTTGTACTACCATTGATAGACATGATGAATGGGAGTTG
Transcript ID List ENST00000264161.9; ENST00000422708.3
External Link RMBase: RNA-editing_site_80419
mod ID: A2ISITE010037 Click to Show/Hide the Full List
mod site chr2:135919248-135919249:- [2]
Sequence CACTTGAGGTCAGAAGTTCAAGACCGACCCGGCCAACTTAG
Transcript ID List ENST00000422708.3; rmsk_683710; ENST00000264161.9
External Link RMBase: RNA-editing_site_80420
mod ID: A2ISITE010038 Click to Show/Hide the Full List
mod site chr2:135929999-135930000:- [3]
Sequence CATGTACTTGCCTTGACTTAAGTTACCAGTCTGTCCAAGAG
Transcript ID List ENST00000264161.9; ENST00000456565.5; ENST00000441323.5
External Link RMBase: RNA-editing_site_80421
N6-methyladenosine (m6A)
In total 54 m6A sequence/site(s) in this target gene
mod ID: M6ASITE047547 Click to Show/Hide the Full List
mod site chr2:135906710-135906711:- [5]
Sequence ATTAATTTGTTAAATTCTAAACTTGAATTTCAATAAAATTT
Motif Score 2.627720238
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000264161.9
External Link RMBase: m6A_site_494453
mod ID: M6ASITE047548 Click to Show/Hide the Full List
mod site chr2:135906761-135906762:- [5]
Sequence AAATTATGTAAAGCTAAACTACTGGTTAGAAAGTATTCAGT
Motif Score 2.500660714
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000264161.9
External Link RMBase: m6A_site_494454
mod ID: M6ASITE047549 Click to Show/Hide the Full List
mod site chr2:135906910-135906911:- [6]
Sequence CTTAGATTTTCAGTATTTGAACTTATTTTTTTAAATTCTGT
Motif Score 3.373380952
Cell/Tissue List HeLa; HEK293T
Seq Type List m6A-seq; DART-seq
Transcript ID List ENST00000478212.5; ENST00000264161.9
External Link RMBase: m6A_site_494455
mod ID: M6ASITE047550 Click to Show/Hide the Full List
mod site chr2:135906952-135906953:- [5]
Sequence TTTTTCTTCTTTTCTATATTACAAGGGCCCCAGTGTTAATG
Motif Score 2.07285119
Cell/Tissue List HEK293T; hESC-HEK293T
Seq Type List DART-seq; MAZTER-seq
Transcript ID List ENST00000478212.5; ENST00000264161.9
External Link RMBase: m6A_site_494456
mod ID: M6ASITE047551 Click to Show/Hide the Full List
mod site chr2:135906976-135906977:- [5]
Sequence TTTTAAACAGTTAAGATTGTACAATTTTTCTTCTTTTCTAT
Motif Score 2.856142857
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000264161.9; ENST00000478212.5
External Link RMBase: m6A_site_494457
mod ID: M6ASITE047552 Click to Show/Hide the Full List
mod site chr2:135906990-135906991:- [6]
Sequence GTAAACGTTAAGAGTTTTAAACAGTTAAGATTGTACAATTT
Motif Score 2.20572619
Cell/Tissue List HeLa; hESC-HEK293T; AML
Seq Type List m6A-seq; MAZTER-seq; miCLIP
Transcript ID List ENST00000264161.9; ENST00000478212.5
External Link RMBase: m6A_site_494458
mod ID: M6ASITE047553 Click to Show/Hide the Full List
mod site chr2:135907006-135907007:- [5]
Sequence ATATTCTGTTACTACAGTAAACGTTAAGAGTTTTAAACAGT
Motif Score 2.179660714
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000478212.5; ENST00000264161.9
External Link RMBase: m6A_site_494459
mod ID: M6ASITE047554 Click to Show/Hide the Full List
mod site chr2:135907016-135907017:- [5]
Sequence TTACAAATTCATATTCTGTTACTACAGTAAACGTTAAGAGT
Motif Score 2.494845238
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000264161.9; ENST00000478212.5
External Link RMBase: m6A_site_494460
mod ID: M6ASITE047555 Click to Show/Hide the Full List
