m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00659)
Target Name Long intergenic non-protein coding RNA 1273 (LINC01273)
Gene Name LINC01273
Chromosomal Location 20q13.13
Gene ID 101927541
HGNC ID
HGNC:50329
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
LINC01273 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Browse Drug
Methyltransferase-like 3 (METTL3) [WRITER]
 Regulator Info 
Representative RIP-seq result supporting the interaction between LINC01273 and the regulator
Cell Line MDA-MB-231 Homo sapiens
Regulation logFC: 7.26E+00 GSE60213
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary Long intergenic non-protein coding RNA 1273 (LINC01273) was modified with m6A, METTL3 increased LINC01273 m6A modification, followed by LINC01273 decay in the presence of YTHDF2, a m6A 'reader'. And LINC01273 plays a key role in sorafenib resistant HCC cells.
Target Regulation Down regulation
Responsed Disease Hepatocellular carcinoma ICD-11: 2C12.02
 Disease Info 
Responsed Drug Sorafenib Approved
 Drug Info 
In-vitro Model SMMC-7721 Endocervical adenocarcinoma Homo sapiens CVCL_0534
Huh-7 Adult hepatocellular carcinoma Homo sapiens CVCL_0336
YTH domain-containing family protein 2 (YTHDF2) [READER]
 Regulator Info 
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary Long intergenic non-protein coding RNA 1273 (LINC01273) was modified with m6A, METTL3 increased LINC01273 m6A modification, followed by LINC01273 decay in the presence of YTHDF2, a m6A 'reader'. And LINC01273 plays a key role in sorafenib resistant HCC cells.
Target Regulation Down regulation
Responsed Disease Hepatocellular carcinoma ICD-11: 2C12.02
 Disease Info 
Responsed Drug Sorafenib Approved
 Drug Info 
In-vitro Model SMMC-7721 Endocervical adenocarcinoma Homo sapiens CVCL_0534
Huh-7 Adult hepatocellular carcinoma Homo sapiens CVCL_0336
Liver cancer [ICD-11: 2C12]
 Disease Info 
In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [1]
Response Summary Long intergenic non-protein coding RNA 1273 (LINC01273) was modified with m6A, METTL3 increased LINC01273 m6A modification, followed by LINC01273 decay in the presence of YTHDF2, a m6A 'reader'. And LINC01273 plays a key role in sorafenib resistant HCC cells.
Responsed Disease Hepatocellular carcinoma [ICD-11: 2C12.02]
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
 Regulator Info 
Target Regulation Down regulation
Responsed Drug Sorafenib Approved
 Drug Info 
In-vitro Model SMMC-7721 Endocervical adenocarcinoma Homo sapiens CVCL_0534
Huh-7 Adult hepatocellular carcinoma Homo sapiens CVCL_0336
Experiment 2 Reporting the m6A-centered Disease Response [1]
Response Summary Long intergenic non-protein coding RNA 1273 (LINC01273) was modified with m6A, METTL3 increased LINC01273 m6A modification, followed by LINC01273 decay in the presence of YTHDF2, a m6A 'reader'. And LINC01273 plays a key role in sorafenib resistant HCC cells.
Responsed Disease Hepatocellular carcinoma [ICD-11: 2C12.02]
Target Regulator YTH domain-containing family protein 2 (YTHDF2) READER
 Regulator Info 
Target Regulation Down regulation
Responsed Drug Sorafenib Approved
 Drug Info 
In-vitro Model SMMC-7721 Endocervical adenocarcinoma Homo sapiens CVCL_0534
Huh-7 Adult hepatocellular carcinoma Homo sapiens CVCL_0336
Sorafenib [Approved]
 Drug Info 
In total 2 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response [1]
Response Summary Long intergenic non-protein coding RNA 1273 (LINC01273) was modified with m6A, METTL3 increased LINC01273 m6A modification, followed by LINC01273 decay in the presence of YTHDF2, a m6A 'reader'. And LINC01273 plays a key role in sorafenib resistant HCC cells.
