General Information of the m6A Target Gene (ID: M6ATAR00671)
Target Name TNF receptor-associated factor 5 (TRAF5)
Synonyms
RING finger protein 84
    Click to Show/Hide
Gene Name TRAF5
Chromosomal Location 1q32.3
Family TNF receptor-associated factor family, A subfamily
Function
Adapter protein and signal transducer that links members of the tumor necrosis factor receptor family to different signaling pathways by association with the receptor cytoplasmic domain and kinases. Mediates activation of NF-kappa-B and probably JNK. Seems to be involved in apoptosis. Plays a role in mediating activation of NF-kappa-B by EIF2AK2/PKR.
    Click to Show/Hide
Gene ID 7188
Uniprot ID
TRAF5_HUMAN
HGNC ID
HGNC:12035
KEGG ID
hsa:7188
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
TRAF5 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Browse Drug
Methyltransferase-like 3 (METTL3) [WRITER]
Representative RNA-seq result indicating the expression of this target gene regulated by METTL3
Cell Line LX2 cell line Homo sapiens
Treatment: shMETTL3 LX2 cells
Control: shLuc LX2 cells
GSE207909
Regulation
logFC: -7.59E-01
p-value: 1.50E-05
More Results Click to View More RNA-seq Results
Representative RIP-seq result supporting the interaction between TRAF5 and the regulator
Cell Line MDA-MB-231 Homo sapiens
Regulation logFC: 2.24E+00 GSE60213
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary 2-polarized tumor-associated macrophages enabled the oxaliplatin resistance via the elevation of METTL3-mediated m6A modification in Colorectal Cancer cells. Furthermore, they found that TNF receptor-associated factor 5 (TRAF5) contributes to the METTL3-triggered OX resistance in CRC cells.
Target Regulation Down regulation
Responsed Disease Colorectal cancer ICD-11: 2B91
Responsed Drug Oxaliplatin Approved
In-vitro Model LoVo Colon adenocarcinoma Homo sapiens CVCL_0399
HCT 116 Colon carcinoma Homo sapiens CVCL_0291
In-vivo Model HCT-116 cells (3 × 105 cells in 200 uL of saline) were subcutaneously injected into the nude mice to establish xenograft tumors. After 10 days, 10 mg/kg OX or saline was intraperitoneally injected (n = 5 for each group). Si-METTL3 or si-TRAF5 (10 nmol/20 g body weight) was injected twice intratumorally before the start of OX treatment. The mice were examined every 2 days and sacrificed 4 weeks after the OX treatment.
Colorectal cancer [ICD-11: 2B91]
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [1]
Response Summary 2-polarized tumor-associated macrophages enabled the oxaliplatin resistance via the elevation of METTL3-mediated m6A modification in Colorectal Cancer cells. Furthermore, they found that TNF receptor-associated factor 5 (TRAF5) contributes to the METTL3-triggered OX resistance in CRC cells.
Responsed Disease Colorectal cancer [ICD-11: 2B91]
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
Target Regulation Down regulation
Responsed Drug Oxaliplatin Approved
In-vitro Model LoVo Colon adenocarcinoma Homo sapiens CVCL_0399
HCT 116 Colon carcinoma Homo sapiens CVCL_0291
In-vivo Model HCT-116 cells (3 × 105 cells in 200 uL of saline) were subcutaneously injected into the nude mice to establish xenograft tumors. After 10 days, 10 mg/kg OX or saline was intraperitoneally injected (n = 5 for each group). Si-METTL3 or si-TRAF5 (10 nmol/20 g body weight) was injected twice intratumorally before the start of OX treatment. The mice were examined every 2 days and sacrificed 4 weeks after the OX treatment.
Oxaliplatin [Approved]
In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response [1]
Response Summary 2-polarized tumor-associated macrophages enabled the oxaliplatin resistance via the elevation of METTL3-mediated m6A modification in Colorectal Cancer cells. Furthermore, they found that TNF receptor-associated factor 5 (TRAF5) contributes to the METTL3-triggered OX resistance in CRC cells.
