m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00625)
Target Name Homeobox protein Nkx-3.1 (NKX3-1)
Synonyms
Homeobox protein NK-3 homolog A
    Click to Show/Hide
Gene Name NKX3-1
Chromosomal Location 8p21.2
Family NK-3 homeobox family
Function
Transcription factor, which binds preferentially the consensus sequence 5'-TAAGT[AG]-3' and can behave as a transcriptional repressor. Plays an important role in normal prostate development, regulating proliferation of glandular epithelium and in the formation of ducts in prostate. Acts as a tumor suppressor controlling prostate carcinogenesis, as shown by the ability to inhibit proliferation and invasion activities of PC-3 prostate cancer cells.
    Click to Show/Hide
Gene ID 4824
Uniprot ID
NKX31_HUMAN
HGNC ID
HGNC:7838
KEGG ID
hsa:4824
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
NKX3-1 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Methyltransferase-like 3 (METTL3) [WRITER]
 Regulator Info 
Representative RNA-seq result indicating the expression of this target gene regulated by METTL3
Cell Line LX2 cell line Homo sapiens
Treatment: shMETTL3 LX2 cells
Control: shLuc LX2 cells
 GSE207909
Regulation
logFC: 1.12E+00
p-value: 7.44E-16
More Results Click to View More RNA-seq Results
Representative RIP-seq result supporting the interaction between NKX3-1 and the regulator
Cell Line MDA-MB-231 Homo sapiens
Regulation logFC: 7.11E+00 GSE60213
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary Knock-down of YTHDF2 or METTL3 significantly induced the expression of LHPP and Homeobox protein Nkx-3.1 (NKX3-1) at both mRNA and protein level with inhibited phosphorylated AKT. YTHDF2 mediates the mRNA degradation of the tumor suppressors LHPP and NKX3-1 in m6A-dependent way to regulate AKT phosphorylation-induced tumor progression in prostate cancer.
Target Regulation Down regulation
Responsed Disease Prostate cancer ICD-11: 2C82
 Disease Info 
Pathway Response Oxidative phosphorylation hsa00190
In-vitro Model VCaP Prostate carcinoma Homo sapiens CVCL_2235
RWPE-1 Normal Homo sapiens CVCL_3791
PC-3 Prostate carcinoma Homo sapiens CVCL_0035
DU145 Prostate carcinoma Homo sapiens CVCL_0105
22Rv1 Prostate carcinoma Homo sapiens CVCL_1045
In-vivo Model Approximately 2 × 106 PCa cells (PC-3 shNC, shYTHDF2, shMETTL3 cell lines) per mouse suspended in 100 uL PBS were injected in the flank of male BALB/c nude mice (4 weeks old). During the 40-day observation, the tumor size (V = (width2×length ×0.52)) was measured with vernier caliper. Approximately 1.5 × 106 PCa cells suspended in 100 uL of PBS (PC-3 shNC, shYTHDF2, and shMETTL3 cell lines) per mouse were injected into the tail vein of male BALB/c nude mice (4 weeks old). The IVIS Spectrum animal imaging system (PerkinElmer) was used to evaluate the tumor growth (40 days) and whole metastasis conditions (4 weeks and 6 weeks) with 100 uL XenoLight D-luciferin Potassium Salt (15 mg/ml, Perkin Elmer) per mouse. Mice were anesthetized and then sacrificed for tumors and metastases which were sent for further organ-localized imaging as above, IHC staining and hematoxylin-eosin (H&E) staining.
YTH domain-containing family protein 2 (YTHDF2) [READER]
 Regulator Info 
Representative RNA-seq result indicating the expression of this target gene regulated by YTHDF2
Cell Line GSC11 cell line Homo sapiens
Treatment: siYTHDF2 GSC11 cells
Control: siControl GSC11 cells
 GSE142825
Regulation
logFC: 9.36E-01
p-value: 4.17E-02
More Results Click to View More RNA-seq Results
Representative RIP-seq result supporting the interaction between NKX3-1 and the regulator
Cell Line Hela Homo sapiens
Regulation logFC: 1.20E+00 GSE49339
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary Knock-down of YTHDF2 or METTL3 significantly induced the expression of LHPP and Homeobox protein Nkx-3.1 (NKX3-1) at both mRNA and protein level with inhibited phosphorylated AKT. YTHDF2 mediates the mRNA degradation of the tumor suppressors LHPP and NKX3-1 in m6A-dependent way to regulate AKT phosphorylation-induced tumor progression in prostate cancer.
