m6A Target Gene Information
General Information of the m6A Target Gene (ID: M6ATAR00679)
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
CAV1
can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Fat mass and obesity-associated protein (FTO) [ERASER]
| Representative RNA-seq result indicating the expression of this target gene regulated by FTO | ||
| Cell Line | 253J cell line | Homo sapiens |
|
Treatment: siFTO 253J cells
Control: 253J cells
|
GSE150239 | |
| Regulation |
![]() ![]() |
logFC: 3.45E+00 p-value: 8.00E-05 |
| More Results | Click to View More RNA-seq Results | |
| In total 1 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [1] | |||
| Response Summary | This study demonstrated that the key demethylase of m6A FTO promoted the proliferation and metastasis of gastric cancer via regulating the mitochondrial fission/fusion and metabolism. In terms of mechanism, FTO improved the degradation of Caveolin-1 (CAV1) mRNA via its demethylation. | |||
| Target Regulation | Down regulation | |||
| Responsed Disease | Gastric cancer | ICD-11: 2B72 | ||
| In-vitro Model | SGC-7901 | Gastric carcinoma | Homo sapiens | CVCL_0520 |
| AGS | Gastric adenocarcinoma | Homo sapiens | CVCL_0139 | |
| In-vivo Model | For the tumor growth analysis, AGS cells were subcutaneously injected into nude mice, and then the tumor volumes were monitored every 5 days. Tumor volumes were estimated based on the length and width and calculated using the following formula: tumor volume = (length × width2)/2. About 1 month later, the nude mice were sacrificed, and then tumors were excised, pictured, and weighed. For the tumor metastasis analysis, AGS cells were injected into nude mice by Tail Vein. About 1 month later, the nude mice were sacrificed, and then lung with metastasis lesions were excised, pictured, and counted. | |||
Wilms tumor 1-associating protein (WTAP) [WRITER]
| Representative RNA-seq result indicating the expression of this target gene regulated by WTAP | ||
| Cell Line | mice hepatocyte | Mus musculus |
|
Treatment: Wtap Hknockout mice hepatocyte
Control: Wtap flox/flox mice hepatocyte
|
GSE168850 | |
| Regulation |
![]() ![]() |
logFC: 6.32E-01 p-value: 2.97E-02 |
| More Results | Click to View More RNA-seq Results | |
| In total 1 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [2] | |||
| Response Summary | WTAP could methylate 3'-UTR of Caveolin-1 (CAV1) and downregulate CAV-1 expression to activate NF-Kappa-B signaling pathway in EC, which promoted EC progression. | |||
| Target Regulation | Down regulation | |||
| Responsed Disease | Endometrial cancer | ICD-11: 2C76 | ||
| Pathway Response | NF-kappa B signaling pathway | hsa04064 | ||
| Cell Process | Cell proliferation | |||
| Cell migration | ||||
| Cell invasion | ||||
| Cell apoptosis | ||||
| In-vitro Model | Ishikawa | Endometrial adenocarcinoma | Homo sapiens | CVCL_2529 |
| HEC-1-A | Endometrial adenocarcinoma | Homo sapiens | CVCL_0293 | |
Gastric cancer [ICD-11: 2B72]
| In total 1 item(s) under this disease | ||||
| Experiment 1 Reporting the m6A-centered Disease Response | [1] | |||
| Response Summary | This study demonstrated that the key demethylase of m6A FTO promoted the proliferation and metastasis of gastric cancer via regulating the mitochondrial fission/fusion and metabolism. In terms of mechanism, FTO improved the degradation of Caveolin-1 (CAV1) mRNA via its demethylation. | |||
| Responsed Disease | Gastric cancer [ICD-11: 2B72] | |||