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
Target Regulation Down regulation
Responsed Disease Colorectal cancer ICD-11: 2B91
In-vitro Model LoVo Colon adenocarcinoma Homo sapiens CVCL_0399
HCT 116 Colon carcinoma Homo sapiens CVCL_0291
In-vivo Model HCT-116 cells (3 × 105 cells in 200 uL of saline) were subcutaneously injected into the nude mice to establish xenograft tumors. After 10 days, 10 mg/kg OX or saline was intraperitoneally injected (n = 5 for each group). Si-METTL3 or si-TRAF5 (10 nmol/20 g body weight) was injected twice intratumorally before the start of OX treatment. The mice were examined every 2 days and sacrificed 4 weeks after the OX treatment.
Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator
Histone modification
m6A Regulator: Methyltransferase-like 3 (METTL3)
In total 2 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03576
Epigenetic Regulator Histone acetyltransferase p300 (P300)
Regulated Target Histone H3 lysine 27 acetylation (H3K27ac)
Crosstalk relationship Histone modification → m6A
Disease Colorectal cancer
Drug Oxaliplatin
Crosstalk ID: M6ACROT03621
Epigenetic Regulator N-lysine methyltransferase SMYD2 (SMYD2)
Regulated Target Histone H3 lysine 4 trimethylation (H3K4me3)
Crosstalk relationship Histone modification → m6A
Disease Colorectal cancer
Drug Oxaliplatin
Non-coding RNA
m6A Regulator: Insulin-like growth factor 2 mRNA-binding protein 3 (IGF2BP3)
In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05006
Epigenetic Regulator Long intergenic non-protein coding RNA 467 (LINC00467)
Regulated Target Insulin like growth factor 2 mRNA binding protein 3 (IGF2BP3)
Crosstalk relationship ncRNA → m6A
Disease Liver cancer
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00671)
TNF receptor-associated factor 5 (TRAF5)
Adenosine-to-Inosine editing (A-to-I)
In total 9 m6A sequence/site(s) in this target gene
mod ID: A2ISITE001896 Click to Show/Hide the Full List
mod site chr1:211359007-211359008:+ [3]
Sequence CTAGGCTGGAGCGCAGTGGCACAATCATAGCTCACTGCAGC
Transcript ID List ENST00000336184.6; ENST00000261464.10; ENST00000367004.3; ENST00000488428.1; ENST00000462410.5
External Link RMBase: RNA-editing_site_12123
mod ID: A2ISITE001898 Click to Show/Hide the Full List
mod site chr1:211359190-211359191:+ [3]
Sequence GGACTTGAGTCCTGGCCTTAAGTGATCCTCCCATCTCAGCC
Transcript ID List ENST00000488428.1; ENST00000367004.3; ENST00000336184.6; ENST00000462410.5; ENST00000261464.10
External Link RMBase: RNA-editing_site_12124
mod ID: A2ISITE001899 Click to Show/Hide the Full List
mod site chr1:211361862-211361863:+ [4]
Sequence CCCGCCATCATGCCTGGCTAATTTTTGTATTTTTAGTAGAG
Transcript ID List ENST00000367004.3; ENST00000336184.6; ENST00000462410.5; ENST00000261464.10
External Link RMBase: RNA-editing_site_12125
mod ID: A2ISITE001900 Click to Show/Hide the Full List
mod site chr1:211363768-211363769:+ [5]
Sequence AAAAAATACAAAAATCAGCCAGGTGTGGTGGCGCACCCTGT
Transcript ID List rmsk_374188; ENST00000367004.3; ENST00000261464.10; ENST00000336184.6; ENST00000462410.5
External Link RMBase: RNA-editing_site_12126
mod ID: A2ISITE001901 Click to Show/Hide the Full List
mod site chr1:211363812-211363813:+ [5]
Sequence CCCAGCTCCTTGGGAGGCTGAGGTGGGAGAATCCCTTGAGC
Transcript ID List ENST00000336184.6; rmsk_374188; ENST00000261464.10; ENST00000462410.5; ENST00000367004.3
External Link RMBase: RNA-editing_site_12127
mod ID: A2ISITE001902 Click to Show/Hide the Full List
