m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00679)

Target Name	Caveolin-1 (CAV1)
Gene Name	CAV1
Chromosomal Location	7q31.2
Family	Caveolin family
Function	May act as a scaffolding protein within caveolar membranes. Forms a stable heterooligomeric complex with CAV2 that targets to lipid rafts and drives caveolae formation. Mediates the recruitment of CAVIN proteins (CAVIN1/2/3/4) to the caveolae. Interacts directly with G-protein alpha subunits and can functionally regulate their activity (By similarity). Involved in the costimulatory signal essential for T-cell receptor (TCR)-mediated T-cell activation. Its binding to DPP4 induces T-cell proliferation and NF-kappa-B activation in a T-cell receptor/CD3-dependent manner. Recruits CTNNB1 to caveolar membranes and may regulate CTNNB1-mediated signaling through the Wnt pathway (By similarity). Negatively regulates TGFB1-mediated activation of SMAD2/3 by mediating the internalization of TGFBR1 from membrane rafts leading to its subsequent degradation. Click to Show/Hide
Gene ID	857
Uniprot ID	CAV1_HUMAN
HGNC ID	HGNC:1527
KEGG ID	hsa:857

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

CAV1 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Fat mass and obesity-associated protein (FTO) [ERASER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by FTO*
Cell Line	253J cell line	Homo sapiens
Treatment: siFTO 253J cells Control: 253J cells		GSE150239
Regulation		logFC: 3.45E+00 p-value: 8.00E-05
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	This study demonstrated that the key demethylase of m6A FTO promoted the proliferation and metastasis of gastric cancer via regulating the mitochondrial fission/fusion and metabolism. In terms of mechanism, FTO improved the degradation of Caveolin-1 (CAV1) mRNA via its demethylation.
Target Regulation	Down regulation
Responsed Disease	Gastric cancer		ICD-11: 2B72	Disease Info
In-vitro Model	SGC-7901	Gastric carcinoma	Homo sapiens	CVCL_0520
In-vitro Model	AGS	Gastric adenocarcinoma	Homo sapiens	CVCL_0139
In-vivo Model	For the tumor growth analysis, AGS cells were subcutaneously injected into nude mice, and then the tumor volumes were monitored every 5 days. Tumor volumes were estimated based on the length and width and calculated using the following formula: tumor volume = (length × width2)/2. About 1 month later, the nude mice were sacrificed, and then tumors were excised, pictured, and weighed. For the tumor metastasis analysis, AGS cells were injected into nude mice by Tail Vein. About 1 month later, the nude mice were sacrificed, and then lung with metastasis lesions were excised, pictured, and counted.

Wilms tumor 1-associating protein (WTAP) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by WTAP*
Cell Line	mice hepatocyte	Mus musculus
Treatment: Wtap Hknockout mice hepatocyte Control: Wtap flox/flox mice hepatocyte		GSE168850
Regulation		logFC: 6.32E-01 p-value: 2.97E-02
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[2]
Response Summary	WTAP could methylate 3'-UTR of Caveolin-1 (CAV1) and downregulate CAV-1 expression to activate NF-Kappa-B signaling pathway in EC, which promoted EC progression.
Target Regulation	Down regulation
Responsed Disease	Endometrial cancer		ICD-11: 2C76	Disease Info
Pathway Response	NF-kappa B signaling pathway			hsa04064
Cell Process	Cell proliferation
	Cell migration
	Cell invasion
	Cell apoptosis
In-vitro Model	Ishikawa	Endometrial adenocarcinoma	Homo sapiens	CVCL_2529
	HEC-1-A	Endometrial adenocarcinoma	Homo sapiens	CVCL_0293

Gastric cancer [ICD-11: 2B72]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	This study demonstrated that the key demethylase of m6A FTO promoted the proliferation and metastasis of gastric cancer via regulating the mitochondrial fission/fusion and metabolism. In terms of mechanism, FTO improved the degradation of Caveolin-1 (CAV1) mRNA via its demethylation.
Responsed Disease	Gastric cancer [ICD-11: 2B72]
Target Regulator	Fat mass and obesity-associated protein (FTO)		ERASER	Regulator Info
Target Regulation	Down regulation
In-vitro Model	SGC-7901	Gastric carcinoma	Homo sapiens	CVCL_0520
In-vitro Model	AGS	Gastric adenocarcinoma	Homo sapiens	CVCL_0139
In-vivo Model	For the tumor growth analysis, AGS cells were subcutaneously injected into nude mice, and then the tumor volumes were monitored every 5 days. Tumor volumes were estimated based on the length and width and calculated using the following formula: tumor volume = (length × width2)/2. About 1 month later, the nude mice were sacrificed, and then tumors were excised, pictured, and weighed. For the tumor metastasis analysis, AGS cells were injected into nude mice by Tail Vein. About 1 month later, the nude mice were sacrificed, and then lung with metastasis lesions were excised, pictured, and counted.

