m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00675)

Target Name	LINC00035 (ABHD11-AS1)
Synonyms	NCRNA00035; non-protein coding RNA 35WBSCR26; LINC00035; ABHD11-AS1 Click to Show/Hide
Gene Name	ABHD11-AS1
Chromosomal Location	7q11.23
Gene ID	171022
HGNC ID	HGNC:18289

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

ABHD11-AS1 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Methyltransferase-like 3 (METTL3) [WRITER]

Regulator Info

*Representative RIP-seq result supporting the interaction between ABHD11-AS1 and the regulator*
Cell Line	MDA-MB-231	Homo sapiens
Regulation	logFC: 5.94E+00	GSE60213

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	LINC00035 (ABHD11-AS1) was upregulated in NSCLC tissue specimens and cells and the ectopic overexpression was closely correlated with unfavorable prognosis of NSCLC patients.METTL3 installed the m6 A modification and enhanced ABHD11-AS1 transcript stability to increase its expression.
Target Regulation	Up regulation
Responsed Disease	Non-small-cell lung carcinoma		ICD-11: 2C25.Y	Disease Info
Pathway Response	Central carbon metabolism in cancer			hsa05230
In-vitro Model	NCI-H1650	Minimally invasive lung adenocarcinoma	Homo sapiens	CVCL_1483
	NCI-H1299	Lung large cell carcinoma	Homo sapiens	CVCL_0060
	HCC827	Lung adenocarcinoma	Homo sapiens	CVCL_2063
	BEAS-2B	Normal	Homo sapiens	CVCL_0168
	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
In-vivo Model	H1299 cells were transfected with sh-ABHD11-AS1 and harvested from six-well plates, then resuspended at a density 1 × 10⁷ cells/ml. Mice were subsequently injected with 100 uL suspension at the right flank. After injection, tumor weight and length were examined every 3 days.

Lung cancer [ICD-11: 2C25]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	LINC00035 (ABHD11-AS1) was upregulated in NSCLC tissue specimens and cells and the ectopic overexpression was closely correlated with unfavorable prognosis of NSCLC patients.METTL3 installed the m6 A modification and enhanced ABHD11-AS1 transcript stability to increase its expression.
Responsed Disease	Non-small-cell lung carcinoma [ICD-11: 2C25.Y]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Pathway Response	Central carbon metabolism in cancer			hsa05230
In-vitro Model	NCI-H1650	Minimally invasive lung adenocarcinoma	Homo sapiens	CVCL_1483
	NCI-H1299	Lung large cell carcinoma	Homo sapiens	CVCL_0060
	HCC827	Lung adenocarcinoma	Homo sapiens	CVCL_2063
	BEAS-2B	Normal	Homo sapiens	CVCL_0168
	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
In-vivo Model	H1299 cells were transfected with sh-ABHD11-AS1 and harvested from six-well plates, then resuspended at a density 1 × 10⁷ cells/ml. Mice were subsequently injected with 100 uL suspension at the right flank. After injection, tumor weight and length were examined every 3 days.

Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator

Non-coding RNA

m6A Regulator: Methyltransferase-like 3 (METTL3)

Regulator Info

In total 3 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05026		Crosstalk Info
Epigenetic Regulator	LINC00035 (ABHD11-AS1)
Regulated Target	Insulin like growth factor 2 mRNA binding protein 2 (IGF2BP2)
Crosstalk relationship	m6A → ncRNA
Disease	Colorectal cancer	Disease Info
Crosstalk ID: M6ACROT05618		Crosstalk Info
Epigenetic Regulator	LINC00035 (ABHD11-AS1)
Regulated Target	Krueppel-like factor 4 (KLF4)
Crosstalk relationship	m6A → ncRNA
Disease	Non-small cell lung cancer	Disease Info
Crosstalk ID: M6ACROT05690		Crosstalk Info
Epigenetic Regulator	LINC00035 (ABHD11-AS1)
Regulated Target	hsa-miR-1301-3p
Crosstalk relationship	m6A → ncRNA
Disease	Acute ischemic stroke	Disease Info

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00675)

LINC00035 (ABHD11-AS1)

N6-methyladenosine (m6A)