mod site chr1:211363821-211363822:+ [5]
Sequence TTGGGAGGCTGAGGTGGGAGAATCCCTTGAGCCAGGGAGGC
Transcript ID List ENST00000462410.5; ENST00000261464.10; rmsk_374188; ENST00000336184.6; ENST00000367004.3
External Link RMBase: RNA-editing_site_12128
mod ID: A2ISITE001903 Click to Show/Hide the Full List
mod site chr1:211364004-211364005:+ [5]
Sequence CCAGTTGGTTTGTATTCTAGAACTTGCCTCAGCACCAGAGC
Transcript ID List ENST00000462410.5; ENST00000261464.10; ENST00000336184.6; ENST00000367004.3
External Link RMBase: RNA-editing_site_12129
mod ID: A2ISITE001904 Click to Show/Hide the Full List
mod site chr1:211373861-211373862:+ [4]
Sequence CCTGCCTCAGCCTCCTGAGTAGCTGGGATTACAGGCGCCCG
Transcript ID List ENST00000261464.10; ENST00000473385.1; ENST00000336184.6
External Link RMBase: RNA-editing_site_12130
mod ID: A2ISITE001905 Click to Show/Hide the Full List
mod site chr1:211374863-211374864:+ [5]
Sequence CATGGTTTGCTTAGGAGTTCAGAGTTCCTTCATCATCGAAA
Transcript ID List ENST00000261464.10; ENST00000336184.6
External Link RMBase: RNA-editing_site_12131
N6-methyladenosine (m6A)
In total 51 m6A sequence/site(s) in this target gene
mod ID: M6ASITE081582 Click to Show/Hide the Full List
mod site chr1:211353366-211353367:+ [6]
Sequence GGAGCGGTTGGAAGAGCGCTACAAATGTGCCTTCTGCCACT
Motif Score 2.078666667
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000261464.10; ENST00000462410.5; ENST00000494355.1; ENST00000367004.3; ENST00000488428.1; ENST00000336184.6
External Link RMBase: m6A_site_77121
mod ID: M6ASITE081583 Click to Show/Hide the Full List
mod site chr1:211354417-211354418:+ [6]
Sequence TTTTTTCTCCAGAGAATTAAACACAGTGCCAATCTGCCCTG
Motif Score 2.20572619
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000367004.3; ENST00000261464.10; ENST00000336184.6; ENST00000462410.5; ENST00000488428.1
External Link RMBase: m6A_site_77122
mod ID: M6ASITE081584 Click to Show/Hide the Full List
mod site chr1:211356910-211356911:+ [7]
Sequence TGTTTCCCAGCAACTGTGGGACCTGGCCTCATGGGGTTTAT
Motif Score 3.622404762
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000462410.5; ENST00000488428.1; ENST00000261464.10; ENST00000367004.3; ENST00000336184.6
External Link RMBase: m6A_site_77123
mod ID: M6ASITE081585 Click to Show/Hide the Full List
mod site chr1:211360747-211360748:+ [6]
Sequence ATACCCAGTATTTTGTCCCAACAATTGTGCGAAGATTATTC
Motif Score 2.173910714
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000367004.3; ENST00000488428.1; ENST00000462410.5; ENST00000336184.6; ENST00000261464.10
External Link RMBase: m6A_site_77124
mod ID: M6ASITE081586 Click to Show/Hide the Full List
mod site chr1:211361095-211361096:+ [8]
Sequence TCCATTTCGTAGGTAGATGAACACCTGGCTGTATGTCCTGA
Motif Score 2.951386905
Cell/Tissue List CD34; hESC-HEK293T
Seq Type List m6A-seq; MAZTER-seq
Transcript ID List ENST00000261464.10; ENST00000462410.5; ENST00000367004.3; ENST00000488428.1; ENST00000336184.6
External Link RMBase: m6A_site_77125
mod ID: M6ASITE081587 Click to Show/Hide the Full List
mod site chr1:211361127-211361128:+ [7]
Sequence ATGTCCTGAAGCTGAGCAAGACTGTCCTTTTAAGCACTATG
Motif Score 3.319380952
Cell/Tissue List HeLa; CD34
Seq Type List m6A-seq
Transcript ID List ENST00000261464.10; ENST00000367004.3; ENST00000462410.5; ENST00000488428.1; ENST00000336184.6
External Link RMBase: m6A_site_77126
mod ID: M6ASITE081588 Click to Show/Hide the Full List
mod site chr1:211365388-211365389:+ [7]
Sequence ATTGAAGGATAAACGGAGGAACCTGCAGCAACATGAGCATT
Motif Score 2.930744048