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
 Regulator Info 
Target Regulation Down regulation
Responsed Disease Hepatocellular carcinoma ICD-11: 2C12.02
 Disease Info 
In-vitro Model SMMC-7721 Endocervical adenocarcinoma Homo sapiens CVCL_0534
Huh-7 Adult hepatocellular carcinoma Homo sapiens CVCL_0336
Experiment 2 Reporting the m6A-centered Drug Response [1]
Response Summary Long intergenic non-protein coding RNA 1273 (LINC01273) was modified with m6A, METTL3 increased LINC01273 m6A modification, followed by LINC01273 decay in the presence of YTHDF2, a m6A 'reader'. And LINC01273 plays a key role in sorafenib resistant HCC cells.
Target Regulator YTH domain-containing family protein 2 (YTHDF2) READER
 Regulator Info 
Target Regulation Down regulation
Responsed Disease Hepatocellular carcinoma ICD-11: 2C12.02
 Disease Info 
In-vitro Model SMMC-7721 Endocervical adenocarcinoma Homo sapiens CVCL_0534
Huh-7 Adult hepatocellular carcinoma Homo sapiens CVCL_0336
Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator
Histone modification
m6A Regulator: YTH domain-containing family protein 2 (YTHDF2)
 Regulator Info 
In total 2 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03416
 Crosstalk Info 
Regulated Target Histone H3 lysine 4 trimethylation (H3K4me3)
Crosstalk relationship Histone modification → m6A
Disease Liver cancer
 Disease Info 
Drug Sorafenib
 Drug Info 
Crosstalk ID: M6ACROT03427
 Crosstalk Info 
Regulated Target Histone H3 lysine 27 acetylation (H3K27ac)
Crosstalk relationship Histone modification → m6A
Disease Liver cancer
 Disease Info 
Drug Sorafenib
 Drug Info 
Non-coding RNA
m6A Regulator: YTH domain-containing family protein 2 (YTHDF2)
 Regulator Info 
In total 2 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05044
 Crosstalk Info 
Epigenetic Regulator MicroRNA 145 (MIR145)
Regulated Target YTH domain-containing family protein 2 (YTHDF2)
Crosstalk relationship ncRNA → m6A
Disease Liver cancer
 Disease Info 
Crosstalk ID: M6ACROT05612
 Crosstalk Info 
Epigenetic Regulator Long intergenic non-protein coding RNA 1273 (LINC01273)
Regulated Target hsa-miR-600
Crosstalk relationship m6A → ncRNA
Disease Liver cancer
 Disease Info 
Drug Sorafenib
 Drug Info 
m6A Regulator: Methyltransferase-like 3 (METTL3)
 Regulator Info 
In total 3 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05354
 Crosstalk Info 
Epigenetic Regulator hsa-miR-600
Regulated Target Methyltransferase-like protein 3 (METTL3)
Crosstalk relationship ncRNA → m6A
Disease Liver cancer
 Disease Info 
Drug Sorafenib
 Drug Info 
Crosstalk ID: M6ACROT05355
 Crosstalk Info 
Epigenetic Regulator Long intergenic non-protein coding RNA 1273 (LINC01273)
Regulated Target hsa-miR-600
Crosstalk relationship ncRNA → m6A
Disease Liver cancer
 Disease Info 
Drug Sorafenib
 Drug Info 
Crosstalk ID: M6ACROT05611
 Crosstalk Info 
Epigenetic Regulator Long intergenic non-protein coding RNA 1273 (LINC01273)
Regulated Target hsa-miR-600
Crosstalk relationship m6A → ncRNA
Disease Liver cancer
 Disease Info 
Drug Sorafenib
 Drug Info 
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00659)
Long intergenic non-protein coding RNA 1273 (LINC01273)
Adenosine-to-Inosine editing (A-to-I)
In total 2 m6A sequence/site(s) in this target gene
mod ID: A2ISITE010722 Click to Show/Hide the Full List
mod site chr20:50173249-50173250:+ [2]
Sequence CAGTGGTGCAATCCTAGCTCACTGCAGCTTCGACCTCCCGT
Transcript ID List ENST00000427333.5; ENST00000411453.2
External Link RMBase: RNA-editing_site_88160
mod ID: A2ISITE010723 Click to Show/Hide the Full List