mod site chr2:135907034-135907035:- [5]
Sequence GAAATTCATATGGTTATGTTACAAATTCATATTCTGTTACT
Motif Score 2.07285119
Cell/Tissue List HEK293T; hESC-HEK293T
Seq Type List DART-seq; MAZTER-seq
Transcript ID List ENST00000478212.5; ENST00000264161.9
External Link RMBase: m6A_site_494461
mod ID: M6ASITE047556 Click to Show/Hide the Full List
mod site chr2:135907060-135907061:- [5]
Sequence ACATGCATCAGTAGGAAATAACTTGAGAAATTCATATGGTT
Motif Score 2.590089286
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000264161.9; ENST00000478212.5
External Link RMBase: m6A_site_494462
mod ID: M6ASITE047557 Click to Show/Hide the Full List
mod site chr2:135907080-135907081:- [6]
Sequence AGAGATTTTTATAACTTCAGACATGCATCAGTAGGAAATAA
Motif Score 2.897386905
Cell/Tissue List HeLa; HEK293T; hESC-HEK293T
Seq Type List m6A-seq; DART-seq; MAZTER-seq
Transcript ID List ENST00000478212.5; ENST00000264161.9
External Link RMBase: m6A_site_494463
mod ID: M6ASITE047558 Click to Show/Hide the Full List
mod site chr2:135907087-135907088:- [5]
Sequence GTTTAAAAGAGATTTTTATAACTTCAGACATGCATCAGTAG
Motif Score 2.590089286
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000478212.5; ENST00000264161.9
External Link RMBase: m6A_site_494464
mod ID: M6ASITE047559 Click to Show/Hide the Full List
mod site chr2:135907140-135907141:- [5]
Sequence TTGCAAGGCCCTAAAATATCACTGTTATTTTTGGAGTAATT
Motif Score 2.469291667
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000478212.5; ENST00000264161.9
External Link RMBase: m6A_site_494465
mod ID: M6ASITE047560 Click to Show/Hide the Full List
mod site chr2:135907310-135907311:- [7]
Sequence ACGACTCACTCCTTAAATTCACACTTTGCCACTTAACTCCA
Motif Score 2.047297619
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000489964.5; ENST00000478212.5; ENST00000422708.3; ENST00000264161.9
External Link RMBase: m6A_site_494466
mod ID: M6ASITE047561 Click to Show/Hide the Full List
mod site chr2:135911188-135911189:- [7]
Sequence TTTGGAGAAAATTAAGGCTTACATTGATTCCTTCCGCTTTG
Motif Score 2.07285119
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000422708.3; ENST00000489964.5; ENST00000491481.1; ENST00000264161.9; ENST00000478212.5
External Link RMBase: m6A_site_494467
mod ID: M6ASITE047562 Click to Show/Hide the Full List
mod site chr2:135911427-135911428:- [7]
Sequence TTGTCAGGAGCTCAAAGAATACATGATCCTCAACTGCTAAC
Motif Score 2.110482143
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000422708.3; ENST00000264161.9; ENST00000489964.5; ENST00000478212.5; ENST00000491481.1
External Link RMBase: m6A_site_494468
mod ID: M6ASITE047563 Click to Show/Hide the Full List
mod site chr2:135911490-135911491:- [6]
Sequence GTGTTTTTTCTCTTGCAGAAACAGTCCAACTCTTACGATAT
Motif Score 2.20572619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000264161.9; ENST00000489964.5; ENST00000491481.1; ENST00000478212.5; ENST00000422708.3
External Link RMBase: m6A_site_494469
mod ID: M6ASITE047564 Click to Show/Hide the Full List
mod site chr2:135911514-135911515:- [6]
Sequence AGGATGGTAGTCACTTGAGGACTGGTGTTTTTTCTCTTGCA
Motif Score 4.065041667
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000491481.1; ENST00000489964.5; ENST00000478212.5; ENST00000264161.9; ENST00000422708.3
External Link RMBase: m6A_site_494470