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000261464.10; ENST00000336184.6; ENST00000367004.3; ENST00000462410.5
External Link RMBase: m6A_site_77127
mod ID: M6ASITE081589 Click to Show/Hide the Full List
mod site chr1:211365464-211365465:+ [7]
Sequence AAGAATGTCCAATTAGAAGAACAGGTAAATCTTCAAAGGTT
Motif Score 2.951386905
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000336184.6; ENST00000261464.10; ENST00000367004.3; ENST00000462410.5
External Link RMBase: m6A_site_77128
mod ID: M6ASITE081590 Click to Show/Hide the Full List
mod site chr1:211369584-211369585:+ [7]
Sequence AAATGGAAGCTTCCTCCCAAACATCCAGGTAAGAAATGGCC
Motif Score 2.20572619
Cell/Tissue List HeLa; CD34
Seq Type List m6A-seq
Transcript ID List ENST00000367004.3; ENST00000261464.10; ENST00000336184.6; ENST00000473385.1
External Link RMBase: m6A_site_77129
mod ID: M6ASITE081591 Click to Show/Hide the Full List
mod site chr1:211371399-211371400:+ [7]
Sequence CAAAATAAATTTGACCTGAGACCTTTGATGGAAGCAGTTGA
Motif Score 2.876744048
Cell/Tissue List HeLa; CD34; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000336184.6; ENST00000367004.3; ENST00000473385.1; ENST00000261464.10
External Link RMBase: m6A_site_77130
mod ID: M6ASITE081592 Click to Show/Hide the Full List
mod site chr1:211371429-211371430:+ [7]
Sequence GAAGCAGTTGATACAGTGAAACAGAAAATTACCCTGCTAGA
Motif Score 2.20572619
Cell/Tissue List HeLa; CD34; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000261464.10; ENST00000367004.3; ENST00000336184.6; ENST00000473385.1
External Link RMBase: m6A_site_77131
mod ID: M6ASITE081593 Click to Show/Hide the Full List
mod site chr1:211371452-211371453:+ [7]
Sequence GAAAATTACCCTGCTAGAAAACAATGATCAAAGATTAGGTA
Motif Score 2.20572619
Cell/Tissue List HeLa; CD34; HEK293T; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000261464.10; ENST00000336184.6; ENST00000473385.1; ENST00000367004.3
External Link RMBase: m6A_site_77132
mod ID: M6ASITE081594 Click to Show/Hide the Full List
mod site chr1:211372144-211372145:+ [7]
Sequence CAGCCGTTTTAGAAGAGGAAACTAACAAACATGATACCCAC
Motif Score 2.627720238
Cell/Tissue List HeLa; CD34; HEK293T; fibroblasts; LCLs; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000261464.10; ENST00000473385.1; ENST00000367004.3; ENST00000336184.6
External Link RMBase: m6A_site_77133
mod ID: M6ASITE081595 Click to Show/Hide the Full List
mod site chr1:211372152-211372153:+ [7]
Sequence TTAGAAGAGGAAACTAACAAACATGATACCCACATTAATAT
Motif Score 2.20572619
Cell/Tissue List HeLa; CD34; HEK293T; fibroblasts; LCLs; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000336184.6; ENST00000473385.1; ENST00000367004.3; ENST00000261464.10
External Link RMBase: m6A_site_77134
mod ID: M6ASITE081596 Click to Show/Hide the Full List
mod site chr1:211372212-211372213:+ [7]
Sequence AAAAATGAAGAGCGATTTAAACTGCTGGAGGGTACTTGCTA
Motif Score 2.627720238
Cell/Tissue List HeLa; CD34; HEK293T; hNPCs; fibroblasts; LCLs; CD8T; Huh7
Seq Type List m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List ENST00000473385.1; ENST00000261464.10; ENST00000336184.6; ENST00000367004.3
External Link RMBase: m6A_site_77135
mod ID: M6ASITE081597 Click to Show/Hide the Full List
mod site chr1:211372474-211372475:+ [9]
Sequence GGCCATTCAGGCAGAGGGTGACCCTGATGCTTCTGGACCAG
Motif Score 2.839113095
Cell/Tissue List CD8T
Seq Type List m6A-CLIP/IP
Transcript ID List ENST00000367004.3; ENST00000261464.10; ENST00000473385.1; ENST00000336184.6