| Target Regulator | Fat mass and obesity-associated protein (FTO) | ERASER | ||
| Target Regulation | Down regulation | |||
| In-vitro Model | SGC-7901 | Gastric carcinoma | Homo sapiens | CVCL_0520 |
| AGS | Gastric adenocarcinoma | Homo sapiens | CVCL_0139 | |
| In-vivo Model | For the tumor growth analysis, AGS cells were subcutaneously injected into nude mice, and then the tumor volumes were monitored every 5 days. Tumor volumes were estimated based on the length and width and calculated using the following formula: tumor volume = (length × width2)/2. About 1 month later, the nude mice were sacrificed, and then tumors were excised, pictured, and weighed. For the tumor metastasis analysis, AGS cells were injected into nude mice by Tail Vein. About 1 month later, the nude mice were sacrificed, and then lung with metastasis lesions were excised, pictured, and counted. | |||
Endometrial cancer [ICD-11: 2C76]
| In total 1 item(s) under this disease | ||||
| Experiment 1 Reporting the m6A-centered Disease Response | [2] | |||
| Response Summary | WTAP could methylate 3'-UTR of Caveolin-1 (CAV1) and downregulate CAV-1 expression to activate NF-Kappa-B signaling pathway in EC, which promoted EC progression. | |||
| Responsed Disease | Endometrial cancer [ICD-11: 2C76] | |||
| Target Regulator | Wilms tumor 1-associating protein (WTAP) | WRITER | ||
| Target Regulation | Down regulation | |||
| Pathway Response | NF-kappa B signaling pathway | hsa04064 | ||
| Cell Process | Cell proliferation | |||
| Cell migration | ||||
| Cell invasion | ||||
| Cell apoptosis | ||||
| In-vitro Model | Ishikawa | Endometrial adenocarcinoma | Homo sapiens | CVCL_2529 |
| HEC-1-A | Endometrial adenocarcinoma | Homo sapiens | CVCL_0293 | |
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00679)
| In total 1 m6A sequence/site(s) in this target gene | |||
| mod ID: A2ISITE002305 | Click to Show/Hide the Full List | ||
| mod site | chr7:116533234-116533235:+ | [4] | |
| Sequence | TTAATCCCAGCTACTGGGGAAGCTGAGGCAGGAGAATGGCT | ||
| Transcript ID List | ENST00000341049.7; ENST00000393470.1; ENST00000456473.5; ENST00000405348.5; ENST00000393467.1; ENST00000393468.1; rmsk_2348549; ENST00000451122.5; ENST00000614113.4 | ||
| External Link | RMBase: RNA-editing_site_126690 | ||
N6-methyladenosine (m6A)
| In total 41 m6A sequence/site(s) in this target gene | |||
| mod ID: M6ASITE081885 | Click to Show/Hide the Full List | ||
| mod site | chr7:116525027-116525028:+ | [5] | |
| Sequence | TTAAAGCACAGCCCAGGGAAACCTCCTCACAGTTTTCATCC | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | fibroblasts; A549; HEK293A-TOA; iSLK; MSC; TIME | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000451122.5; ENST00000614113.4; ENST00000489856.1; ENST00000393470.1 | ||
| External Link | RMBase: m6A_site_773655 | ||
| mod ID: M6ASITE081886 | Click to Show/Hide the Full List | ||
| mod site | chr7:116525084-116525085:+ | [5] | |
| Sequence | GTCTGGGGGCAAATACGTAGACTCGGAGGTAGGCATCCGTG | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | fibroblasts; A549; HEK293A-TOA; iSLK; MSC; TIME | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000489856.1; ENST00000393470.1; ENST00000614113.4; ENST00000451122.5; ENST00000341049.7 | ||
| External Link | RMBase: m6A_site_773656 | ||
| mod ID: M6ASITE081887 | Click to Show/Hide the Full List | ||
| mod site | chr7:116525327-116525328:+ | [6] | |