Target Regulation Down regulation
Responsed Disease Prostate cancer ICD-11: 2C82
 Disease Info 
Pathway Response Oxidative phosphorylation hsa00190
In-vitro Model VCaP Prostate carcinoma Homo sapiens CVCL_2235
RWPE-1 Normal Homo sapiens CVCL_3791
PC-3 Prostate carcinoma Homo sapiens CVCL_0035
DU145 Prostate carcinoma Homo sapiens CVCL_0105
22Rv1 Prostate carcinoma Homo sapiens CVCL_1045
In-vivo Model Approximately 2 × 106 PCa cells (PC-3 shNC, shYTHDF2, shMETTL3 cell lines) per mouse suspended in 100 uL PBS were injected in the flank of male BALB/c nude mice (4 weeks old). During the 40-day observation, the tumor size (V = (width2×length ×0.52)) was measured with vernier caliper. Approximately 1.5 × 106 PCa cells suspended in 100 uL of PBS (PC-3 shNC, shYTHDF2, and shMETTL3 cell lines) per mouse were injected into the tail vein of male BALB/c nude mice (4 weeks old). The IVIS Spectrum animal imaging system (PerkinElmer) was used to evaluate the tumor growth (40 days) and whole metastasis conditions (4 weeks and 6 weeks) with 100 uL XenoLight D-luciferin Potassium Salt (15 mg/ml, Perkin Elmer) per mouse. Mice were anesthetized and then sacrificed for tumors and metastases which were sent for further organ-localized imaging as above, IHC staining and hematoxylin-eosin (H&E) staining.
Prostate cancer [ICD-11: 2C82]
 Disease Info 
In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [1]
Response Summary Knock-down of YTHDF2 or METTL3 significantly induced the expression of LHPP and Homeobox protein Nkx-3.1 (NKX3-1) at both mRNA and protein level with inhibited phosphorylated AKT. YTHDF2 mediates the mRNA degradation of the tumor suppressors LHPP and NKX3-1 in m6A-dependent way to regulate AKT phosphorylation-induced tumor progression in prostate cancer.
Responsed Disease Prostate cancer [ICD-11: 2C82]
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
 Regulator Info 
Target Regulation Down regulation
Pathway Response Oxidative phosphorylation hsa00190
In-vitro Model VCaP Prostate carcinoma Homo sapiens CVCL_2235
RWPE-1 Normal Homo sapiens CVCL_3791
PC-3 Prostate carcinoma Homo sapiens CVCL_0035
DU145 Prostate carcinoma Homo sapiens CVCL_0105
22Rv1 Prostate carcinoma Homo sapiens CVCL_1045
In-vivo Model Approximately 2 × 106 PCa cells (PC-3 shNC, shYTHDF2, shMETTL3 cell lines) per mouse suspended in 100 uL PBS were injected in the flank of male BALB/c nude mice (4 weeks old). During the 40-day observation, the tumor size (V = (width2×length ×0.52)) was measured with vernier caliper. Approximately 1.5 × 106 PCa cells suspended in 100 uL of PBS (PC-3 shNC, shYTHDF2, and shMETTL3 cell lines) per mouse were injected into the tail vein of male BALB/c nude mice (4 weeks old). The IVIS Spectrum animal imaging system (PerkinElmer) was used to evaluate the tumor growth (40 days) and whole metastasis conditions (4 weeks and 6 weeks) with 100 uL XenoLight D-luciferin Potassium Salt (15 mg/ml, Perkin Elmer) per mouse. Mice were anesthetized and then sacrificed for tumors and metastases which were sent for further organ-localized imaging as above, IHC staining and hematoxylin-eosin (H&E) staining.