External Link RMBase: m6A_site_77136
mod ID: M6ASITE081598 Click to Show/Hide the Full List
mod site chr1:211372490-211372491:+ [7]
Sequence GGTGACCCTGATGCTTCTGGACCAGAGTGGCAAAAAGAACA
Motif Score 3.622404762
Cell/Tissue List HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000261464.10; ENST00000367004.3; ENST00000473385.1; ENST00000336184.6
External Link RMBase: m6A_site_77137
mod ID: M6ASITE081599 Click to Show/Hide the Full List
mod site chr1:211372508-211372509:+ [7]
Sequence GGACCAGAGTGGCAAAAAGAACATTATGGAGACCTTCAAAC
Motif Score 2.951386905
Cell/Tissue List HeLa; CD34; HepG2; HEK293T; A549; hESC-HEK293T; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List m6A-seq; MeRIP-seq; MAZTER-seq
Transcript ID List ENST00000367004.3; ENST00000473385.1; ENST00000336184.6; ENST00000261464.10
External Link RMBase: m6A_site_77138
mod ID: M6ASITE081600 Click to Show/Hide the Full List
mod site chr1:211372519-211372520:+ [7]
Sequence GCAAAAAGAACATTATGGAGACCTTCAAACCTGACCCCAAT
Motif Score 2.876744048
Cell/Tissue List HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000336184.6; ENST00000367004.3; ENST00000473385.1; ENST00000261464.10
External Link RMBase: m6A_site_77139
mod ID: M6ASITE081601 Click to Show/Hide the Full List
mod site chr1:211372527-211372528:+ [7]
Sequence AACATTATGGAGACCTTCAAACCTGACCCCAATAGCAGCAG
Motif Score 2.185083333
Cell/Tissue List HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000261464.10; ENST00000473385.1; ENST00000367004.3; ENST00000336184.6
External Link RMBase: m6A_site_77140
mod ID: M6ASITE081602 Click to Show/Hide the Full List
mod site chr1:211372532-211372533:+ [9]
Sequence TATGGAGACCTTCAAACCTGACCCCAATAGCAGCAGCTTTA
Motif Score 2.839113095
Cell/Tissue List CD8T
Seq Type List m6A-CLIP/IP
Transcript ID List ENST00000336184.6; ENST00000261464.10; ENST00000473385.1; ENST00000367004.3
External Link RMBase: m6A_site_77141
mod ID: M6ASITE081603 Click to Show/Hide the Full List
mod site chr1:211372557-211372558:+ [7]
Sequence AATAGCAGCAGCTTTAAAAGACCTGATGGGGAGATGAACAT
Motif Score 2.876744048
Cell/Tissue List HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000261464.10; ENST00000473385.1; ENST00000367004.3; ENST00000336184.6
External Link RMBase: m6A_site_77142
mod ID: M6ASITE081604 Click to Show/Hide the Full List
mod site chr1:211372574-211372575:+ [7]
Sequence AAGACCTGATGGGGAGATGAACATTGCATCTGGCTGTCCCC
Motif Score 2.951386905
Cell/Tissue List HeLa; CD34; HepG2; HEK293T; A549; hESC-HEK293T; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; CD8T; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List m6A-seq; MeRIP-seq; MAZTER-seq; m6A-CLIP/IP
Transcript ID List ENST00000336184.6; ENST00000367004.3; ENST00000473385.1; ENST00000261464.10
External Link RMBase: m6A_site_77143
mod ID: M6ASITE081605 Click to Show/Hide the Full List
mod site chr1:211372631-211372632:+ [9]
Sequence TGTTTTGGAGAATGCCAAGAACGCCTACATTAAAGATGACA
Motif Score 2.925321429
Cell/Tissue List CD8T
Seq Type List m6A-CLIP/IP
Transcript ID List ENST00000261464.10; ENST00000473385.1; ENST00000367004.3; ENST00000336184.6
External Link RMBase: m6A_site_77144
mod ID: M6ASITE081606 Click to Show/Hide the Full List
mod site chr1:211372676-211372677:+ [7]
Sequence GTTCTTGAAAGTGGCCGTGGACTTAACTGACCTGGAGGATC
Motif Score 4.065041667
Cell/Tissue List HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; CD8T; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List ENST00000367004.3; ENST00000261464.10; ENST00000336184.6; ENST00000473385.1