| Sequence | GGAGCCCCTGAGCTAGGAGGACACGGAAAAGGGGATTGGGG | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000341049.7; ENST00000614113.4; ENST00000489856.1; ENST00000451122.5; ENST00000393470.1 | ||
| External Link | RMBase: m6A_site_773657 | ||
| mod ID: M6ASITE081888 | Click to Show/Hide the Full List | ||
| mod site | chr7:116526526-116526527:+ | [7] | |
| Sequence | GCCCTCCGCCCTCTGCAGGGACATCTCTACACCGTTCCCAT | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | MT4; GSC-11; TIME; iSLK; endometrial; HEC-1-A | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000405348.5; ENST00000393468.1; ENST00000393467.1; ENST00000393470.1; ENST00000456473.5; ENST00000451122.5; ENST00000489856.1; ENST00000341049.7; ENST00000614113.4 | ||
| External Link | RMBase: m6A_site_773658 | ||
| mod ID: M6ASITE081889 | Click to Show/Hide the Full List | ||
| mod site | chr7:116526553-116526554:+ | [8] | |
| Sequence | TACACCGTTCCCATCCGGGAACAGGGCAACATCTACAAGCC | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | A549; MT4; GSC-11; TIME; iSLK; endometrial; HEC-1-A | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000393470.1; ENST00000456473.5; ENST00000393467.1; ENST00000451122.5; ENST00000614113.4; ENST00000489856.1; ENST00000341049.7; ENST00000405348.5; ENST00000393468.1 | ||
| External Link | RMBase: m6A_site_773659 | ||
| mod ID: M6ASITE081890 | Click to Show/Hide the Full List | ||
| mod site | chr7:116526579-116526580:+ | [9] | |
| Sequence | CAACATCTACAAGCCCAACAACAAGGCCATGGCAGACGAGC | ||
| Motif Score | 2.173910714 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000614113.4; ENST00000393467.1; ENST00000341049.7; ENST00000405348.5; ENST00000489856.1; ENST00000393470.1; ENST00000456473.5; ENST00000451122.5; ENST00000393468.1 | ||
| External Link | RMBase: m6A_site_773660 | ||
| mod ID: M6ASITE081891 | Click to Show/Hide the Full List | ||
| mod site | chr7:116526627-116526628:+ | [9] | |
| Sequence | GAAGCAAGTGTACGACGCGCACACCAAGGAGATCGACCTGG | ||
| Motif Score | 2.830589286 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000393470.1; ENST00000614113.4; ENST00000489856.1; ENST00000451122.5; ENST00000393467.1; ENST00000456473.5; ENST00000393468.1; ENST00000341049.7; ENST00000405348.5 | ||
| External Link | RMBase: m6A_site_773661 | ||
| mod ID: M6ASITE081892 | Click to Show/Hide the Full List | ||
| mod site | chr7:116526664-116526665:+ | [6] | |
| Sequence | CTGGTCAACCGCGACCCTAAACACCTCAACGATGACGTGGT | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa; A549; hESC-HEK293T; MT4; GSC-11; TIME; iSLK; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000489856.1; ENST00000456473.5; ENST00000614113.4; ENST00000393468.1; ENST00000451122.5; ENST00000393467.1; ENST00000341049.7; ENST00000405348.5; ENST00000393470.1 | ||
| External Link | RMBase: m6A_site_773662 | ||
| mod ID: M6ASITE081893 | Click to Show/Hide the Full List | ||
| mod site | chr7:116526722-116526723:+ | [6] | |
| Sequence | ACCAACAGGGAAGGGCTGGGACAGCTCTCCTCTGGCAGTTA | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; A549; MT4; iSLK; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000489856.1; ENST00000341049.7; ENST00000393470.1; ENST00000456473.5; ENST00000614113.4; ENST00000393468.1; ENST00000405348.5; ENST00000451122.5; ENST00000393467.1 | ||
| External Link | RMBase: m6A_site_773663 | ||
| mod ID: M6ASITE081894 | Click to Show/Hide the Full List | ||
| mod site | chr7:116558949-116558950:+ | [10] | |
| Sequence | CACTTCTTCCTTTTAGATTGACTTTGAAGATGTGATTGCAG | ||
| Motif Score | 3.28175 | ||
| Cell/Tissue List | A549 | ||