Endometrial cancer [ICD-11: 2C76]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[2]
Response Summary	WTAP could methylate 3'-UTR of Caveolin-1 (CAV1) and downregulate CAV-1 expression to activate NF-Kappa-B signaling pathway in EC, which promoted EC progression.
Responsed Disease	Endometrial cancer [ICD-11: 2C76]
Target Regulator	Wilms tumor 1-associating protein (WTAP)		WRITER	Regulator Info
Target Regulation	Down regulation
Pathway Response	NF-kappa B signaling pathway			hsa04064
Cell Process	Cell proliferation
	Cell migration
	Cell invasion
	Cell apoptosis
In-vitro Model	Ishikawa	Endometrial adenocarcinoma	Homo sapiens	CVCL_2529
	HEC-1-A	Endometrial adenocarcinoma	Homo sapiens	CVCL_0293

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00679)

Caveolin-1 (CAV1)

Adenosine-to-Inosine editing (A-to-I)

In total 1 m6A sequence/site(s) in this target gene
mod ID: A2ISITE002305		Click to Show/Hide the Full List
mod site	chr7:116533234-116533235:+		[4]
Sequence	TTAATCCCAGCTACTGGGGAAGCTGAGGCAGGAGAATGGCT
Transcript ID List	ENST00000341049.7; ENST00000393470.1; ENST00000456473.5; ENST00000405348.5; ENST00000393467.1; ENST00000393468.1; rmsk_2348549; ENST00000451122.5; ENST00000614113.4
External Link	RMBase: RNA-editing_site_126690

N6-methyladenosine (m6A)