mod ID: M6ASITE047565 Click to Show/Hide the Full List
mod site chr2:135914509-135914510:- [7]
Sequence TTTCACGTTTCTTTTTCAGCACACCAAATGAAAAGCTGTTG
Motif Score 2.830589286
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000422708.3; ENST00000489964.5; ENST00000264161.9
External Link RMBase: m6A_site_494471
mod ID: M6ASITE047566 Click to Show/Hide the Full List
mod site chr2:135914536-135914537:- [6]
Sequence AGTTGCCATTTGATCTTCAAACACTGATTTCACGTTTCTTT
Motif Score 2.20572619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000489964.5; ENST00000264161.9; ENST00000422708.3
External Link RMBase: m6A_site_494472
mod ID: M6ASITE047567 Click to Show/Hide the Full List
mod site chr2:135914591-135914592:- [6]
Sequence ATTTTGTAATCCCTTGAGAAACTCAAATAGAAGAAGTTCCT
Motif Score 2.627720238
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000264161.9; ENST00000422708.3; ENST00000489964.5
External Link RMBase: m6A_site_494473
mod ID: M6ASITE047568 Click to Show/Hide the Full List
mod site chr2:135916296-135916297:- [6]
Sequence TTTTTGGAGCCAACTCTAAGACTAGAATATTGTGAAGCATT
Motif Score 3.319380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000264161.9; ENST00000422708.3
External Link RMBase: m6A_site_494474
mod ID: M6ASITE047569 Click to Show/Hide the Full List
mod site chr2:135916341-135916342:- [6]
Sequence GAAATTCAAACAGTGAATAAACAGTTCCCATGTGAGCCATT
Motif Score 2.20572619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000264161.9; ENST00000422708.3
External Link RMBase: m6A_site_494475
mod ID: M6ASITE047570 Click to Show/Hide the Full List
mod site chr2:135916352-135916353:- [6]
Sequence GGTTTCAGACTGAAATTCAAACAGTGAATAAACAGTTCCCA
Motif Score 2.20572619
Cell/Tissue List HeLa; kidney
Seq Type List m6A-seq; m6A-REF-seq
Transcript ID List ENST00000264161.9; ENST00000422708.3
External Link RMBase: m6A_site_494476
mod ID: M6ASITE047571 Click to Show/Hide the Full List
mod site chr2:135916364-135916365:- [6]
Sequence ATTCTGCAAATAGGTTTCAGACTGAAATTCAAACAGTGAAT
Motif Score 3.319380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000264161.9; ENST00000422708.3
External Link RMBase: m6A_site_494477
mod ID: M6ASITE047572 Click to Show/Hide the Full List
mod site chr2:135920463-135920464:- [6]
Sequence ATGGTACAAATATTCAAAGGACTTCAAGAAAGGTAAAAAGT
Motif Score 4.065041667
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000422708.3; ENST00000264161.9
External Link RMBase: m6A_site_494478
mod ID: M6ASITE047573 Click to Show/Hide the Full List
mod site chr2:135920478-135920479:- [7]
Sequence GAAATTGCTGACACCATGGTACAAATATTCAAAGGACTTCA
Motif Score 2.856142857
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000422708.3; ENST00000264161.9
External Link RMBase: m6A_site_494479
mod ID: M6ASITE047574 Click to Show/Hide the Full List
mod site chr2:135920488-135920489:- [5]
Sequence AGTTATGGAAGAAATTGCTGACACCATGGTACAAATATTCA
Motif Score 2.859755952
Cell/Tissue List HEK293T; hESC-HEK293T
Seq Type List DART-seq; MAZTER-seq
Transcript ID List ENST00000264161.9; ENST00000422708.3
External Link RMBase: m6A_site_494480
mod ID: M6ASITE047575 Click to Show/Hide the Full List
mod site chr2:135920542-135920543:- [6]
Sequence AACTGAGTTTGTTGGTTTGGACATTGAAATGGCTTTTAATT
Motif Score 3.643047619
Cell/Tissue List HeLa; HEK293T; hESC-HEK293T