External Link RMBase: m6A_site_77145
mod ID: M6ASITE081607 Click to Show/Hide the Full List
mod site chr1:211372726-211372727:+ [7]
Sequence TGTTATGGGGTGATAAGAGGACTTCTTGGGGCCAGAACTGT
Motif Score 4.065041667
Cell/Tissue List HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; CD8T; MM6; Huh7; Jurkat; CD4T; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4
Seq Type List m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List ENST00000336184.6; ENST00000261464.10; ENST00000473385.1; ENST00000367004.3
External Link RMBase: m6A_site_77146
mod ID: M6ASITE081608 Click to Show/Hide the Full List
mod site chr1:211372742-211372743:+ [7]
Sequence GAGGACTTCTTGGGGCCAGAACTGTGGAGGAGAGCACATTT
Motif Score 3.373380952
Cell/Tissue List HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; CD8T; MM6; Huh7; Jurkat; CD4T; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4
Seq Type List m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List ENST00000367004.3; ENST00000473385.1; ENST00000261464.10; ENST00000336184.6
External Link RMBase: m6A_site_77147
mod ID: M6ASITE081609 Click to Show/Hide the Full List
mod site chr1:211372776-211372777:+ [9]
Sequence CACATTTGATTATCATATTGACCTGGATTTAGACTCAAAGC
Motif Score 2.839113095
Cell/Tissue List CD8T
Seq Type List m6A-CLIP/IP
Transcript ID List ENST00000261464.10; ENST00000367004.3; ENST00000473385.1; ENST00000336184.6
External Link RMBase: m6A_site_77148
mod ID: M6ASITE081610 Click to Show/Hide the Full List
mod site chr1:211372788-211372789:+ [7]
Sequence TCATATTGACCTGGATTTAGACTCAAAGCACATTTGTATTT
Motif Score 3.319380952
Cell/Tissue List HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hESCs; fibroblasts; GM12878; LCLs; MM6; Huh7; Jurkat; CD4T; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000261464.10; ENST00000336184.6; ENST00000367004.3; ENST00000473385.1
External Link RMBase: m6A_site_77149
mod ID: M6ASITE081611 Click to Show/Hide the Full List
mod site chr1:211372842-211372843:+ [7]
Sequence ACGTTTGAAGTCAGTTTAAAACTTCTGAAGTGCTGTCTTTT
Motif Score 2.627720238
Cell/Tissue List HeLa; HepG2; HEK293T; A549; U2OS; H1B; H1A; hESCs; fibroblasts; GM12878; LCLs; Huh7; Jurkat; CD4T; HEK293A-TOA; iSLK; MSC; TIME; TREX
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000336184.6; ENST00000473385.1; ENST00000261464.10
External Link RMBase: m6A_site_77150
mod ID: M6ASITE081612 Click to Show/Hide the Full List
mod site chr1:211372889-211372890:+ [10]
Sequence TTACTCTGTCCCAGTTTGAAACTTAAAACTCTTAGAATATT
Motif Score 2.627720238
Cell/Tissue List A549; GM12878; Huh7
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000261464.10; ENST00000336184.6; ENST00000473385.1
External Link RMBase: m6A_site_77151
mod ID: M6ASITE081613 Click to Show/Hide the Full List
mod site chr1:211372896-211372897:+ [10]
Sequence GTCCCAGTTTGAAACTTAAAACTCTTAGAATATTCTCTTAT
Motif Score 2.627720238
Cell/Tissue List A549; GM12878; Huh7
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000473385.1; ENST00000261464.10; ENST00000336184.6
External Link RMBase: m6A_site_77152
mod ID: M6ASITE081614 Click to Show/Hide the Full List
mod site chr1:211373103-211373104:+ [11]
Sequence GTTTGGCCTATTGATTCTAGACCTGGCCTTAAGTCTGCAAA
Motif Score 2.876744048
Cell/Tissue List HepG2
Seq Type List m6A-seq
Transcript ID List ENST00000336184.6; ENST00000261464.10; ENST00000473385.1
External Link RMBase: m6A_site_77153
mod ID: M6ASITE081619 Click to Show/Hide the Full List