In total 41 m6A sequence/site(s) in this target gene
mod ID: M6ASITE081885		Click to Show/Hide the Full List
mod site	chr7:116525027-116525028:+		[5]
Sequence	TTAAAGCACAGCCCAGGGAAACCTCCTCACAGTTTTCATCC
Motif Score	2.185083333
Cell/Tissue List	fibroblasts; A549; HEK293A-TOA; iSLK; MSC; TIME
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000451122.5; ENST00000614113.4; ENST00000489856.1; ENST00000393470.1
External Link	RMBase: m6A_site_773655
mod ID: M6ASITE081886		Click to Show/Hide the Full List
mod site	chr7:116525084-116525085:+		[5]
Sequence	GTCTGGGGGCAAATACGTAGACTCGGAGGTAGGCATCCGTG
Motif Score	3.319380952
Cell/Tissue List	fibroblasts; A549; HEK293A-TOA; iSLK; MSC; TIME
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000489856.1; ENST00000393470.1; ENST00000614113.4; ENST00000451122.5; ENST00000341049.7
External Link	RMBase: m6A_site_773656
mod ID: M6ASITE081887		Click to Show/Hide the Full List
mod site	chr7:116525327-116525328:+		[6]
Sequence	GGAGCCCCTGAGCTAGGAGGACACGGAAAAGGGGATTGGGG
Motif Score	3.643047619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000341049.7; ENST00000614113.4; ENST00000489856.1; ENST00000451122.5; ENST00000393470.1
External Link	RMBase: m6A_site_773657
mod ID: M6ASITE081888		Click to Show/Hide the Full List
mod site	chr7:116526526-116526527:+		[7]
Sequence	GCCCTCCGCCCTCTGCAGGGACATCTCTACACCGTTCCCAT
Motif Score	3.643047619
Cell/Tissue List	MT4; GSC-11; TIME; iSLK; endometrial; HEC-1-A
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000405348.5; ENST00000393468.1; ENST00000393467.1; ENST00000393470.1; ENST00000456473.5; ENST00000451122.5; ENST00000489856.1; ENST00000341049.7; ENST00000614113.4
External Link	RMBase: m6A_site_773658
mod ID: M6ASITE081889		Click to Show/Hide the Full List
mod site	chr7:116526553-116526554:+		[8]
Sequence	TACACCGTTCCCATCCGGGAACAGGGCAACATCTACAAGCC
Motif Score	2.951386905
Cell/Tissue List	A549; MT4; GSC-11; TIME; iSLK; endometrial; HEC-1-A
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000393470.1; ENST00000456473.5; ENST00000393467.1; ENST00000451122.5; ENST00000614113.4; ENST00000489856.1; ENST00000341049.7; ENST00000405348.5; ENST00000393468.1
External Link	RMBase: m6A_site_773659
mod ID: M6ASITE081890		Click to Show/Hide the Full List
mod site	chr7:116526579-116526580:+		[9]
Sequence	CAACATCTACAAGCCCAACAACAAGGCCATGGCAGACGAGC
Motif Score	2.173910714
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000614113.4; ENST00000393467.1; ENST00000341049.7; ENST00000405348.5; ENST00000489856.1; ENST00000393470.1; ENST00000456473.5; ENST00000451122.5; ENST00000393468.1
External Link	RMBase: m6A_site_773660
mod ID: M6ASITE081891		Click to Show/Hide the Full List
mod site	chr7:116526627-116526628:+		[9]
Sequence	GAAGCAAGTGTACGACGCGCACACCAAGGAGATCGACCTGG
Motif Score	2.830589286
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000393470.1; ENST00000614113.4; ENST00000489856.1; ENST00000451122.5; ENST00000393467.1; ENST00000456473.5; ENST00000393468.1; ENST00000341049.7; ENST00000405348.5
External Link	RMBase: m6A_site_773661
mod ID: M6ASITE081892		Click to Show/Hide the Full List
mod site	chr7:116526664-116526665:+		[6]
Sequence	CTGGTCAACCGCGACCCTAAACACCTCAACGATGACGTGGT
Motif Score	2.20572619
Cell/Tissue List	HeLa; A549; hESC-HEK293T; MT4; GSC-11; TIME; iSLK; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq; MAZTER-seq
Transcript ID List	ENST00000489856.1; ENST00000456473.5; ENST00000614113.4; ENST00000393468.1; ENST00000451122.5; ENST00000393467.1; ENST00000341049.7; ENST00000405348.5; ENST00000393470.1
External Link	RMBase: m6A_site_773662
mod ID: M6ASITE081893		Click to Show/Hide the Full List
mod site	chr7:116526722-116526723:+		[6]
Sequence	ACCAACAGGGAAGGGCTGGGACAGCTCTCCTCTGGCAGTTA
Motif Score	3.643047619
Cell/Tissue List	HeLa; A549; MT4; iSLK; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000489856.1; ENST00000341049.7; ENST00000393470.1; ENST00000456473.5; ENST00000614113.4; ENST00000393468.1; ENST00000405348.5; ENST00000451122.5; ENST00000393467.1
External Link	RMBase: m6A_site_773663
mod ID: M6ASITE081894		Click to Show/Hide the Full List
mod site	chr7:116558949-116558950:+		[10]
Sequence	CACTTCTTCCTTTTAGATTGACTTTGAAGATGTGATTGCAG