Seq Type List m6A-seq; DART-seq; MAZTER-seq
Transcript ID List ENST00000264161.9; ENST00000422708.3
External Link RMBase: m6A_site_494481
mod ID: M6ASITE047576 Click to Show/Hide the Full List
mod site chr2:135920561-135920562:- [5]
Sequence CTAATACCCATAGACATCTAACTGAGTTTGTTGGTTTGGAC
Motif Score 2.590089286
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000264161.9
External Link RMBase: m6A_site_494482
mod ID: M6ASITE047577 Click to Show/Hide the Full List
mod site chr2:135920568-135920569:- [6]
Sequence GAAGACTCTAATACCCATAGACATCTAACTGAGTTTGTTGG
Motif Score 2.897386905
Cell/Tissue List HeLa; HEK293T; hESC-HEK293T
Seq Type List m6A-seq; DART-seq; MAZTER-seq
Transcript ID List ENST00000264161.9
External Link RMBase: m6A_site_494483
mod ID: M6ASITE047578 Click to Show/Hide the Full List
mod site chr2:135920576-135920577:- [5]
Sequence TCAGAGCGGAAGACTCTAATACCCATAGACATCTAACTGAG
Motif Score 2.089839286
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000264161.9
External Link RMBase: m6A_site_494484
mod ID: M6ASITE047579 Click to Show/Hide the Full List
mod site chr2:135920584-135920585:- [6]
Sequence CACAGTATTCAGAGCGGAAGACTCTAATACCCATAGACATC
Motif Score 3.319380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000264161.9
External Link RMBase: m6A_site_494485
mod ID: M6ASITE047580 Click to Show/Hide the Full List
mod site chr2:135922787-135922788:- [6]
Sequence GAGAAGGTTTTCTCTATTGGACCAGGTAAGATTTTGGCAGT
Motif Score 3.622404762
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000264161.9
External Link RMBase: m6A_site_494486
mod ID: M6ASITE047581 Click to Show/Hide the Full List
mod site chr2:135922888-135922889:- [5]
Sequence AAGGAGGAGCCAATGTTTTTACTGTGTCATATTTTAAAAAT
Motif Score 2.494845238
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000264161.9
External Link RMBase: m6A_site_494487
mod ID: M6ASITE047582 Click to Show/Hide the Full List
mod site chr2:135924427-135924428:- [7]
Sequence CTTCCGAGAAACTTTAATTAACAAAGGTTTTGTGGAAATCC
Motif Score 2.168095238
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000264161.9; ENST00000441323.5
External Link RMBase: m6A_site_494488
mod ID: M6ASITE047583 Click to Show/Hide the Full List
mod site chr2:135924497-135924498:- [7]
Sequence ATTTTATTACTGTCTTCTAGACATCAACTAGTCAGGCAGTC
Motif Score 2.897386905
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000441323.5; ENST00000456565.5; ENST00000264161.9
External Link RMBase: m6A_site_494489
mod ID: M6ASITE047584 Click to Show/Hide the Full List
mod site chr2:135932801-135932802:- [5]
Sequence CCAGGATACAAGATTAGACAACAGAGTCATTGATCTTAGGG
Motif Score 2.173910714
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000441323.5; ENST00000456565.5; ENST00000264161.9
External Link RMBase: m6A_site_494490
mod ID: M6ASITE047585 Click to Show/Hide the Full List
mod site chr2:135932804-135932805:- [8]
Sequence TAACCAGGATACAAGATTAGACAACAGAGTCATTGATCTTA
Motif Score 2.897386905
Cell/Tissue List endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000456565.5; ENST00000441323.5; ENST00000264161.9
External Link RMBase: m6A_site_494491
mod ID: M6ASITE047586 Click to Show/Hide the Full List
mod site chr2:135932814-135932815:- [7]
Sequence GAGCTACTGTTAACCAGGATACAAGATTAGACAACAGAGTC