| Seq Type List | m6A-CLIP/IP | ||
| Transcript ID List | ENST00000456473.5; ENST00000451122.5; ENST00000393470.1; ENST00000393468.1; ENST00000405348.5; ENST00000341049.7; ENST00000614113.4; ENST00000393467.1 | ||
| External Link | RMBase: m6A_site_773664 | ||
| mod ID: M6ASITE081895 | Click to Show/Hide the Full List | ||
| mod site | chr7:116558971-116558972:+ | [6] | |
| Sequence | TTTGAAGATGTGATTGCAGAACCAGAAGGGACACACAGTTT | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HeLa; A549; HepG2; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000405348.5; ENST00000393467.1; ENST00000393470.1; ENST00000614113.4; ENST00000341049.7; ENST00000393468.1; ENST00000456473.5; ENST00000451122.5 | ||
| External Link | RMBase: m6A_site_773665 | ||
| mod ID: M6ASITE081896 | Click to Show/Hide the Full List | ||
| mod site | chr7:116558981-116558982:+ | [6] | |
| Sequence | TGATTGCAGAACCAGAAGGGACACACAGTTTTGACGGCATT | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; A549; hESC-HEK293T; HepG2; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000614113.4; ENST00000451122.5; ENST00000393470.1; ENST00000405348.5; ENST00000341049.7; ENST00000393468.1; ENST00000393467.1; ENST00000456473.5 | ||
| External Link | RMBase: m6A_site_773666 | ||
| mod ID: M6ASITE081897 | Click to Show/Hide the Full List | ||
| mod site | chr7:116559126-116559127:+ | [9] | |
| Sequence | CGCCATTCTCTCTTTCCTGCACATCTGGGCAGTTGTACCAT | ||
| Motif Score | 2.830589286 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000614113.4; ENST00000393467.1; ENST00000451122.5; ENST00000456473.5; ENST00000405348.5; ENST00000393468.1; ENST00000341049.7; ENST00000393470.1 | ||
| External Link | RMBase: m6A_site_773667 | ||
| mod ID: M6ASITE081898 | Click to Show/Hide the Full List | ||
| mod site | chr7:116559207-116559208:+ | [9] | |
| Sequence | TGTCTATTCCATCTACGTCCACACCGTCTGTGACCCACTCT | ||
| Motif Score | 2.053113095 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000451122.5; ENST00000393467.1; ENST00000393468.1; ENST00000456473.5; ENST00000341049.7; ENST00000405348.5; ENST00000614113.4; ENST00000393470.1 | ||
| External Link | RMBase: m6A_site_773668 | ||
| mod ID: M6ASITE081899 | Click to Show/Hide the Full List | ||
| mod site | chr7:116559267-116559268:+ | [10] | |
| Sequence | ATTCAGCAATGTCCGCATCAACTTGCAGAAAGAAATATAAA | ||
| Motif Score | 2.595904762 | ||
| Cell/Tissue List | A549 | ||
| Seq Type List | m6A-CLIP/IP | ||
| Transcript ID List | ENST00000341049.7; ENST00000405348.5; ENST00000393470.1; ENST00000393468.1; ENST00000393467.1; ENST00000614113.4; ENST00000451122.5 | ||
| External Link | RMBase: m6A_site_773669 | ||
| mod ID: M6ASITE081900 | Click to Show/Hide the Full List | ||
| mod site | chr7:116559290-116559291:+ | [11] | |
| Sequence | TGCAGAAAGAAATATAAATGACATTTCAAGGATAGAAGTAT | ||
| Motif Score | 2.859755952 | ||
| Cell/Tissue List | kidney; hESC-HEK293T; A549 | ||
| Seq Type List | m6A-REF-seq; MAZTER-seq; m6A-CLIP/IP | ||
| Transcript ID List | ENST00000393468.1; ENST00000451122.5; ENST00000405348.5; ENST00000393467.1; ENST00000341049.7; ENST00000614113.4; ENST00000393470.1 | ||
| External Link | RMBase: m6A_site_773670 | ||
| mod ID: M6ASITE081901 | Click to Show/Hide the Full List | ||
| mod site | chr7:116559493-116559494:+ | [6] | |
| Sequence | TGGCAGTCTGAATTTTTAAAACCCATTTAAATTTTTTTCCT | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa; HEK293T; U2OS; fibroblasts; A549 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000405348.5; ENST00000614113.4; ENST00000451122.5; ENST00000341049.7; ENST00000393467.1; ENST00000393468.1 | ||