mod site chr1:211373545-211373546:+ [12]
Sequence CTATATATGTGTGTATACAAACAGTTCGAATGTATTTTGGT
Motif Score 2.20572619
Cell/Tissue List hNPCs
Seq Type List m6A-seq
Transcript ID List ENST00000261464.10; ENST00000336184.6; ENST00000473385.1
External Link RMBase: m6A_site_77154
mod ID: M6ASITE081620 Click to Show/Hide the Full List
mod site chr1:211373661-211373662:+ [12]
Sequence ATTTACAACTTGAGGAGAAAACCTTTACAATTTCCTATGGG
Motif Score 2.185083333
Cell/Tissue List hNPCs
Seq Type List m6A-seq
Transcript ID List ENST00000261464.10; ENST00000473385.1; ENST00000336184.6
External Link RMBase: m6A_site_77155
mod ID: M6ASITE081621 Click to Show/Hide the Full List
mod site chr1:211373705-211373706:+ [12]
Sequence CAGAAGTACTCTCAGCGAAAACTGATGGCTAAAACAGTATC
Motif Score 2.627720238
Cell/Tissue List hNPCs
Seq Type List m6A-seq
Transcript ID List ENST00000261464.10; ENST00000473385.1; ENST00000336184.6
External Link RMBase: m6A_site_77156
mod ID: M6ASITE081622 Click to Show/Hide the Full List
mod site chr1:211374036-211374037:+ [6]
Sequence CCCACCGCGTCAAGCCTCTGACAACTATTGAATTTGTAAGC
Motif Score 2.859755952
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000261464.10; ENST00000473385.1; ENST00000336184.6
External Link RMBase: m6A_site_77157
mod ID: M6ASITE081623 Click to Show/Hide the Full List
mod site chr1:211374083-211374084:+ [13]
Sequence GCAAATGGGCATTTATATAAACTTGTGATGTTTCTTGTCAG
Motif Score 2.627720238
Cell/Tissue List HEK293T; HeLa; hNPCs; hESCs; fibroblasts; A549; LCLs; CD8T; HEK293A-TOA
Seq Type List MeRIP-seq; m6A-seq; m6A-CLIP/IP
Transcript ID List ENST00000473385.1; ENST00000261464.10; ENST00000336184.6
External Link RMBase: m6A_site_77158
mod ID: M6ASITE081624 Click to Show/Hide the Full List
mod site chr1:211374126-211374127:+ [7]
Sequence TTCTGAGTACTCTGTGAAGAACAGAAATGATCATATTCTTA
Motif Score 2.951386905
Cell/Tissue List HeLa; HEK293T; hNPCs; hESCs; fibroblasts; A549; LCLs; HEK293A-TOA
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000473385.1; ENST00000336184.6; ENST00000261464.10
External Link RMBase: m6A_site_77159
mod ID: M6ASITE081633 Click to Show/Hide the Full List
mod site chr1:211374184-211374185:+ [7]
Sequence GTCTGAAGGTGTATATACAAACTGAGATGAGTCCTTATGAC
Motif Score 2.627720238
Cell/Tissue List HeLa; HEK293T; HepG2; hNPCs; hESCs; fibroblasts; A549; GM12878; LCLs; CD8T; Huh7; HEK293A-TOA; TIME
Seq Type List m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List ENST00000473385.1; ENST00000261464.10; ENST00000336184.6
External Link RMBase: m6A_site_77160
mod ID: M6ASITE081644 Click to Show/Hide the Full List
mod site chr1:211374391-211374392:+ [7]
Sequence ATGCACCTTACAATTTCTGAACAGTTAACCCTATAGAAGCA
Motif Score 2.951386905
Cell/Tissue List HeLa; HEK293T; hESC-HEK293T; fibroblasts; A549; GM12878; LCLs; CD8T; HEK293A-TOA; TIME
Seq Type List m6A-seq; MeRIP-seq; MAZTER-seq; m6A-CLIP/IP
Transcript ID List ENST00000336184.6; ENST00000261464.10; ENST00000473385.1
External Link RMBase: m6A_site_77161
mod ID: M6ASITE081655 Click to Show/Hide the Full List
mod site chr1:211374443-211374444:+ [7]
Sequence AGTGTCTTCTGGGAAGAGGAACCTTCTTAATCTCTTCTGTG
Motif Score 2.930744048
Cell/Tissue List HeLa; HEK293T; A549; HepG2; hNPCs; hESCs; fibroblasts; GM12878; LCLs; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000336184.6; ENST00000473385.1; ENST00000261464.10
External Link RMBase: m6A_site_77162
mod ID: M6ASITE081666 Click to Show/Hide the Full List
mod site chr1:211374484-211374485:+ [7]