Motif Score	3.28175
Cell/Tissue List	A549
Seq Type List	m6A-CLIP/IP
Transcript ID List	ENST00000456473.5; ENST00000451122.5; ENST00000393470.1; ENST00000393468.1; ENST00000405348.5; ENST00000341049.7; ENST00000614113.4; ENST00000393467.1
External Link	RMBase: m6A_site_773664
mod ID: M6ASITE081895		Click to Show/Hide the Full List
mod site	chr7:116558971-116558972:+		[6]
Sequence	TTTGAAGATGTGATTGCAGAACCAGAAGGGACACACAGTTT
Motif Score	2.930744048
Cell/Tissue List	HeLa; A549; HepG2; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000405348.5; ENST00000393467.1; ENST00000393470.1; ENST00000614113.4; ENST00000341049.7; ENST00000393468.1; ENST00000456473.5; ENST00000451122.5
External Link	RMBase: m6A_site_773665
mod ID: M6ASITE081896		Click to Show/Hide the Full List
mod site	chr7:116558981-116558982:+		[6]
Sequence	TGATTGCAGAACCAGAAGGGACACACAGTTTTGACGGCATT
Motif Score	3.643047619
Cell/Tissue List	HeLa; A549; hESC-HEK293T; HepG2; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq; MAZTER-seq
Transcript ID List	ENST00000614113.4; ENST00000451122.5; ENST00000393470.1; ENST00000405348.5; ENST00000341049.7; ENST00000393468.1; ENST00000393467.1; ENST00000456473.5
External Link	RMBase: m6A_site_773666
mod ID: M6ASITE081897		Click to Show/Hide the Full List
mod site	chr7:116559126-116559127:+		[9]
Sequence	CGCCATTCTCTCTTTCCTGCACATCTGGGCAGTTGTACCAT
Motif Score	2.830589286
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000614113.4; ENST00000393467.1; ENST00000451122.5; ENST00000456473.5; ENST00000405348.5; ENST00000393468.1; ENST00000341049.7; ENST00000393470.1
External Link	RMBase: m6A_site_773667
mod ID: M6ASITE081898		Click to Show/Hide the Full List
mod site	chr7:116559207-116559208:+		[9]
Sequence	TGTCTATTCCATCTACGTCCACACCGTCTGTGACCCACTCT
Motif Score	2.053113095
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000451122.5; ENST00000393467.1; ENST00000393468.1; ENST00000456473.5; ENST00000341049.7; ENST00000405348.5; ENST00000614113.4; ENST00000393470.1
External Link	RMBase: m6A_site_773668
mod ID: M6ASITE081899		Click to Show/Hide the Full List
mod site	chr7:116559267-116559268:+		[10]
Sequence	ATTCAGCAATGTCCGCATCAACTTGCAGAAAGAAATATAAA
Motif Score	2.595904762
Cell/Tissue List	A549
Seq Type List	m6A-CLIP/IP
Transcript ID List	ENST00000341049.7; ENST00000405348.5; ENST00000393470.1; ENST00000393468.1; ENST00000393467.1; ENST00000614113.4; ENST00000451122.5
External Link	RMBase: m6A_site_773669
mod ID: M6ASITE081900		Click to Show/Hide the Full List
mod site	chr7:116559290-116559291:+		[11]
Sequence	TGCAGAAAGAAATATAAATGACATTTCAAGGATAGAAGTAT
Motif Score	2.859755952
Cell/Tissue List	kidney; hESC-HEK293T; A549
Seq Type List	m6A-REF-seq; MAZTER-seq; m6A-CLIP/IP
Transcript ID List	ENST00000393468.1; ENST00000451122.5; ENST00000405348.5; ENST00000393467.1; ENST00000341049.7; ENST00000614113.4; ENST00000393470.1
External Link	RMBase: m6A_site_773670
mod ID: M6ASITE081901		Click to Show/Hide the Full List
mod site	chr7:116559493-116559494:+		[6]
Sequence	TGGCAGTCTGAATTTTTAAAACCCATTTAAATTTTTTTCCT
Motif Score	2.185083333
Cell/Tissue List	HeLa; HEK293T; U2OS; fibroblasts; A549
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000405348.5; ENST00000614113.4; ENST00000451122.5; ENST00000341049.7; ENST00000393467.1; ENST00000393468.1
External Link	RMBase: m6A_site_773671
mod ID: M6ASITE081902		Click to Show/Hide the Full List
mod site	chr7:116559566-116559567:+		[6]
Sequence	CTTTATTGGCTGAGATATGAACATATTGTTGAAAGGTAATT
Motif Score	2.951386905
Cell/Tissue List	HeLa; HEK293T; hESC-HEK293T; U2OS; fibroblasts; A549; H1299; iSLK; MSC; TIME; TREX; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq; MAZTER-seq; m6A-CLIP/IP
Transcript ID List	ENST00000405348.5; ENST00000451122.5; ENST00000614113.4; ENST00000393467.1; ENST00000341049.7
External Link	RMBase: m6A_site_773672
mod ID: M6ASITE081903		Click to Show/Hide the Full List
mod site	chr7:116559604-116559605:+		[6]
Sequence	ATTTGAGAGAAATATGAAGAACTGAGGAGGAAAAAAAAAAA
Motif Score	3.373380952
Cell/Tissue List	HeLa; HEK293T; HepG2; U2OS; fibroblasts; A549; H1299; Huh7; iSLK; MSC; TIME; TREX; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000614113.4; ENST00000405348.5; ENST00000451122.5; ENST00000341049.7; ENST00000393467.1