| External Link | RMBase: m6A_site_773671 | ||
| mod ID: M6ASITE081902 | Click to Show/Hide the Full List | ||
| mod site | chr7:116559566-116559567:+ | [6] | |
| Sequence | CTTTATTGGCTGAGATATGAACATATTGTTGAAAGGTAATT | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa; HEK293T; hESC-HEK293T; U2OS; fibroblasts; A549; H1299; iSLK; MSC; TIME; TREX; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq; MAZTER-seq; m6A-CLIP/IP | ||
| Transcript ID List | ENST00000405348.5; ENST00000451122.5; ENST00000614113.4; ENST00000393467.1; ENST00000341049.7 | ||
| External Link | RMBase: m6A_site_773672 | ||
| mod ID: M6ASITE081903 | Click to Show/Hide the Full List | ||
| mod site | chr7:116559604-116559605:+ | [6] | |
| Sequence | ATTTGAGAGAAATATGAAGAACTGAGGAGGAAAAAAAAAAA | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa; HEK293T; HepG2; U2OS; fibroblasts; A549; H1299; Huh7; iSLK; MSC; TIME; TREX; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000614113.4; ENST00000405348.5; ENST00000451122.5; ENST00000341049.7; ENST00000393467.1 | ||
| External Link | RMBase: m6A_site_773673 | ||
| mod ID: M6ASITE081904 | Click to Show/Hide the Full List | ||
| mod site | chr7:116559635-116559636:+ | [6] | |
| Sequence | AAAAAAAAAAAAAGAAAAGAACCAACAACCTCAACTGCCTA | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HeLa; HEK293T; A549; HepG2; U2OS; fibroblasts; H1299; Huh7; iSLK; MSC; TIME; TREX; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000405348.5; ENST00000451122.5; ENST00000341049.7; rmsk_2348597; ENST00000393467.1; ENST00000614113.4 | ||
| External Link | RMBase: m6A_site_773674 | ||
| mod ID: M6ASITE081905 | Click to Show/Hide the Full List | ||
| mod site | chr7:116559743-116559744:+ | [6] | |
| Sequence | TGTGGGCAGATTTTCAGCAAACTCTTTTCCCACTGTTTAAG | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa; HEK293T; A549; HepG2; U2OS; H1299; Huh7; iSLK; MSC; TIME; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000405348.5; ENST00000614113.4; ENST00000393467.1; ENST00000341049.7 | ||
| External Link | RMBase: m6A_site_773675 | ||
| mod ID: M6ASITE081906 | Click to Show/Hide the Full List | ||
| mod site | chr7:116559831-116559832:+ | [6] | |
| Sequence | TGATCCTTACAAGTTAGAAAACATAATCTTCTGCCTTCTCA | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000405348.5; ENST00000393467.1; ENST00000614113.4; ENST00000341049.7 | ||
| External Link | RMBase: m6A_site_773676 | ||
| mod ID: M6ASITE081907 | Click to Show/Hide the Full List | ||
| mod site | chr7:116559935-116559936:+ | [6] | |
| Sequence | TTTGTTATGTAGATAACAAGACCTCAGTGCCTTCCTGTTTT | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000341049.7; ENST00000393467.1; ENST00000614113.4; ENST00000405348.5 | ||
| External Link | RMBase: m6A_site_773677 | ||
| mod ID: M6ASITE081908 | Click to Show/Hide the Full List | ||
| mod site | chr7:116560176-116560177:+ | [10] | |
| Sequence | AATGAAATGAATTAAAGTGGACCAATAGGGCTGAGCTCTCT | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | A549 | ||
| Seq Type List | m6A-CLIP/IP | ||
| Transcript ID List | ENST00000405348.5; ENST00000341049.7; ENST00000614113.4; ENST00000393467.1 | ||
| External Link | RMBase: m6A_site_773678 | ||
| mod ID: M6ASITE081909 | Click to Show/Hide the Full List | ||
| mod site | chr7:116560311-116560312:+ | [12] | |