Sequence GGATTTTCAAAATGCTAAAGACTCACACTGCAGCAATCATC
Motif Score 3.319380952
Cell/Tissue List HeLa; CD34; HEK293T; A549; HepG2; hNPCs; hESCs; fibroblasts; GM12878; LCLs; Huh7; Jurkat; HEK293A-TOA; iSLK; MSC; TIME; TREX
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000336184.6; ENST00000261464.10; ENST00000473385.1
External Link RMBase: m6A_site_77163
mod ID: M6ASITE081677 Click to Show/Hide the Full List
mod site chr1:211374488-211374489:+ [6]
Sequence TTTCAAAATGCTAAAGACTCACACTGCAGCAATCATCCCAG
Motif Score 2.047297619
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000473385.1; ENST00000336184.6; ENST00000261464.10
External Link RMBase: m6A_site_77164
mod ID: M6ASITE081688 Click to Show/Hide the Full List
mod site chr1:211374535-211374536:+ [6]
Sequence AAATTCAAAGAAATAGGTTCACAACAGGAATATACTGAAGA
Motif Score 2.047297619
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000261464.10; ENST00000336184.6; ENST00000473385.1
External Link RMBase: m6A_site_77165
mod ID: M6ASITE081699 Click to Show/Hide the Full List
mod site chr1:211374556-211374557:+ [7]
Sequence CAACAGGAATATACTGAAGAACTAGAGTGTCACTGCTGGTG
Motif Score 3.373380952
Cell/Tissue List HeLa; HEK293T; A549; HepG2; H1B; H1A; hNPCs; hESCs; fibroblasts; GM12878; LCLs; Huh7; Jurkat; HEK293A-TOA; iSLK; MSC; TIME; TREX
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000473385.1; ENST00000261464.10; ENST00000336184.6
External Link RMBase: m6A_site_77166
mod ID: M6ASITE081707 Click to Show/Hide the Full List
mod site chr1:211374578-211374579:+ [7]
Sequence TAGAGTGTCACTGCTGGTGAACTGTGGCACGGTTGCTCAAC
Motif Score 3.373380952
Cell/Tissue List HeLa; HEK293T; A549; HepG2; H1B; H1A; hNPCs; hESCs; fibroblasts; GM12878; LCLs; Huh7; Jurkat; HEK293A-TOA; iSLK; MSC; TIME; TREX
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000261464.10; ENST00000473385.1; ENST00000336184.6
External Link RMBase: m6A_site_77167
mod ID: M6ASITE081708 Click to Show/Hide the Full List
mod site chr1:211374597-211374598:+ [6]
Sequence AACTGTGGCACGGTTGCTCAACACATCACCTCGGACAAATT
Motif Score 2.173910714
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000473385.1; ENST00000261464.10; ENST00000336184.6
External Link RMBase: m6A_site_77168
mod ID: M6ASITE081709 Click to Show/Hide the Full List
mod site chr1:211374611-211374612:+ [7]
Sequence TGCTCAACACATCACCTCGGACAAATTCAGGAAGCATTTCT
Motif Score 3.643047619
Cell/Tissue List HeLa; HEK293T; A549; hESC-HEK293T; HepG2; H1B; H1A; hNPCs; hESCs; fibroblasts; GM12878; LCLs; Huh7; Jurkat; HEK293A-TOA; iSLK; MSC; TIME; TREX
Seq Type List m6A-seq; MeRIP-seq; MAZTER-seq; m6A-CLIP/IP
Transcript ID List ENST00000336184.6; ENST00000473385.1; ENST00000261464.10
External Link RMBase: m6A_site_77169
mod ID: M6ASITE081710 Click to Show/Hide the Full List
mod site chr1:211374649-211374650:+ [7]
Sequence TCTTTAGCCCACAAGTCCAGACCCAGGTGCTCTGTATGTTT
Motif Score 2.876744048
Cell/Tissue List HeLa; HEK293T; A549; HepG2; H1B; H1A; hESCs; fibroblasts; GM12878; LCLs; Huh7; Jurkat; HEK293A-TOA; iSLK; MSC; TIME; TREX
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000473385.1; ENST00000261464.10; ENST00000336184.6
External Link RMBase: m6A_site_77170
mod ID: M6ASITE081711 Click to Show/Hide the Full List
mod site chr1:211374764-211374765:+ [14]
Sequence TTAAGTAGTTGATGTGGAAAACATTTTAAAGTGAATTTGTC
Motif Score 2.20572619
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000336184.6; ENST00000473385.1; ENST00000261464.10
External Link RMBase: m6A_site_77171