External Link	RMBase: m6A_site_773673
mod ID: M6ASITE081904		Click to Show/Hide the Full List
mod site	chr7:116559635-116559636:+		[6]
Sequence	AAAAAAAAAAAAAGAAAAGAACCAACAACCTCAACTGCCTA
Motif Score	2.930744048
Cell/Tissue List	HeLa; HEK293T; A549; HepG2; U2OS; fibroblasts; H1299; Huh7; iSLK; MSC; TIME; TREX; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000405348.5; ENST00000451122.5; ENST00000341049.7; rmsk_2348597; ENST00000393467.1; ENST00000614113.4
External Link	RMBase: m6A_site_773674
mod ID: M6ASITE081905		Click to Show/Hide the Full List
mod site	chr7:116559743-116559744:+		[6]
Sequence	TGTGGGCAGATTTTCAGCAAACTCTTTTCCCACTGTTTAAG
Motif Score	2.627720238
Cell/Tissue List	HeLa; HEK293T; A549; HepG2; U2OS; H1299; Huh7; iSLK; MSC; TIME; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000405348.5; ENST00000614113.4; ENST00000393467.1; ENST00000341049.7
External Link	RMBase: m6A_site_773675
mod ID: M6ASITE081906		Click to Show/Hide the Full List
mod site	chr7:116559831-116559832:+		[6]
Sequence	TGATCCTTACAAGTTAGAAAACATAATCTTCTGCCTTCTCA
Motif Score	2.20572619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000405348.5; ENST00000393467.1; ENST00000614113.4; ENST00000341049.7
External Link	RMBase: m6A_site_773676
mod ID: M6ASITE081907		Click to Show/Hide the Full List
mod site	chr7:116559935-116559936:+		[6]
Sequence	TTTGTTATGTAGATAACAAGACCTCAGTGCCTTCCTGTTTT
Motif Score	2.876744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000341049.7; ENST00000393467.1; ENST00000614113.4; ENST00000405348.5
External Link	RMBase: m6A_site_773677
mod ID: M6ASITE081908		Click to Show/Hide the Full List
mod site	chr7:116560176-116560177:+		[10]
Sequence	AATGAAATGAATTAAAGTGGACCAATAGGGCTGAGCTCTCT
Motif Score	3.622404762
Cell/Tissue List	A549
Seq Type List	m6A-CLIP/IP
Transcript ID List	ENST00000405348.5; ENST00000341049.7; ENST00000614113.4; ENST00000393467.1
External Link	RMBase: m6A_site_773678
mod ID: M6ASITE081909		Click to Show/Hide the Full List
mod site	chr7:116560311-116560312:+		[12]
Sequence	TCACGCTTTCCTGAATCCAAACTAATCCATCACCGGGGTGG
Motif Score	2.627720238
Cell/Tissue List	HepG2; HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000405348.5; ENST00000393467.1; ENST00000341049.7; ENST00000614113.4
External Link	RMBase: m6A_site_773679
mod ID: M6ASITE081910		Click to Show/Hide the Full List
mod site	chr7:116560435-116560436:+		[13]
Sequence	GCCTATCAGAGTTGCTGCAAACCTGACCCCTGCTCAGTAAA
Motif Score	2.185083333
Cell/Tissue List	HeLa; A549; endometrial; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000341049.7; ENST00000614113.4; ENST00000405348.5; ENST00000393467.1
External Link	RMBase: m6A_site_773680
mod ID: M6ASITE081911		Click to Show/Hide the Full List
mod site	chr7:116560516-116560517:+		[6]
Sequence	CCCCCTGCCAGGAGCTTTGGACCTAATCCAAGCATCCCTTT
Motif Score	3.622404762
Cell/Tissue List	HeLa; HEK293T; A549; HepG2; fibroblasts; H1299; HEK293A-TOA; TIME; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000614113.4; ENST00000405348.5; ENST00000393467.1; ENST00000341049.7
External Link	RMBase: m6A_site_773681
mod ID: M6ASITE081912		Click to Show/Hide the Full List
mod site	chr7:116560615-116560616:+		[6]
Sequence	ATAAGTTCAAATTCTTCTGAACTCAAACTGAGGAATTTCAC
Motif Score	3.373380952
Cell/Tissue List	HeLa; HEK293T; A549; HepG2; fibroblasts; H1299; HEK293A-TOA; TIME; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000393467.1; ENST00000341049.7; ENST00000405348.5; ENST00000614113.4
External Link	RMBase: m6A_site_773682
mod ID: M6ASITE081913		Click to Show/Hide the Full List
mod site	chr7:116560621-116560622:+		[6]
Sequence	TCAAATTCTTCTGAACTCAAACTGAGGAATTTCACCTGTAA
Motif Score	2.627720238
Cell/Tissue List	HeLa; HEK293T; A549; HepG2; fibroblasts; H1299; HEK293A-TOA; TIME; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List	ENST00000405348.5; ENST00000614113.4; ENST00000393467.1; ENST00000341049.7
External Link	RMBase: m6A_site_773683
mod ID: M6ASITE081914		Click to Show/Hide the Full List
mod site	chr7:116560642-116560643:+		[6]
Sequence	CTGAGGAATTTCACCTGTAAACCTGAGTCGTACAGAAAGCT
Motif Score	2.185083333
