m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00669)
Target Name Histone-lysine N-methyltransferase EHMT2 (G9a)
Synonyms
Euchromatic histone-lysine N-methyltransferase 2; HLA-B-associated transcript 8; Histone H3-K9 methyltransferase 3; H3-K9-HMTase 3; Lysine N-methyltransferase 1C; Protein G9a
    Click to Show/Hide
Gene Name G9a
Chromosomal Location 6p21.33
Family Class V-like SAM-binding methyltransferase superfamily, Histone-lysine methyltransferase family, Suvar3-9 subfamily
Function
Histone methyltransferase that specifically mono- and dimethylates 'Lys-9' of histone H3 (H3K9me1 and H3K9me2, respectively) in euchromatin. H3K9me represents a specific tag for epigenetic transcriptional repression by recruiting HP1 proteins to methylated histones. Also mediates monomethylation of 'Lys-56' of histone H3 (H3K56me1) in G1 phase, leading to promote interaction between histone H3 and PCNA and regulating DNA replication. Also weakly methylates 'Lys-27' of histone H3 (H3K27me). Also required for DNA methylation, the histone methyltransferase activity is not required for DNA methylation, suggesting that these 2 activities function independently. Probably targeted to histone H3 by different DNA-binding proteins like E2F6, MGA, MAX and/or DP1. May also methylate histone H1. In addition to the histone methyltransferase activity, also methylates non-histone proteins: mediates dimethylation of 'Lys-373' of p53/TP53. Also methylates CDYL, WIZ, ACIN1, DNMT1, HDAC1, ERCC6, KLF12 and itself.
    Click to Show/Hide
Gene ID 10919
Uniprot ID
EHMT2_HUMAN
HGNC ID
HGNC:14129
KEGG ID
hsa:10919
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
G9a can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Fat mass and obesity-associated protein (FTO) [ERASER]
 Regulator Info 
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary FTO contributes to neuropathic pain through stabilizing nerve injury-induced upregulation of Histone-lysine N-methyltransferase EHMT2 (G9a), a neuropathic pain initiator, in primary sensory neurons.
Target Regulation Up regulation
Responsed Disease Neuropathic Pain ICD-11: 8E43.0
 Disease Info 
In-vitro Model PC12 Rat adrenal gland pheochromocytoma Rattus norvegicus CVCL_0481
In-vivo Model After the animal was anesthetized with isoflurane, a midline incision in the lower lumbar back region was made and the lumbar articular process was exposed and then removed. The exposed DRG was injected with viral solution (1-1.5 ul in rats and 0.5-1 ul in mice) through a glass micropipette connected to a Hamilton syringe. The pipette was retained for 10 min after injection. Animals showing signs of paresis or other abnormalities were excluded. The injected DRGs were stained with hematoxylin/eosin to examine the integrity of their structure and whether they contained visible leukocytes.
Pain disorders [ICD-11: 8E43]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [1]
Response Summary FTO contributes to neuropathic pain through stabilizing nerve injury-induced upregulation of Histone-lysine N-methyltransferase EHMT2 (G9a), a neuropathic pain initiator, in primary sensory neurons.
Responsed Disease Neuropathic Pain [ICD-11: 8E43.0]
Target Regulator Fat mass and obesity-associated protein (FTO) ERASER
 Regulator Info 
Target Regulation Up regulation
In-vitro Model PC12 Rat adrenal gland pheochromocytoma Rattus norvegicus CVCL_0481
In-vivo Model After the animal was anesthetized with isoflurane, a midline incision in the lower lumbar back region was made and the lumbar articular process was exposed and then removed. The exposed DRG was injected with viral solution (1-1.5 ul in rats and 0.5-1 ul in mice) through a glass micropipette connected to a Hamilton syringe. The pipette was retained for 10 min after injection. Animals showing signs of paresis or other abnormalities were excluded. The injected DRGs were stained with hematoxylin/eosin to examine the integrity of their structure and whether they contained visible leukocytes.
Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator
Histone modification
m6A Regulator: Fat mass and obesity-associated protein (FTO)
 Regulator Info 
In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03231
 Crosstalk Info 
Epigenetic Regulator Histone-lysine N-methyltransferase EHMT2 (EHMT2)
Regulated Target Histone H3 lysine 9 dimethylation (H3K9me2)
Crosstalk relationship m6A → Histone modification
Disease Neuropathic pain
 Disease Info 
m6A Regulator: YTH domain-containing family protein 2 (YTHDF2)
 Regulator Info 
In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03232
 Crosstalk Info 
Epigenetic Regulator Histone-lysine N-methyltransferase EHMT2 (EHMT2)
Regulated Target Histone H3 lysine 9 dimethylation (H3K9me2)
Crosstalk relationship m6A → Histone modification
Disease Neuropathic pain
 Disease Info 
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00669)
Histone-lysine N-methyltransferase EHMT2 (G9a)
N4-acetylcytidine (ac4C)
In total 1 m6A sequence/site(s) in this target gene
mod ID: AC4SITE000103 Click to Show/Hide the Full List
mod site chr6:31884724-31884725:-
Sequence GAAGTCCTTCTGAATGCGCGCTGTGACCTCCATGCTGTCAA
Cell/Tissue List DLD1
Seq Type List acRIP-seq
Transcript ID List ENST00000375528.8; ENST00000375530.8; ENST00000477678.1; ENST00000480912.5; ENST00000478491.5; ENST00000461880.5; ENST00000395728.7; ENST00000436026.1; ENST00000494816.5; ENST00000375537.8
External Link RMBase: ac4C_site_1580
2'-O-Methylation (2'-O-Me)
In total 1 m6A sequence/site(s) in this target gene
mod ID: 2OMSITE000402 Click to Show/Hide the Full List
mod site chr6:31881066-31881067:- [2]
Sequence TCGGGGAGCTGATCTCTGATGCTGAGGCTGATGTGAGAGAG
Cell/Tissue List HeLa
Seq Type List Nm-seq
Transcript ID List ENST00000480912.5; ENST00000375528.8; ENST00000395728.7; ENST00000461880.5; ENST00000375537.8; ENST00000478491.5; ENST00000375530.8; ENST00000494816.5
External Link RMBase: Nm_site_5809
5-methylcytidine (m5C)
In total 7 m6A sequence/site(s) in this target gene
mod ID: M5CSITE003856 Click to Show/Hide the Full List
mod site chr6:31888501-31888502:-
Sequence TCCTCACTGCGCACAGCTGTCAGGCTGCAATGCCGCCATCC
Cell/Tissue List testis
Seq Type List Bisulfite-seq
Transcript ID List ENST00000375528.8; ENST00000480912.5; ENST00000395728.7; ENST00000375530.8; ENST00000375537.8
External Link RMBase: m5C_site_37537
mod ID: M5CSITE003857 Click to Show/Hide the Full List
mod site chr6:31896977-31896978:- [3]
Sequence CCCTCCCAGGGGGAGGCCCCCGCTGAGATGGGGGCGCTGCT
Seq Type List Bisulfite-seq
Transcript ID List ENST00000375530.8; ENST00000465429.1; ENST00000395728.7; ENST00000375528.8; ENST00000375537.8
External Link RMBase: m5C_site_37538
mod ID: M5CSITE003858 Click to Show/Hide the Full List
mod site chr6:31896978-31896979:- [3]
Sequence CCCCTCCCAGGGGGAGGCCCCCGCTGAGATGGGGGCGCTGC
Seq Type List Bisulfite-seq
Transcript ID List ENST00000375528.8; ENST00000395728.7; ENST00000465429.1; ENST00000375530.8; ENST00000375537.8
External Link RMBase: m5C_site_37539
mod ID: M5CSITE003859 Click to Show/Hide the Full List
mod site chr6:31896979-31896980:- [3]
Sequence TCCCCTCCCAGGGGGAGGCCCCCGCTGAGATGGGGGCGCTG
Seq Type List Bisulfite-seq