Motif Score 2.110482143
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000441323.5; ENST00000264161.9; ENST00000456565.5
External Link RMBase: m6A_site_494492
mod ID: M6ASITE047587 Click to Show/Hide the Full List
mod site chr2:135943389-135943390:- [7]
Sequence ACACAGCAAGACGTTGAGTTACATGTTCAGAAGGTAAGTTT
Motif Score 2.07285119
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000449218.5; ENST00000463008.1; ENST00000435076.1; ENST00000456565.5; ENST00000441323.5; ENST00000264161.9
External Link RMBase: m6A_site_494493
mod ID: M6ASITE047588 Click to Show/Hide the Full List
mod site chr2:135943409-135943410:- [7]
Sequence ATCAGAAAATTGGAAGCTGTACACAGCAAGACGTTGAGTTA
Motif Score 2.856142857
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000456565.5; ENST00000264161.9; ENST00000463008.1; ENST00000435076.1; ENST00000441323.5; ENST00000449218.5
External Link RMBase: m6A_site_494494
mod ID: M6ASITE047589 Click to Show/Hide the Full List
mod site chr2:135943474-135943475:- [7]
Sequence TTTTTCTCTTGACAGCATCAACAAAGAGAGCATTGTGGATG
Motif Score 2.173910714
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000435076.1; ENST00000441323.5; ENST00000264161.9; ENST00000449218.5; ENST00000456565.5; ENST00000463008.1
External Link RMBase: m6A_site_494495
mod ID: M6ASITE047590 Click to Show/Hide the Full List
mod site chr2:135961395-135961396:- [7]
Sequence GATGGTTAAATTTGCTGCCAAGTAAGTAAGCAATTATATCC
Motif Score 1.724672619
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000264161.9; ENST00000463008.1; ENST00000449218.5; ENST00000441323.5; ENST00000456565.5; ENST00000435076.1
External Link RMBase: m6A_site_494496
mod ID: M6ASITE047591 Click to Show/Hide the Full List
mod site chr2:135979288-135979289:- [7]
Sequence GGGTACGTGCAAGAGTTCATACAAGCAGAGCTAAAGGTAGG
Motif Score 2.110482143
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000435076.1; ENST00000441323.5; ENST00000264161.9; ENST00000456565.5; ENST00000474184.1; ENST00000449218.5; ENST00000463008.1
External Link RMBase: m6A_site_494497
mod ID: M6ASITE047592 Click to Show/Hide the Full List
mod site chr2:135979331-135979332:- [7]
Sequence CGGGTTAGAGACTTGACAATACAAAAAGCTGATGAAGTTGT
Motif Score 2.110482143
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000463008.1; ENST00000435076.1; ENST00000456565.5; ENST00000441323.5; ENST00000264161.9; ENST00000449218.5; ENST00000474184.1
External Link RMBase: m6A_site_494498
mod ID: M6ASITE047593 Click to Show/Hide the Full List
mod site chr2:135979336-135979337:- [5]
Sequence TGGTTCGGGTTAGAGACTTGACAATACAAAAAGCTGATGAA
Motif Score 2.859755952
Cell/Tissue List HEK293T; hESC-HEK293T
Seq Type List DART-seq; MAZTER-seq
Transcript ID List ENST00000435076.1; ENST00000449218.5; ENST00000463008.1; ENST00000456565.5; ENST00000264161.9; ENST00000441323.5; ENST00000474184.1
External Link RMBase: m6A_site_494499
mod ID: M6ASITE047594 Click to Show/Hide the Full List
mod site chr2:135979341-135979342:- [6]
Sequence AGTTTTGGTTCGGGTTAGAGACTTGACAATACAAAAAGCTG
Motif Score 3.319380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000435076.1; ENST00000456565.5; ENST00000463008.1; ENST00000449218.5; ENST00000441323.5; ENST00000474184.1; ENST00000264161.9
External Link RMBase: m6A_site_494500