Cell/Tissue List	HeLa; HEK293T; A549; HepG2; fibroblasts; H1299; HEK293A-TOA; TIME; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000405348.5; ENST00000341049.7; ENST00000393467.1; ENST00000614113.4
External Link	RMBase: m6A_site_773684
mod ID: M6ASITE081915		Click to Show/Hide the Full List
mod site	chr7:116560723-116560724:+		[6]
Sequence	TTGTGATTCTGCCTTTGGGGACTTTTCTTAAACCTTCAGTT
Motif Score	4.065041667
Cell/Tissue List	HeLa; HEK293T; A549; HepG2; fibroblasts; HEK293A-TOA; iSLK; TIME
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List	ENST00000393467.1; ENST00000341049.7; ENST00000614113.4; ENST00000405348.5
External Link	RMBase: m6A_site_773685
mod ID: M6ASITE081916		Click to Show/Hide the Full List
mod site	chr7:116560734-116560735:+		[6]
Sequence	CCTTTGGGGACTTTTCTTAAACCTTCAGTTATGATTTTTTT
Motif Score	2.185083333
Cell/Tissue List	HeLa; HEK293T; HepG2; fibroblasts; A549; HEK293A-TOA; iSLK; TIME
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000405348.5; ENST00000341049.7; ENST00000614113.4; ENST00000393467.1
External Link	RMBase: m6A_site_773686
mod ID: M6ASITE081917		Click to Show/Hide the Full List
mod site	chr7:116560772-116560773:+		[6]
Sequence	TTTTTCATACACTTATTGGAACTCTGCTTGATTTTTGCCTC
Motif Score	3.373380952
Cell/Tissue List	HeLa; HEK293T; HepG2; fibroblasts; A549; HEK293A-TOA; iSLK; TIME
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List	ENST00000341049.7; ENST00000405348.5; ENST00000393467.1; ENST00000614113.4
External Link	RMBase: m6A_site_773687
mod ID: M6ASITE081918		Click to Show/Hide the Full List
mod site	chr7:116560855-116560856:+		[6]
Sequence	TTTGACTTTTTGCATTTAAAACAGACACTGGCATGGATATA
Motif Score	2.20572619
Cell/Tissue List	HeLa; A549; HEK293A-TOA; iSLK
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000614113.4; ENST00000341049.7; ENST00000393467.1; ENST00000405348.5
External Link	RMBase: m6A_site_773688
mod ID: M6ASITE081919		Click to Show/Hide the Full List
mod site	chr7:116560889-116560890:+		[8]
Sequence	GGATATAGTTTTACTTTTAAACTGTGTACATAACTGAAAAT
Motif Score	2.627720238
Cell/Tissue List	HeLa; A549; iSLK
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000405348.5; ENST00000393467.1; ENST00000341049.7; ENST00000614113.4
External Link	RMBase: m6A_site_773689
mod ID: M6ASITE081920		Click to Show/Hide the Full List
mod site	chr7:116560896-116560897:+		[9]
Sequence	GTTTTACTTTTAAACTGTGTACATAACTGAAAATGTGCTAT
Motif Score	2.856142857
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000614113.4; ENST00000341049.7; ENST00000405348.5; ENST00000393467.1
External Link	RMBase: m6A_site_773690
mod ID: M6ASITE081921		Click to Show/Hide the Full List
mod site	chr7:116561002-116561003:+		[6]
Sequence	CTTTGTGATTCAATCTGTAAACTGTGTATTCCAAGACATGT
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000405348.5; ENST00000393467.1; ENST00000341049.7; ENST00000614113.4
External Link	RMBase: m6A_site_773691
mod ID: M6ASITE081922		Click to Show/Hide the Full List
mod site	chr7:116561017-116561018:+		[6]
Sequence	TGTAAACTGTGTATTCCAAGACATGTCTGTTCTACATAGAT
Motif Score	2.897386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000405348.5; ENST00000614113.4; ENST00000393467.1; ENST00000341049.7
External Link	RMBase: m6A_site_773692
mod ID: M6ASITE081923		Click to Show/Hide the Full List
mod site	chr7:116561030-116561031:+		[9]
Sequence	TTCCAAGACATGTCTGTTCTACATAGATGCTTAGTCCCTCA
Motif Score	2.078666667
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000393467.1; ENST00000614113.4; ENST00000341049.7; ENST00000405348.5
External Link	RMBase: m6A_site_773693
mod ID: M6ASITE081924		Click to Show/Hide the Full List
mod site	chr7:116561111-116561112:+		[9]
Sequence	TATGCTTACTGATATATTTTACAATTTTTTATCATGCATGT
Motif Score	2.07285119
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000341049.7; ENST00000405348.5; ENST00000393467.1; ENST00000614113.4
External Link	RMBase: m6A_site_773694
mod ID: M6ASITE081925		Click to Show/Hide the Full List
mod site	chr7:116561178-116561179:+		[6]
Sequence	TAAAAATGTTTAACGGTTAAACAGTCAGCTTTATTATTTTT
Motif Score	2.20572619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000341049.7; ENST00000614113.4; ENST00000405348.5
External Link	RMBase: m6A_site_773695