In total 13 m6A sequence/site(s) in this target gene
mod ID: M6ASITE080450		Click to Show/Hide the Full List
mod site	chr7:73735249-73735250:+		[4]
Sequence	CCTTTCCATAGGTCCATGAGACTGGGGCAGCAGCAGGGGCA
Motif Score	3.319380952
Cell/Tissue List	peripheral-blood; endometrial; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000427153.2
External Link	RMBase: m6A_site_760872
mod ID: M6ASITE080451		Click to Show/Hide the Full List
mod site	chr7:73735348-73735349:+		[4]
Sequence	GCGGGAGGGCCCAGAGTGAGACACCTCTTCCAGACAAGACT
Motif Score	2.897386905
Cell/Tissue List	peripheral-blood; endometrial; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000427153.2
External Link	RMBase: m6A_site_760873
mod ID: M6ASITE080452		Click to Show/Hide the Full List
mod site	chr7:73735361-73735362:+		[4]
Sequence	GAGTGAGACACCTCTTCCAGACAAGACTTGGTCGCTGCCTC
Motif Score	2.897386905
Cell/Tissue List	peripheral-blood; endometrial; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000427153.2
External Link	RMBase: m6A_site_760874
mod ID: M6ASITE080453		Click to Show/Hide the Full List
mod site	chr7:73735366-73735367:+		[4]
Sequence	AGACACCTCTTCCAGACAAGACTTGGTCGCTGCCTCCTCCT
Motif Score	3.319380952
Cell/Tissue List	peripheral-blood; endometrial; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000427153.2
External Link	RMBase: m6A_site_760875
mod ID: M6ASITE080454		Click to Show/Hide the Full List
mod site	chr7:73735438-73735439:+		[5]
Sequence	GGCGGCTGGAGCACTGGGGGACACCCGGACAGAACCCTCCC
Motif Score	3.643047619
Cell/Tissue List	endometrial; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000427153.2; ENST00000641969.1
External Link	RMBase: m6A_site_760876
mod ID: M6ASITE080455		Click to Show/Hide the Full List
mod site	chr7:73735446-73735447:+		[5]
Sequence	GAGCACTGGGGGACACCCGGACAGAACCCTCCCTGGACCAA
Motif Score	3.643047619
Cell/Tissue List	endometrial; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000427153.2; ENST00000641969.1
External Link	RMBase: m6A_site_760877
mod ID: M6ASITE080456		Click to Show/Hide the Full List
mod site	chr7:73735451-73735452:+		[5]
Sequence	CTGGGGGACACCCGGACAGAACCCTCCCTGGACCAAGTCCT
Motif Score	2.930744048
Cell/Tissue List	endometrial; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000641969.1; ENST00000427153.2
External Link	RMBase: m6A_site_760878
mod ID: M6ASITE080457		Click to Show/Hide the Full List
mod site	chr7:73735462-73735463:+		[5]
Sequence	CCGGACAGAACCCTCCCTGGACCAAGTCCTCCAGGAACGGG
Motif Score	3.622404762
Cell/Tissue List	endometrial; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000641969.1; ENST00000427153.2
External Link	RMBase: m6A_site_760879
mod ID: M6ASITE080458		Click to Show/Hide the Full List
mod site	chr7:73735814-73735815:+		[6]
Sequence	CTGGAGGTCCTGGAGGAGAAACTGAGGCTGAGGCGGGAGCT
Motif Score	2.627720238
Cell/Tissue List	HeLa; endometrial; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000427153.2; ENST00000641969.1
External Link	RMBase: m6A_site_760880
mod ID: M6ASITE080459		Click to Show/Hide the Full List
mod site	chr7:73736011-73736012:+		[6]
Sequence	TACTCGGGGAGCCCACGTGGACCCTGGAGCTGCCAGCACCC
Motif Score	3.622404762
Cell/Tissue List	HeLa; endometrial; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000641969.1; ENST00000427153.2
External Link	RMBase: m6A_site_760881
mod ID: M6ASITE080460		Click to Show/Hide the Full List
mod site	chr7:73736078-73736079:+		[6]
Sequence	GGACGTTGGTGGTGACACAGACCTCAGCCCAGGACTTTGGG
Motif Score	2.876744048
Cell/Tissue List	HeLa; HepG2; A549; HEK293T; H1A; H1B; hESCs; GM12878; MM6; Huh7; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000427153.2
External Link	RMBase: m6A_site_760882
mod ID: M6ASITE080461		Click to Show/Hide the Full List
mod site	chr7:73736091-73736092:+		[6]
Sequence	GACACAGACCTCAGCCCAGGACTTTGGGAGTAGTGTCTTTA
Motif Score	4.065041667
Cell/Tissue List	HeLa; HepG2; A549; HEK293T; H1A; H1B; hESCs; GM12878; MM6; Huh7; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000427153.2
External Link	RMBase: m6A_site_760883
mod ID: M6ASITE080462		Click to Show/Hide the Full List
mod site	chr7:73736147-73736148:+		[6]
Sequence	GGTCTGACCACCCCTGTAAAACCTCGTGCCCACACAGTGCC
Motif Score	2.185083333
Cell/Tissue List	HeLa; HepG2; A549; HEK293T; H1A; H1B; hESCs; GM12878; MM6; Huh7; Jurkat; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000427153.2
External Link	RMBase: m6A_site_760886

Ref 1	m(6) A transferase METTL3-induced lncRNA ABHD11-AS1 promotes the Warburg effect of non-small-cell lung cancer. J Cell Physiol. 2021 Apr;236(4):2649-2658. doi: 10.1002/jcp.30023. Epub 2020 Sep 6.
Ref 2	A phase 1 dose escalation study of BI 831266, an inhibitor of Aurora kinase B, in patients with advanced solid tumors. Invest New Drugs. 2015 Apr;33(2):409-22. doi: 10.1007/s10637-014-0201-7. Epub 2014 Dec 23.
Ref 3	INGN-225: a dendritic cell-based p53 vaccine (Ad.p53-DC) in small cell lung cancer: observed association between immune response and enhanced chemotherapy effect. Expert Opin Biol Ther. 2010 Jun;10(6):983-91. doi: 10.1517/14712598.2010.484801.
Ref 4	R-2HG Exhibits Anti-tumor Activity by Targeting FTO/m(6)A/MYC/CEBPA Signaling. Cell. 2018 Jan 11;172(1-2):90-105.e23. doi: 10.1016/j.cell.2017.11.031. Epub 2017 Dec 14.
Ref 5	m(6)A mRNA methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer. Nat Cell Biol. 2018 Sep;20(9):1074-1083. doi: 10.1038/s41556-018-0174-4. Epub 2018 Aug 27.
Ref 6	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map