m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00714)

Target Name	Krueppel-like factor 2 (KLF2)
Synonyms	Lung krueppel-like factor Click to Show/Hide
Gene Name	KLF2
Chromosomal Location	19p13.11
Family	Krueppel C2H2-type zinc-finger protein family
Function	Transcription factor that binds to the CACCC box in the promoter of target genes such as HBB/beta globin or NOV and activates their transcription. Might be involved in transcriptional regulation by modulating the binding of the RARA nuclear receptor to RARE DNA elements. Click to Show/Hide
Gene ID	10365
Uniprot ID	KLF2_HUMAN
HGNC ID	HGNC:6347
KEGG ID	hsa:10365

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

KLF2 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Browse Drug

Fat mass and obesity-associated protein (FTO) [ERASER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by FTO*
Cell Line	B16F10 cell line	Mus musculus
Treatment: FTO knockout B16F10 cells Control: B16F10 cells		GSE134388
Regulation		logFC: -1.68E+00 p-value: 3.25E-02
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	FTO overexpression significantly upregulated the mRNA and protein levels of VCAM-1 and ICAM-1, downregulated those of Krueppel-like factor 2 (KLF2) and eNOS, and strongly attenuated the atorvastatin-mediated induction of KLF2 and eNOS expression. FTO could serve as a novel molecular target to modulate endothelial function in vascular diseases.
Target Regulation	Down regulation
Responsed Disease	Vascular diseases		ICD-11: BE2Z	Disease Info
Responsed Drug	Atorvastatin		Approved	Drug Info
In-vitro Model	THP-1	Childhood acute monocytic leukemia	Homo sapiens	CVCL_0006
	HUVEC-C	Normal	Homo sapiens	CVCL_2959
	HEK293T	Normal	Homo sapiens	CVCL_0063

Methyltransferase-like 3 (METTL3) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by METTL3*
Cell Line	LX2 cell line	Homo sapiens
Treatment: shMETTL3 LX2 cells Control: shLuc LX2 cells		GSE207909
Regulation		logFC: -1.15E+00 p-value: 3.23E-14
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene			[2]
Response Summary	METTL3 promotes translation of SPHK2 mRNA via an m6A-YTHDF1-dependent manner. Functionally, SPHK2 facilitates GC cell proliferation, migration and invasion by inhibiting Krueppel-like factor 2 (KLF2) expression.
Target Regulation	Down regulation
Responsed Disease	Gastric cancer	ICD-11: 2B72	Disease Info
Cell Process	Cell proliferation
	Cell migration
	Cell invasion

Gastric cancer [ICD-11: 2B72]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response			[2]
Response Summary	METTL3 promotes translation of SPHK2 mRNA via an m6A-YTHDF1-dependent manner. Functionally, SPHK2 facilitates GC cell proliferation, migration and invasion by inhibiting Krueppel-like factor 2 (KLF2) expression.
Responsed Disease	Gastric cancer [ICD-11: 2B72]
Target Regulator	Methyltransferase-like 3 (METTL3)	WRITER	Regulator Info
Target Regulation	Down regulation
Cell Process	Cell proliferation
	Cell migration
	Cell invasion

Diseases of the circulatory system [ICD-11: BE2Z]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	FTO overexpression significantly upregulated the mRNA and protein levels of VCAM-1 and ICAM-1, downregulated those of Krueppel-like factor 2 (KLF2) and eNOS, and strongly attenuated the atorvastatin-mediated induction of KLF2 and eNOS expression. FTO could serve as a novel molecular target to modulate endothelial function in vascular diseases.
Responsed Disease	Vascular diseases [ICD-11: BE2Z]
Target Regulator	Fat mass and obesity-associated protein (FTO)		ERASER	Regulator Info
Target Regulation	Down regulation
Responsed Drug	Atorvastatin		Approved	Drug Info
In-vitro Model	THP-1	Childhood acute monocytic leukemia	Homo sapiens	CVCL_0006
	HUVEC-C	Normal	Homo sapiens	CVCL_2959
	HEK293T	Normal	Homo sapiens	CVCL_0063

Atorvastatin [Approved]

Drug Info

In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response				[1]
Response Summary	FTO overexpression significantly upregulated the mRNA and protein levels of VCAM-1 and ICAM-1, downregulated those of Krueppel-like factor 2 (KLF2) and eNOS, and strongly attenuated the atorvastatin-mediated induction of KLF2 and eNOS expression. FTO could serve as a novel molecular target to modulate endothelial function in vascular diseases.
Target Regulator	Fat mass and obesity-associated protein (FTO)		ERASER	Regulator Info
Target Regulation	Down regulation
Responsed Disease	Vascular diseases		ICD-11: BE2Z	Disease Info
In-vitro Model	THP-1	Childhood acute monocytic leukemia	Homo sapiens	CVCL_0006
	HUVEC-C	Normal	Homo sapiens	CVCL_2959
	HEK293T	Normal	Homo sapiens	CVCL_0063

Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator

Histone modification

m6A Regulator: Methyltransferase-like 3 (METTL3)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03653		Crosstalk Info
Epigenetic Regulator	Histone-lysine N-methyltransferase EZH2 (EZH2)
Regulated Target	Histone H3 lysine 27 trimethylation (H3K27me3)
Crosstalk relationship	Histone modification → m6A
Disease	Gastric cancer	Disease Info

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00714)

Krueppel-like factor 2 (KLF2)

Adenosine-to-Inosine editing (A-to-I)

In total 1 m6A sequence/site(s) in this target gene
mod ID: A2ISITE009082		Click to Show/Hide the Full List
mod site	chr19:16325053-16325054:+		[3]
Sequence	GTGGGCGGCGGGCTCGGGGTAGTAGAACGTGGGCTGCGGGG
Transcript ID List	ENST00000592003.1; ENST00000248071.5
External Link	RMBase: RNA-editing_site_67126

5-methylcytidine (m5C)

In total 2 m6A sequence/site(s) in this target gene
mod ID: M5CSITE001844		Click to Show/Hide the Full List
mod site	chr19:16325189-16325190:+
Sequence	CCCGAGCCCCGCCGCCCGCTCACGCCCATTGCCCTGTCGCC
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000248071.5; ENST00000592003.1; rmsk_4952862
External Link	RMBase: m5C_site_23348
mod ID: M5CSITE001845		Click to Show/Hide the Full List
mod site	chr19:16325635-16325636:+		[4]
Sequence	GCATGCGAGGTCCCGGGGGCCGCCCCCCGCCGCCGCCCGAC
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000248071.5; ENST00000592003.1
External Link	RMBase: m5C_site_23349

N6-methyladenosine (m6A)

In total 14 m6A sequence/site(s) in this target gene
mod ID: M6ASITE040444		Click to Show/Hide the Full List
mod site	chr19:16324937-16324938:+		[5]
Sequence	CCGGCCATGGCGCTGAGTGAACCCATCCTGCCGTCCTTCTC
Motif Score	2.930744048
Cell/Tissue List	HeLa; A549; U2OS; Jurkat; CD4T; GSC-11; HEK293A-TOA; iSLK; TIME; TREX; MSC; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000248071.5; ENST00000592003.1
External Link	RMBase: m6A_site_426233
mod ID: M6ASITE040445		Click to Show/Hide the Full List
mod site	chr19:16325232-16325233:+		[6]
Sequence	CAGCGCTGGCCGCGCGCCGAACCCGAGTCCGGCGGCACCGA
Motif Score	2.930744048
Cell/Tissue List	A549; U2OS; Jurkat; CD4T; GSC-11; TREX; iSLK; TIME; MSC; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000248071.5; ENST00000592003.1
External Link	RMBase: m6A_site_426234
mod ID: M6ASITE040446		Click to Show/Hide the Full List
mod site	chr19:16325276-16325277:+		[6]
Sequence	CGACCTCAACAGCGTGCTGGACTTCATCCTGTCCATGGGGC
Motif Score	4.065041667
Cell/Tissue List	A549; U2OS; Jurkat; CD4T; GSC-11; HEK293T; TREX; iSLK; TIME; MSC; endometrial; HEC-1-A
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000248071.5; ENST00000592003.1
External Link	RMBase: m6A_site_426235
mod ID: M6ASITE040447		Click to Show/Hide the Full List
mod site	chr19:16325370-16325371:+		[6]
Sequence	CCTGCGTTCTATTACCCCGAACCCGGCGCGCCCCCGCCCTA
Motif Score	2.930744048
Cell/Tissue List	A549; U2OS; Jurkat; GSC-11; iSLK; endometrial
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000592003.1; ENST00000248071.5
External Link	RMBase: m6A_site_426236
mod ID: M6ASITE040448		Click to Show/Hide the Full List
mod site	chr19:16325983-16325984:+		[7]
Sequence	GCTACGCGGGCTGCGGCAAGACCTACACCAAGAGTTCGCAT
Motif Score	2.876744048
Cell/Tissue List	CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000592003.1; ENST00000248071.5
External Link	RMBase: m6A_site_426237
mod ID: M6ASITE040449		Click to Show/Hide the Full List
mod site	chr19:16327100-16327101:+		[5]
Sequence	CGGGCGCGGCCCCCTCCCAAACTGTGACTGGTATTTATTGG
Motif Score	2.627720238
Cell/Tissue List	HeLa; HEK293T; A549; HepG2; U2OS; fibroblasts; GM12878; LCLs; Jurkat; CD4T; HEK293A-TOA; iSLK; TIME; TREX; MSC; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000592003.1; ENST00000248071.5
External Link	RMBase: m6A_site_426238
mod ID: M6ASITE040450		Click to Show/Hide the Full List
mod site	chr19:16327106-16327107:+		[8]
Sequence	CGGCCCCCTCCCAAACTGTGACTGGTATTTATTGGACCCAG
Motif Score	3.28175
Cell/Tissue List	CD8T
Seq Type List	m6A-CLIP/IP
Transcript ID List	ENST00000592003.1; ENST00000248071.5
External Link	RMBase: m6A_site_426239
mod ID: M6ASITE040451		Click to Show/Hide the Full List
mod site	chr19:16327121-16327122:+		[5]
Sequence	CTGTGACTGGTATTTATTGGACCCAGAGAACCGGGCCGGGC
Motif Score	3.622404762
Cell/Tissue List	HeLa; HEK293T; A549; HepG2; U2OS; fibroblasts; GM12878; LCLs; H1299; MM6; Jurkat; CD4T; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000592003.1; ENST00000248071.5
External Link	RMBase: m6A_site_426240
mod ID: M6ASITE040452		Click to Show/Hide the Full List
mod site	chr19:16327130-16327131:+		[5]
Sequence	GTATTTATTGGACCCAGAGAACCGGGCCGGGCACAGCGTGG
Motif Score	2.930744048
Cell/Tissue List	HeLa; HEK293T; A549; HepG2; U2OS; fibroblasts; GM12878; LCLs; H1299; MM6; Jurkat; CD4T; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000592003.1; ENST00000248071.5
External Link	RMBase: m6A_site_426241
mod ID: M6ASITE040453		Click to Show/Hide the Full List
mod site	chr19:16327212-16327213:+		[8]
Sequence	CACCCCAGCCCCCGTCTGTGACTGAAGGCCCGGTGGGAAAA
Motif Score	3.28175
Cell/Tissue List	CD8T
Seq Type List	m6A-CLIP/IP
Transcript ID List	ENST00000248071.5; ENST00000592003.1
External Link	RMBase: m6A_site_426242
mod ID: M6ASITE040454		Click to Show/Hide the Full List
mod site	chr19:16327234-16327235:+		[5]
Sequence	TGAAGGCCCGGTGGGAAAAGACCACGATCCTCCTTGACGAG
Motif Score	2.876744048
Cell/Tissue List	HeLa; HEK293T; A549; HepG2; H1B; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000248071.5; ENST00000592003.1
External Link	RMBase: m6A_site_426243
mod ID: M6ASITE040455		Click to Show/Hide the Full List
mod site	chr19:16327312-16327313:+		[9]
Sequence	TCTTCTCTCCCACCGGGTCTACACTAGAGGATCGAGGCTTG
Motif Score	2.078666667
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000248071.5
External Link	RMBase: m6A_site_426244
mod ID: M6ASITE040456		Click to Show/Hide the Full List
mod site	chr19:16327408-16327409:+		[9]
Sequence	AATATTGTATATAGTGACTGACAAATATTGTATTACTGTAC
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000248071.5
External Link	RMBase: m6A_site_426245
mod ID: M6ASITE040457		Click to Show/Hide the Full List
mod site	chr19:16327437-16327438:+		[10]
Sequence	GTATTACTGTACATAGAGAGACAGGTGGGCATTTTTGGGCT
Motif Score	2.897386905
Cell/Tissue List	Huh7; TIME; TREX
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000248071.5
External Link	RMBase: m6A_site_426246