Transcript ID List ENST00000375528.8; ENST00000395728.7; ENST00000375530.8; ENST00000465429.1; ENST00000375537.8
External Link RMBase: m5C_site_37540
mod ID: M5CSITE003860 Click to Show/Hide the Full List
mod site chr6:31897162-31897163:-
Sequence GGAGGGGGTTGATGCGGGCCCGGGGGAGGGGTCGTGCGGCC
Cell/Tissue List T24
Seq Type List Bisulfite-seq
Transcript ID List ENST00000375537.8; ENST00000465429.1; ENST00000375528.8; ENST00000375530.8; ENST00000395728.7
External Link RMBase: m5C_site_37541
mod ID: M5CSITE003861 Click to Show/Hide the Full List
mod site chr6:31897163-31897164:-
Sequence GGGAGGGGGTTGATGCGGGCCCGGGGGAGGGGTCGTGCGGC
Cell/Tissue List T24
Seq Type List Bisulfite-seq
Transcript ID List ENST00000375528.8; ENST00000395728.7; ENST00000375537.8; ENST00000465429.1; ENST00000375530.8
External Link RMBase: m5C_site_37542
mod ID: M5CSITE003862 Click to Show/Hide the Full List
mod site chr6:31897164-31897165:-
Sequence AGGGAGGGGGTTGATGCGGGCCCGGGGGAGGGGTCGTGCGG
Cell/Tissue List T24
Seq Type List Bisulfite-seq
Transcript ID List ENST00000375530.8; ENST00000395728.7; ENST00000375537.8; ENST00000465429.1; ENST00000375528.8
External Link RMBase: m5C_site_37543
N6-methyladenosine (m6A)
In total 28 m6A sequence/site(s) in this target gene
mod ID: M6ASITE074500 Click to Show/Hide the Full List
mod site chr6:31879962-31879963:- [4]
Sequence TCTCTCCCCACCACCCTTTCACACATTCCTGACCAGAGATC
Motif Score 2.047297619
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000375528.8; ENST00000480912.5; ENST00000478491.5; ENST00000375530.8; ENST00000461880.5; ENST00000375537.8; ENST00000395728.7; ENST00000494816.5
External Link RMBase: m6A_site_712441
mod ID: M6ASITE074501 Click to Show/Hide the Full List
mod site chr6:31880090-31880091:- [4]
Sequence CGGCTCCCTGCCCCCTGTCAACACATGAGAACGGACCACAC
Motif Score 2.173910714
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000375530.8; ENST00000375528.8; ENST00000480912.5; ENST00000494816.5; ENST00000478491.5; ENST00000461880.5; ENST00000375537.8; ENST00000395728.7
External Link RMBase: m6A_site_712442
mod ID: M6ASITE074502 Click to Show/Hide the Full List
mod site chr6:31880134-31880135:- [4]
Sequence CGTCTGGCCCGCCTGGACCCACACCCTGAGCTGCTGCCCGA
Motif Score 2.053113095
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000375537.8; ENST00000478491.5; ENST00000375530.8; ENST00000480912.5; ENST00000494816.5; ENST00000395728.7; ENST00000375528.8; ENST00000461880.5
External Link RMBase: m6A_site_712443
mod ID: M6ASITE074503 Click to Show/Hide the Full List
mod site chr6:31880237-31880238:- [4]
Sequence CTATGGCGACCGCTTCTGGGACATCAAAAGCAAATATTTCA
Motif Score 3.643047619
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000461880.5; ENST00000478491.5; ENST00000480912.5; ENST00000375528.8; ENST00000494816.5; ENST00000375537.8; ENST00000375530.8; ENST00000395728.7
External Link RMBase: m6A_site_712444
mod ID: M6ASITE074504 Click to Show/Hide the Full List
mod site chr6:31880696-31880697:- [4]
Sequence CGCCTTCTTCAGTTCCCGAGACATCCGGACTGGGGAGGAGC
Motif Score 2.897386905
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000478491.5; ENST00000494816.5; ENST00000375528.8; ENST00000480912.5; ENST00000461880.5; ENST00000395728.7; ENST00000375537.8; ENST00000375530.8
