m6A Target Gene Information
General Information of the m6A Target Gene (ID: M6ATAR00717)
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
MIR503
can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Methyltransferase-like 3 (METTL3) [WRITER]
| Representative RNA-seq result indicating the expression of this target gene regulated by METTL3 | ||
| Cell Line | MDA-MB-231 | Homo sapiens |
|
Treatment: METTL3 knockdown MDA-MB-231 cells
Control: MDA-MB-231 cells
|
GSE70061 | |
| Regulation |
  |
logFC: 1.48E+00 p-value: 8.87E-04 |
| More Results | Click to View More RNA-seq Results | |
| In total 1 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [1] | |||
| Response Summary | Hypoxia induced rapid H3K4 methylation of the promoter of the methyltransferase-like 3 gene (METTL3) and resulted in its overexpression. METTL3 overexpression evokes N6-methyladenosine (m6A)-dependent miR-503 biogenesis in endothelial cells. In summary, this study highlights a novel endogenous mechanism wherein EVs aggravate myocardial injury during the onset of AMI via endothelial cell-secreted miR-503 shuttling. | |||
| Target Regulation | Up regulation | |||
| Responsed Disease | Myocardial injury | ICD-11: NB31.Z | ||
| Cell Process | Mitochondrial metabolic dysfunction | |||
| In-vivo Model | To generate an AMI mouse model, mice were anesthetised by intraperitoneal injection of sterile pentobarbital sodium at 50 mg/kg body weight. | |||
Injury of heart [ICD-11: NB31]
| In total 1 item(s) under this disease | ||||
| Experiment 1 Reporting the m6A-centered Disease Response | [1] | |||
| Response Summary | Hypoxia induced rapid H3K4 methylation of the promoter of the methyltransferase-like 3 gene (METTL3) and resulted in its overexpression. METTL3 overexpression evokes N6-methyladenosine (m6A)-dependent miR-503 biogenesis in endothelial cells. In summary, this study highlights a novel endogenous mechanism wherein EVs aggravate myocardial injury during the onset of AMI via endothelial cell-secreted miR-503 shuttling. | |||
| Responsed Disease | Myocardial injury [ICD-11: NB31.Z] | |||
| Target Regulator | Methyltransferase-like 3 (METTL3) | WRITER | ||
| Target Regulation | Up regulation | |||
| Cell Process | Mitochondrial metabolic dysfunction | |||
| In-vivo Model | To generate an AMI mouse model, mice were anesthetised by intraperitoneal injection of sterile pentobarbital sodium at 50 mg/kg body weight. | |||
Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator
Histone modification
m6A Regulator: Methyltransferase-like 3 (METTL3)
| In total 1 item(s) under this m6A regulator | ||
| Crosstalk ID: M6ACROT03071 | ||
| Epigenetic Regulator | Histone-lysine N-methyltransferase 2A (KMT2A) | |
| Regulated Target | Histone H3 lysine 4 trimethylation (H3K4me3) | |
| Crosstalk relationship | Histone modification → m6A | |
| Disease | Myocardial injury | |
| Drug | C646 | |
Non-coding RNA
m6A Regulator: Methyltransferase-like 3 (METTL3)
| In total 1 item(s) under this m6A regulator | ||
| Crosstalk ID: M6ACROT05626 | ||
| Epigenetic Regulator | MiR-503 | |
| Regulated Target | PPARG coactivator 1 beta (PPARGC1B) | |
| Crosstalk relationship | m6A → ncRNA | |
| Disease | Injury of heart | |
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00717)
| In total 1 m6A sequence/site(s) in this target gene | |||
| mod ID: A2ISITE003920 | Click to Show/Hide the Full List | ||
| mod site | chrX:134546391-134546392:- | [2] | |
| Sequence | CCCGCGCTCAGCCGTGCCCTAGCAGCGGGAACAGTTCTGCA | ||
| Transcript ID List | ENST00000385270.1; MIMAT0002874; ENST00000441492.1; ENST00000440570.5; ENST00000414769.1 | ||
| External Link | RMBase: RNA-editing_site_143326 | ||
References