| Sequence | TCACGCTTTCCTGAATCCAAACTAATCCATCACCGGGGTGG | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HepG2; HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000405348.5; ENST00000393467.1; ENST00000341049.7; ENST00000614113.4 | ||
| External Link | RMBase: m6A_site_773679 | ||
| mod ID: M6ASITE081910 | Click to Show/Hide the Full List | ||
| mod site | chr7:116560435-116560436:+ | [13] | |
| Sequence | GCCTATCAGAGTTGCTGCAAACCTGACCCCTGCTCAGTAAA | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa; A549; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000341049.7; ENST00000614113.4; ENST00000405348.5; ENST00000393467.1 | ||
| External Link | RMBase: m6A_site_773680 | ||
| mod ID: M6ASITE081911 | Click to Show/Hide the Full List | ||
| mod site | chr7:116560516-116560517:+ | [6] | |
| Sequence | CCCCCTGCCAGGAGCTTTGGACCTAATCCAAGCATCCCTTT | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa; HEK293T; A549; HepG2; fibroblasts; H1299; HEK293A-TOA; TIME; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000614113.4; ENST00000405348.5; ENST00000393467.1; ENST00000341049.7 | ||
| External Link | RMBase: m6A_site_773681 | ||
| mod ID: M6ASITE081912 | Click to Show/Hide the Full List | ||
| mod site | chr7:116560615-116560616:+ | [6] | |
| Sequence | ATAAGTTCAAATTCTTCTGAACTCAAACTGAGGAATTTCAC | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa; HEK293T; A549; HepG2; fibroblasts; H1299; HEK293A-TOA; TIME; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000393467.1; ENST00000341049.7; ENST00000405348.5; ENST00000614113.4 | ||
| External Link | RMBase: m6A_site_773682 | ||
| mod ID: M6ASITE081913 | Click to Show/Hide the Full List | ||
| mod site | chr7:116560621-116560622:+ | [6] | |
| Sequence | TCAAATTCTTCTGAACTCAAACTGAGGAATTTCACCTGTAA | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa; HEK293T; A549; HepG2; fibroblasts; H1299; HEK293A-TOA; TIME; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq; m6A-CLIP/IP | ||
| Transcript ID List | ENST00000405348.5; ENST00000614113.4; ENST00000393467.1; ENST00000341049.7 | ||
| External Link | RMBase: m6A_site_773683 | ||
| mod ID: M6ASITE081914 | Click to Show/Hide the Full List | ||
| mod site | chr7:116560642-116560643:+ | [6] | |
| Sequence | CTGAGGAATTTCACCTGTAAACCTGAGTCGTACAGAAAGCT | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa; HEK293T; A549; HepG2; fibroblasts; H1299; HEK293A-TOA; TIME; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000405348.5; ENST00000341049.7; ENST00000393467.1; ENST00000614113.4 | ||
| External Link | RMBase: m6A_site_773684 | ||
| mod ID: M6ASITE081915 | Click to Show/Hide the Full List | ||
| mod site | chr7:116560723-116560724:+ | [6] | |
| Sequence | TTGTGATTCTGCCTTTGGGGACTTTTCTTAAACCTTCAGTT | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa; HEK293T; A549; HepG2; fibroblasts; HEK293A-TOA; iSLK; TIME | ||
| Seq Type List | m6A-seq; MeRIP-seq; m6A-CLIP/IP | ||
| Transcript ID List | ENST00000393467.1; ENST00000341049.7; ENST00000614113.4; ENST00000405348.5 | ||
| External Link | RMBase: m6A_site_773685 | ||
| mod ID: M6ASITE081916 | Click to Show/Hide the Full List | ||
| mod site | chr7:116560734-116560735:+ | [6] | |
| Sequence | CCTTTGGGGACTTTTCTTAAACCTTCAGTTATGATTTTTTT | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa; HEK293T; HepG2; fibroblasts; A549; HEK293A-TOA; iSLK; TIME | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000405348.5; ENST00000341049.7; ENST00000614113.4; ENST00000393467.1 | ||
| External Link | RMBase: m6A_site_773686 | ||