External Link RMBase: m6A_site_712445
mod ID: M6ASITE074505 Click to Show/Hide the Full List
mod site chr6:31880771-31880772:- [4]
Sequence CAACCACCTGTGTGACCCCAACATCATTCCCGTCCGGGTCT
Motif Score 2.173910714
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000375537.8; ENST00000375528.8; ENST00000478491.5; ENST00000494816.5; ENST00000375530.8; ENST00000461880.5; ENST00000480912.5; ENST00000395728.7
External Link RMBase: m6A_site_712446
mod ID: M6ASITE074506 Click to Show/Hide the Full List
mod site chr6:31880807-31880808:- [5]
Sequence AGATGCCCGTTACTATGGCAACATCAGCCGCTTCATCAACC
Motif Score 2.173910714
Cell/Tissue List HEK293T; hESC-HEK293T
Seq Type List DART-seq; MAZTER-seq
Transcript ID List ENST00000480912.5; ENST00000395728.7; ENST00000375528.8; ENST00000461880.5; ENST00000375530.8; ENST00000494816.5; ENST00000375537.8; ENST00000478491.5
External Link RMBase: m6A_site_712447
mod ID: M6ASITE074507 Click to Show/Hide the Full List
mod site chr6:31881017-31881018:- [4]
Sequence TTACCTCTTCGACTTAGACAACAAGGTGAGCAGGAGACCCT
Motif Score 2.173910714
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000461880.5; ENST00000375528.8; ENST00000480912.5; ENST00000478491.5; ENST00000494816.5; ENST00000395728.7; ENST00000375530.8; ENST00000375537.8
External Link RMBase: m6A_site_712448
mod ID: M6ASITE074508 Click to Show/Hide the Full List
mod site chr6:31881020-31881021:- [5]
Sequence TTCTTACCTCTTCGACTTAGACAACAAGGTGAGCAGGAGAC
Motif Score 2.897386905
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000395728.7; ENST00000480912.5; ENST00000375528.8; ENST00000375537.8; ENST00000478491.5; ENST00000461880.5; ENST00000494816.5; ENST00000375530.8
External Link RMBase: m6A_site_712449
mod ID: M6ASITE074509 Click to Show/Hide the Full List
mod site chr6:31882983-31882984:- [4]
Sequence GCGATTGCTCCAGGAATTTAACAAGATTGAGCCTCCGCTGA
Motif Score 2.168095238
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000375528.8; ENST00000375537.8; ENST00000480912.5; ENST00000395728.7; ENST00000478491.5; ENST00000461880.5; ENST00000375530.8; ENST00000494816.5
External Link RMBase: m6A_site_712450
mod ID: M6ASITE074510 Click to Show/Hide the Full List
mod site chr6:31883365-31883366:- [4]
Sequence CAGCATCCGGTGCTGGTATGACAAGGTGCGTGCCCCTTGCC
Motif Score 2.859755952
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000480912.5; ENST00000375537.8; ENST00000461880.5; ENST00000494816.5; ENST00000375528.8; ENST00000395728.7; ENST00000478491.5; ENST00000375530.8
External Link RMBase: m6A_site_712451
mod ID: M6ASITE074511 Click to Show/Hide the Full List
mod site chr6:31883821-31883822:- [4]
Sequence CACCATGAACATCGATCGCAACATCACCCACCTGCAGGTGA
Motif Score 2.173910714
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000461880.5; ENST00000478491.5; ENST00000375530.8; ENST00000494816.5; ENST00000375528.8; ENST00000480912.5; ENST00000436026.1; ENST00000395728.7; ENST00000375537.8
External Link RMBase: m6A_site_712452
mod ID: M6ASITE074512 Click to Show/Hide the Full List
mod site chr6:31883872-31883873:- [4]
Sequence GGAGCCCTGCCCTGAGGATTACAAGTACATCTCAGAGAACT