mod site chr20:50173254-50173255:+ [2]
Sequence GTGCAATCCTAGCTCACTGCAGCTTCGACCTCCCGTGCTCA
Transcript ID List ENST00000411453.2; ENST00000427333.5
External Link RMBase: RNA-editing_site_88161
N6-methyladenosine (m6A)
In total 10 m6A sequence/site(s) in this target gene
mod ID: M6ASITE053530 Click to Show/Hide the Full List
mod site chr20:50172745-50172746:+ [3]
Sequence GGTTTCGGTTTTCTGGCTGAACAGTGATTAACGCGAGGGAA
Motif Score 2.951386905
Cell/Tissue List HeLa; HepG2; A549; iSLK
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000427333.5; ENST00000411453.2; rmsk_5144549
External Link RMBase: m6A_site_536253
mod ID: M6ASITE053531 Click to Show/Hide the Full List
mod site chr20:50172927-50172928:+ [3]
Sequence CTTGTTTTGTCCCAGGAAGAACATTCCAACACAGACCACAA
Motif Score 2.951386905
Cell/Tissue List HeLa; HepG2; A549; iSLK
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000411453.2; ENST00000427333.5; rmsk_5144550
External Link RMBase: m6A_site_536254
mod ID: M6ASITE053532 Click to Show/Hide the Full List
mod site chr20:50172941-50172942:+ [3]
Sequence GGAAGAACATTCCAACACAGACCACAACACCTATGGACCTG
Motif Score 2.876744048
Cell/Tissue List HeLa; HepG2; A549; iSLK
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000411453.2; rmsk_5144550; ENST00000427333.5
External Link RMBase: m6A_site_536255
mod ID: M6ASITE053533 Click to Show/Hide the Full List
mod site chr20:50172957-50172958:+ [3]
Sequence ACAGACCACAACACCTATGGACCTGGAAAACATTGTGCTCA
Motif Score 3.622404762
Cell/Tissue List HeLa; HepG2; A549
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000427333.5; ENST00000411453.2; rmsk_5144550
External Link RMBase: m6A_site_536256
mod ID: M6ASITE053534 Click to Show/Hide the Full List
mod site chr20:50172966-50172967:+ [3]
Sequence AACACCTATGGACCTGGAAAACATTGTGCTCAGTGAAAGAA
Motif Score 2.20572619
Cell/Tissue List HeLa; HepG2; A549
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List rmsk_5144550; ENST00000427333.5; ENST00000411453.2
External Link RMBase: m6A_site_536257
mod ID: M6ASITE053535 Click to Show/Hide the Full List
mod site chr20:50172992-50172993:+ [3]
Sequence TGCTCAGTGAAAGAAGCCAGACACAGAAGGACAATGTTGTA
Motif Score 2.897386905
Cell/Tissue List HeLa; HepG2; A549
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List rmsk_5144550; ENST00000411453.2; ENST00000427333.5
External Link RMBase: m6A_site_536258
mod ID: M6ASITE053536 Click to Show/Hide the Full List
mod site chr20:50173002-50173003:+ [3]
Sequence AAGAAGCCAGACACAGAAGGACAATGTTGTATGAGGTACCT
Motif Score 3.643047619
Cell/Tissue List HeLa; HepG2; A549
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List rmsk_5144550; ENST00000411453.2; ENST00000427333.5
External Link RMBase: m6A_site_536259
mod ID: M6ASITE053537 Click to Show/Hide the Full List
mod site chr20:50173225-50173226:+ [3]
Sequence TATTCTGTTGCCCAGGCTGGACTGCAGTGGTGCAATCCTAG
Motif Score 4.065041667
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000411453.2; ENST00000427333.5
External Link RMBase: m6A_site_536260
mod ID: M6ASITE053538 Click to Show/Hide the Full List
mod site chr20:50176282-50176283:+ [4]
Sequence GCCACATGTGTTTTGCAGGGACACATTCCAGCAAAAAGACA
Motif Score 3.643047619
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000411453.2
External Link RMBase: m6A_site_536261
mod ID: M6ASITE053539 Click to Show/Hide the Full List
mod site chr20:50176300-50176301:+ [4]
Sequence GGACACATTCCAGCAAAAAGACACAAAGTGACAGAATGGCT
Motif Score 2.897386905
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000411453.2
External Link RMBase: m6A_site_536262