mod ID: M6ASITE047595 Click to Show/Hide the Full List
mod site chr2:135980521-135980522:- [9]
Sequence CTTTGCTTTTGGCTATGAGAACCGTGTTATTTATTCTCCTG
Motif Score 2.930744048
Cell/Tissue List A549; HEC-1-A
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000441323.5; ENST00000435076.1; ENST00000463008.1; ENST00000456565.5; ENST00000264161.9; ENST00000474184.1; ENST00000449218.5
External Link RMBase: m6A_site_494501
mod ID: M6ASITE047596 Click to Show/Hide the Full List
mod site chr2:135983400-135983401:- [6]
Sequence ATGATACAATCACAAGAAAAACCAGGTTAGTAGCTATGTGA
Motif Score 2.185083333
Cell/Tissue List HeLa; HepG2; A549; H1299; MM6; CD4T; peripheral-blood; MSC; TREX; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000474184.1; ENST00000449218.5; ENST00000456565.5; ENST00000435076.1; ENST00000264161.9; ENST00000441323.5
External Link RMBase: m6A_site_494502
mod ID: M6ASITE047597 Click to Show/Hide the Full List
mod site chr2:135983409-135983410:- [7]
Sequence ATATCTTCAATGATACAATCACAAGAAAAACCAGGTTAGTA
Motif Score 2.047297619
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000456565.5; ENST00000474184.1; ENST00000449218.5; ENST00000264161.9; ENST00000435076.1; ENST00000441323.5
External Link RMBase: m6A_site_494503
mod ID: M6ASITE047598 Click to Show/Hide the Full List
mod site chr2:135983415-135983416:- [5]
Sequence TATGGAATATCTTCAATGATACAATCACAAGAAAAACCAGG
Motif Score 2.110482143
Cell/Tissue List HEK293T; hESC-HEK293T
Seq Type List DART-seq; MAZTER-seq
Transcript ID List ENST00000474184.1; ENST00000435076.1; ENST00000456565.5; ENST00000441323.5; ENST00000264161.9; ENST00000449218.5
External Link RMBase: m6A_site_494504
mod ID: M6ASITE047606 Click to Show/Hide the Full List
mod site chr2:135985553-135985554:- [6]
Sequence CCAGGGTCGGGAGGGCGGAGACTGGGAGGGAGGGAGAAGCC
Motif Score 3.319380952
Cell/Tissue List HeLa; HepG2; A549; H1A; H1B; MT4; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293T; HEK293A-TOA; MSC; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000435076.1; ENST00000456565.5; ENST00000264161.9; ENST00000441323.5; ENST00000449218.5
External Link RMBase: m6A_site_494512
mod ID: M6ASITE047607 Click to Show/Hide the Full List
mod site chr2:135985576-135985577:- [6]
Sequence GTCCGAGCGCGTGTGCTGAGACCCCAGGGTCGGGAGGGCGG
Motif Score 2.876744048
Cell/Tissue List HeLa; HepG2; A549; H1A; H1B; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293T; HEK293A-TOA; MSC; endometrial; HEC-1-A; GSCs; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000264161.9; ENST00000456565.5; ENST00000449218.5; ENST00000441323.5
External Link RMBase: m6A_site_494513
Pseudouridine (Pseudo)
In total 2 m6A sequence/site(s) in this target gene
mod ID: PSESITE000142 Click to Show/Hide the Full List
mod site chr2:135920539-135920540:- [10]
Sequence TGAGTTTGTTGGTTTGGACATTGAAATGGCTTTTAATTACC
Transcript ID List ENST00000264161.9; ENST00000422708.3
External Link RMBase: Pseudo_site_2724
mod ID: PSESITE000143 Click to Show/Hide the Full List
mod site chr2:135979305-135979306:- [11]
Sequence AGCTGATGAAGTTGTTTGGGTACGTGCAAGAGTTCATACAA
Transcript ID List ENST00000474184.1; ENST00000435076.1; ENST00000456565.5; ENST00000441323.5; ENST00000463008.1; ENST00000449218.5; ENST00000264161.9
External Link RMBase: Pseudo_site_2725