Motif Score 2.07285119
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000395728.7; ENST00000375537.8; ENST00000375528.8; ENST00000494816.5; ENST00000480912.5; ENST00000375530.8; ENST00000461880.5; ENST00000436026.1; ENST00000478491.5
External Link RMBase: m6A_site_712453
mod ID: M6ASITE074513 Click to Show/Hide the Full List
mod site chr6:31884692-31884693:- [4]
Sequence TGCTGTCAACTACCATGGGGACACCCCCCTGCACATCGCAG
Motif Score 3.643047619
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000375537.8; ENST00000436026.1; ENST00000461880.5; ENST00000494816.5; ENST00000477678.1; ENST00000375530.8; ENST00000395728.7; ENST00000375528.8; ENST00000480912.5; ENST00000478491.5
External Link RMBase: m6A_site_712454
mod ID: M6ASITE074514 Click to Show/Hide the Full List
mod site chr6:31884791-31884792:- [4]
Sequence CCTACCTCCACAGGAGGAGAACATCTGCCTGCACTGGGCCT
Motif Score 2.951386905
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000480912.5; ENST00000395728.7; ENST00000436026.1; ENST00000494816.5; ENST00000375530.8; ENST00000478491.5; ENST00000375528.8; ENST00000461880.5; ENST00000375537.8; ENST00000477678.1
External Link RMBase: m6A_site_712455
mod ID: M6ASITE074515 Click to Show/Hide the Full List
mod site chr6:31884915-31884916:- [4]
Sequence CGCCGACGTCACCCTCACTGACAACGTGAGTGAGCGTTTGG
Motif Score 2.859755952
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000375537.8; ENST00000477678.1; ENST00000494816.5; ENST00000461880.5; ENST00000375530.8; ENST00000480912.5; ENST00000436026.1; ENST00000375528.8; ENST00000395728.7
External Link RMBase: m6A_site_712456
mod ID: M6ASITE074516 Click to Show/Hide the Full List
mod site chr6:31884969-31884970:- [4]
Sequence CTGGGCTGCAGAGCACAAGCACATCGAGGTGATCCGCATGC
Motif Score 2.830589286
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000395728.7; ENST00000461880.5; ENST00000375528.8; ENST00000494816.5; ENST00000436026.1; ENST00000480912.5; ENST00000375537.8; ENST00000375530.8; ENST00000477678.1
External Link RMBase: m6A_site_712457
mod ID: M6ASITE074517 Click to Show/Hide the Full List
mod site chr6:31886808-31886809:- [4]
Sequence CCACCTGGAGGTAGCCCGTTACATGGTGCAGCGTGGTGGCT
Motif Score 2.07285119
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000375537.8; ENST00000477678.1; ENST00000436026.1; ENST00000480912.5; ENST00000375530.8; ENST00000395728.7; ENST00000375528.8
External Link RMBase: m6A_site_712458
mod ID: M6ASITE074518 Click to Show/Hide the Full List
mod site chr6:31887904-31887905:- [4]
Sequence GCCCTGCGATCCCCTGGCTGACACCATTGACAGCTCAGGGC
Motif Score 2.859755952
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000375537.8; ENST00000395728.7; ENST00000375530.8; ENST00000480912.5; ENST00000375528.8
External Link RMBase: m6A_site_712459
mod ID: M6ASITE074519 Click to Show/Hide the Full List
mod site chr6:31888055-31888056:- [4]
Sequence GGATGTCCCCGGGAGAGCAGACACTTCTCAGCCCAGGTACT
Motif Score 2.897386905
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000395728.7; ENST00000480912.5; ENST00000375530.8; ENST00000375537.8; ENST00000375528.8
External Link RMBase: m6A_site_712460
mod ID: M6ASITE074520 Click to Show/Hide the Full List