Experiment 2 Reporting the m6A-centered Disease Response [1]
Response Summary Knock-down of YTHDF2 or METTL3 significantly induced the expression of LHPP and Homeobox protein Nkx-3.1 (NKX3-1) at both mRNA and protein level with inhibited phosphorylated AKT. YTHDF2 mediates the mRNA degradation of the tumor suppressors LHPP and NKX3-1 in m6A-dependent way to regulate AKT phosphorylation-induced tumor progression in prostate cancer.
Responsed Disease Prostate cancer [ICD-11: 2C82]
Target Regulator YTH domain-containing family protein 2 (YTHDF2) READER
 Regulator Info 
Target Regulation Down regulation
Pathway Response Oxidative phosphorylation hsa00190
In-vitro Model VCaP Prostate carcinoma Homo sapiens CVCL_2235
RWPE-1 Normal Homo sapiens CVCL_3791
PC-3 Prostate carcinoma Homo sapiens CVCL_0035
DU145 Prostate carcinoma Homo sapiens CVCL_0105
22Rv1 Prostate carcinoma Homo sapiens CVCL_1045
In-vivo Model Approximately 2 × 106 PCa cells (PC-3 shNC, shYTHDF2, shMETTL3 cell lines) per mouse suspended in 100 uL PBS were injected in the flank of male BALB/c nude mice (4 weeks old). During the 40-day observation, the tumor size (V = (width2×length ×0.52)) was measured with vernier caliper. Approximately 1.5 × 106 PCa cells suspended in 100 uL of PBS (PC-3 shNC, shYTHDF2, and shMETTL3 cell lines) per mouse were injected into the tail vein of male BALB/c nude mice (4 weeks old). The IVIS Spectrum animal imaging system (PerkinElmer) was used to evaluate the tumor growth (40 days) and whole metastasis conditions (4 weeks and 6 weeks) with 100 uL XenoLight D-luciferin Potassium Salt (15 mg/ml, Perkin Elmer) per mouse. Mice were anesthetized and then sacrificed for tumors and metastases which were sent for further organ-localized imaging as above, IHC staining and hematoxylin-eosin (H&E) staining.
Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator
Histone modification
m6A Regulator: YTH domain-containing family protein 2 (YTHDF2)
 Regulator Info 
In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03330
 Crosstalk Info 
Epigenetic Regulator Lysine-specific demethylase 5A (KDM5A)
Regulated Target Histone H3 lysine 4 trimethylation (H3K4me3)
Crosstalk relationship Histone modification → m6A
Disease Prostate cancer
 Disease Info 
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00625)
Homeobox protein Nkx-3.1 (NKX3-1)
N6-methyladenosine (m6A)
In total 41 m6A sequence/site(s) in this target gene
mod ID: M6ASITE084189 Click to Show/Hide the Full List
mod site chr8:23679194-23679195:- [2]
Sequence TGAATTGCTTTCTGCTCTTTACATTTCTTTTAAAATAAGCA
Motif Score 2.07285119
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000380871.5
External Link RMBase: m6A_site_790389
mod ID: M6ASITE084190 Click to Show/Hide the Full List
mod site chr8:23679256-23679257:- [2]
Sequence TTCAATGCCACGTGCTGCTGACACCGACCGGAGTACTAGCC
Motif Score 2.859755952
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000380871.5
External Link RMBase: m6A_site_790390
mod ID: M6ASITE084191 Click to Show/Hide the Full List
mod site chr8:23679313-23679314:- [2]
Sequence ATAGAAAGTTGGCCAATTTCACCCCATTTTCTGTGGTTTGG
Motif Score 2.026654762
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000380871.5
External Link RMBase: m6A_site_790391
mod ID: M6ASITE084192 Click to Show/Hide the Full List