Ref 1	N6-methyladenosine demethylase FTO promotes growth and metastasis of gastric cancer via m(6)A modification of caveolin-1 and metabolic regulation of mitochondrial dynamics. Cell Death Dis. 2022 Jan 21;13(1):72. doi: 10.1038/s41419-022-04503-7.
Ref 2	WTAP facilitates progression of endometrial cancer via CAV-1/NF-KappaB axis. Cell Biol Int. 2021 Jun;45(6):1269-1277. doi: 10.1002/cbin.11570. Epub 2021 Feb 19.
Ref 3	Oral Bioavailability and Disposition of Phytochemicals
Ref 4	RADAR: a rigorously annotated database of A-to-I RNA editing. Nucleic Acids Res. 2014 Jan;42(Database issue):D109-13. doi: 10.1093/nar/gkt996. Epub 2013 Oct 25.
Ref 5	Perturbation of m6A writers reveals two distinct classes of mRNA methylation at internal and 5' sites. Cell Rep. 2014 Jul 10;8(1):284-96. doi: 10.1016/j.celrep.2014.05.048. Epub 2014 Jun 26.
Ref 6	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 7	Dynamics of the human and viral m(6)A RNA methylomes during HIV-1 infection of T cells. Nat Microbiol. 2016 Feb 22;1:16011. doi: 10.1038/nmicrobiol.2016.11.
Ref 8	Viral N(6)-methyladenosine upregulates replication and pathogenesis of human respiratory syncytial virus. Nat Commun. 2019 Oct 9;10(1):4595. doi: 10.1038/s41467-019-12504-y.
Ref 9	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.
Ref 10	A majority of m6A residues are in the last exons, allowing the potential for 3' UTR regulation. Genes Dev. 2015 Oct 1;29(19):2037-53. doi: 10.1101/gad.269415.115. Epub 2015 Sep 24.
Ref 11	Single-base mapping of m(6)A by an antibody-independent method. Sci Adv. 2019 Jul 3;5(7):eaax0250. doi: 10.1126/sciadv.aax0250. eCollection 2019 Jul.
Ref 12	Topology of the human and mouse m6A RNA methylomes revealed by m6A-seq. Nature. 2012 Apr 29;485(7397):201-6. doi: 10.1038/nature11112.
Ref 13	N6-methyladenosine-dependent regulation of messenger RNA stability. Nature. 2014 Jan 2;505(7481):117-20. doi: 10.1038/nature12730. Epub 2013 Nov 27.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map