mod site chr6:31888226-31888227:- [4]
Sequence CCGTGTGGCCCACCGCTTCCACAAGGCCTGTGTGTCTCAGC
Motif Score 2.053113095
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000375537.8; ENST00000375528.8; ENST00000480912.5; ENST00000375530.8; ENST00000395728.7
External Link RMBase: m6A_site_712461
mod ID: M6ASITE074521 Click to Show/Hide the Full List
mod site chr6:31888401-31888402:- [4]
Sequence CACCGCGCCCGCATGGTCAAACACCACTGCTGCCCGGGCTG
Motif Score 2.20572619
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000375537.8; ENST00000480912.5; ENST00000375528.8; ENST00000395728.7; ENST00000375530.8
External Link RMBase: m6A_site_712462
mod ID: M6ASITE074522 Click to Show/Hide the Full List
mod site chr6:31888632-31888633:- [4]
Sequence CATCAGCGAGAGGGCGGGGCACAAGTGCATGGCCACTGAGA
Motif Score 2.830589286
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000480912.5; ENST00000375530.8; ENST00000395728.7; ENST00000375528.8; ENST00000375537.8
External Link RMBase: m6A_site_712463
mod ID: M6ASITE074523 Click to Show/Hide the Full List
mod site chr6:31888734-31888735:- [4]
Sequence CATCCAAGGGGTGTCCAATGACACATCTTCGCTGGAGACAG
Motif Score 2.859755952
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000375537.8; ENST00000375530.8; ENST00000375528.8; ENST00000480912.5; ENST00000395728.7
External Link RMBase: m6A_site_712464
mod ID: M6ASITE074524 Click to Show/Hide the Full List
mod site chr6:31889033-31889034:- [4]
Sequence CTCCTCAGGCCCCAGTGAGTACATGGAGGTCCCTCTGGGGT
Motif Score 2.856142857
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000480912.5; ENST00000375528.8; ENST00000395728.7; ENST00000375530.8; ENST00000375537.8
External Link RMBase: m6A_site_712465
mod ID: M6ASITE074525 Click to Show/Hide the Full List
mod site chr6:31889578-31889579:- [4]
Sequence GAAGTTGAAGCTCTAACTGAACAACTAAGTGAAGAGGAGGA
Motif Score 2.951386905
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000480912.5; ENST00000375530.8; ENST00000375537.8; ENST00000395728.7; ENST00000375528.8
External Link RMBase: m6A_site_712466
mod ID: M6ASITE074526 Click to Show/Hide the Full List
mod site chr6:31896694-31896695:- [4]
Sequence TGTTGGTGATGAGGGGGCTGACACCCCTGTAGGGGCTACAC
Motif Score 2.859755952
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000375537.8; ENST00000465429.1; ENST00000395728.7; ENST00000375530.8; ENST00000375528.8
External Link RMBase: m6A_site_712467
mod ID: M6ASITE074527 Click to Show/Hide the Full List
mod site chr6:31896805-31896806:- [4]
Sequence AGTTCATGGCTCTTTGGGGGACACCCCTCGTAGTGAAGAAA
Motif Score 3.643047619
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000465429.1; ENST00000375528.8; ENST00000395728.7; ENST00000375530.8; ENST00000375537.8
External Link RMBase: m6A_site_712468
N7-methylguanosine (m7G)
In total 1 m6A sequence/site(s) in this target gene
mod ID: m7GSITE000107 Click to Show/Hide the Full List
mod site chr6:31896971-31896972:- [6]
Sequence CAGGGGGAGGCCCCCGCTGAGATGGGGGCGCTGCTGCTGGA
Cell/Tissue List A549; HeLa; HepG2
Seq Type List BoRed-seq&m7G-RIP-seq; m7G-seq
Transcript ID List ENST00000395728.7; ENST00000375528.8; ENST00000465429.1; ENST00000375530.8; ENST00000375537.8
External Link RMBase: m7G_site_777