Ref 1	N6-Methyladenosine Demethylase FTO (Fat Mass and Obesity-Associated Protein) as a Novel Mediator of Statin Effects in Human Endothelial Cells. Arterioscler Thromb Vasc Biol. 2022 May;42(5):644-658. doi: 10.1161/ATVBAHA.121.317295. Epub 2022 Mar 17.
Ref 2	METTL3-mediated m(6)A methylation of SPHK2 promotes gastric cancer progression by targeting KLF2. Oncogene. 2021 Apr;40(16):2968-2981. doi: 10.1038/s41388-021-01753-1. Epub 2021 Mar 23.
Ref 3	RADAR: a rigorously annotated database of A-to-I RNA editing. Nucleic Acids Res. 2014 Jan;42(Database issue):D109-13. doi: 10.1093/nar/gkt996. Epub 2013 Oct 25.
Ref 4	5-methylcytosine promotes mRNA export - NSUN2 as the methyltransferase and ALYREF as an m(5)C reader. Cell Res. 2017 May;27(5):606-625. doi: 10.1038/cr.2017.55. Epub 2017 Apr 18.
Ref 5	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 6	Viral N(6)-methyladenosine upregulates replication and pathogenesis of human respiratory syncytial virus. Nat Commun. 2019 Oct 9;10(1):4595. doi: 10.1038/s41467-019-12504-y.
Ref 7	Suppression of m(6)A reader Ythdf2 promotes hematopoietic stem cell expansion. Cell Res. 2018 Sep;28(9):904-917. doi: 10.1038/s41422-018-0072-0. Epub 2018 Jul 31.
Ref 8	A majority of m6A residues are in the last exons, allowing the potential for 3' UTR regulation. Genes Dev. 2015 Oct 1;29(19):2037-53. doi: 10.1101/gad.269415.115. Epub 2015 Sep 24.
Ref 9	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.
Ref 10	N6-Methyladenosine in Flaviviridae Viral RNA Genomes Regulates Infection. Cell Host Microbe. 2016 Nov 9;20(5):654-665. doi: 10.1016/j.chom.2016.09.015. Epub 2016 Oct 20.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map