| mod ID: M6ASITE081917 | Click to Show/Hide the Full List | ||
| mod site | chr7:116560772-116560773:+ | [6] | |
| Sequence | TTTTTCATACACTTATTGGAACTCTGCTTGATTTTTGCCTC | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa; HEK293T; HepG2; fibroblasts; A549; HEK293A-TOA; iSLK; TIME | ||
| Seq Type List | m6A-seq; MeRIP-seq; m6A-CLIP/IP | ||
| Transcript ID List | ENST00000341049.7; ENST00000405348.5; ENST00000393467.1; ENST00000614113.4 | ||
| External Link | RMBase: m6A_site_773687 | ||
| mod ID: M6ASITE081918 | Click to Show/Hide the Full List | ||
| mod site | chr7:116560855-116560856:+ | [6] | |
| Sequence | TTTGACTTTTTGCATTTAAAACAGACACTGGCATGGATATA | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa; A549; HEK293A-TOA; iSLK | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000614113.4; ENST00000341049.7; ENST00000393467.1; ENST00000405348.5 | ||
| External Link | RMBase: m6A_site_773688 | ||
| mod ID: M6ASITE081919 | Click to Show/Hide the Full List | ||
| mod site | chr7:116560889-116560890:+ | [8] | |
| Sequence | GGATATAGTTTTACTTTTAAACTGTGTACATAACTGAAAAT | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa; A549; iSLK | ||
| Seq Type List | MeRIP-seq; m6A-seq | ||
| Transcript ID List | ENST00000405348.5; ENST00000393467.1; ENST00000341049.7; ENST00000614113.4 | ||
| External Link | RMBase: m6A_site_773689 | ||
| mod ID: M6ASITE081920 | Click to Show/Hide the Full List | ||
| mod site | chr7:116560896-116560897:+ | [9] | |
| Sequence | GTTTTACTTTTAAACTGTGTACATAACTGAAAATGTGCTAT | ||
| Motif Score | 2.856142857 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000614113.4; ENST00000341049.7; ENST00000405348.5; ENST00000393467.1 | ||
| External Link | RMBase: m6A_site_773690 | ||
| mod ID: M6ASITE081921 | Click to Show/Hide the Full List | ||
| mod site | chr7:116561002-116561003:+ | [6] | |
| Sequence | CTTTGTGATTCAATCTGTAAACTGTGTATTCCAAGACATGT | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000405348.5; ENST00000393467.1; ENST00000341049.7; ENST00000614113.4 | ||
| External Link | RMBase: m6A_site_773691 | ||
| mod ID: M6ASITE081922 | Click to Show/Hide the Full List | ||
| mod site | chr7:116561017-116561018:+ | [6] | |
| Sequence | TGTAAACTGTGTATTCCAAGACATGTCTGTTCTACATAGAT | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000405348.5; ENST00000614113.4; ENST00000393467.1; ENST00000341049.7 | ||
| External Link | RMBase: m6A_site_773692 | ||
| mod ID: M6ASITE081923 | Click to Show/Hide the Full List | ||
| mod site | chr7:116561030-116561031:+ | [9] | |
| Sequence | TTCCAAGACATGTCTGTTCTACATAGATGCTTAGTCCCTCA | ||
| Motif Score | 2.078666667 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000393467.1; ENST00000614113.4; ENST00000341049.7; ENST00000405348.5 | ||
| External Link | RMBase: m6A_site_773693 | ||
| mod ID: M6ASITE081924 | Click to Show/Hide the Full List | ||
| mod site | chr7:116561111-116561112:+ | [9] | |
| Sequence | TATGCTTACTGATATATTTTACAATTTTTTATCATGCATGT | ||
| Motif Score | 2.07285119 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000341049.7; ENST00000405348.5; ENST00000393467.1; ENST00000614113.4 | ||
| External Link | RMBase: m6A_site_773694 | ||
| mod ID: M6ASITE081925 | Click to Show/Hide the Full List | ||
| mod site | chr7:116561178-116561179:+ | [6] | |
| Sequence | TAAAAATGTTTAACGGTTAAACAGTCAGCTTTATTATTTTT | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000341049.7; ENST00000614113.4; ENST00000405348.5 | ||
| External Link | RMBase: m6A_site_773695 | ||
References