mod site chr8:23679422-23679423:- [2]
Sequence GGGAGTCTCTTGACTCCACTACTTAATTCCGTTTAGTGAGA
Motif Score 2.500660714
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000380871.5
External Link RMBase: m6A_site_790392
mod ID: M6ASITE084193 Click to Show/Hide the Full List
mod site chr8:23679479-23679480:- [2]
Sequence AGACATTAGAAAAAAATGAAACAACAAAACAATTACTAATG
Motif Score 2.20572619
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000380871.5
External Link RMBase: m6A_site_790393
mod ID: M6ASITE084194 Click to Show/Hide the Full List
mod site chr8:23679497-23679498:- [2]
Sequence GGTGAGCTGGTAGAGGGGAGACATTAGAAAAAAATGAAACA
Motif Score 2.897386905
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000380871.5
External Link RMBase: m6A_site_790394
mod ID: M6ASITE084195 Click to Show/Hide the Full List
mod site chr8:23679632-23679633:- [2]
Sequence ACTGTCCAAATGCTTTGGGAACTGTGTTTATTGCCTATAAT
Motif Score 3.373380952
Cell/Tissue List HEK293T; Jurkat
Seq Type List DART-seq; m6A-seq
Transcript ID List ENST00000380871.5
External Link RMBase: m6A_site_790395
mod ID: M6ASITE084196 Click to Show/Hide the Full List
mod site chr8:23679652-23679653:- [2]
Sequence ATTCTAAAACACAACAAGAAACTGTCCAAATGCTTTGGGAA
Motif Score 2.627720238
Cell/Tissue List HEK293T; Jurkat
Seq Type List DART-seq; m6A-seq
Transcript ID List ENST00000380871.5
External Link RMBase: m6A_site_790396
mod ID: M6ASITE084197 Click to Show/Hide the Full List
mod site chr8:23679662-23679663:- [2]
Sequence AAGGAAAACCATTCTAAAACACAACAAGAAACTGTCCAAAT
Motif Score 2.084928571
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000380871.5
External Link RMBase: m6A_site_790397
mod ID: M6ASITE084198 Click to Show/Hide the Full List
mod site chr8:23679664-23679665:- [3]
Sequence AAAAGGAAAACCATTCTAAAACACAACAAGAAACTGTCCAA
Motif Score 2.20572619
Cell/Tissue List Jurkat
Seq Type List m6A-seq
Transcript ID List ENST00000380871.5
External Link RMBase: m6A_site_790398
mod ID: M6ASITE084199 Click to Show/Hide the Full List
mod site chr8:23679675-23679676:- [2]
Sequence AAAGGCTAAGAAAAAGGAAAACCATTCTAAAACACAACAAG
Motif Score 2.185083333
Cell/Tissue List HEK293T; Jurkat
Seq Type List DART-seq; m6A-seq
Transcript ID List ENST00000380871.5
External Link RMBase: m6A_site_790399
mod ID: M6ASITE084200 Click to Show/Hide the Full List
mod site chr8:23679717-23679718:- [4]
Sequence GTCCACTGAGCAAGCAAGGGACTGAGTGAGCCTTTTGCAGG
Motif Score 4.065041667
Cell/Tissue List HeLa; HEK293T; Jurkat
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000380871.5
External Link RMBase: m6A_site_790400
mod ID: M6ASITE084201 Click to Show/Hide the Full List
mod site chr8:23679775-23679776:- [4]
Sequence GTGGAGGGCTCATGGGTGGGACATGGAAAAGAAGGCAGCCT
Motif Score 3.643047619
Cell/Tissue List HeLa; HEK293T
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000380871.5
External Link RMBase: m6A_site_790401
mod ID: M6ASITE084202 Click to Show/Hide the Full List
mod site chr8:23679836-23679837:- [2]
Sequence TGGATTTTCACAGAGGAAGAACACAGCGCAGAATGAAGGGC
Motif Score 2.951386905
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000380871.5
External Link RMBase: m6A_site_790402
mod ID: M6ASITE084203 Click to Show/Hide the Full List
mod site chr8:23679899-23679900:- [2]
Sequence GCTGTTACGTTTGAAGTCTGACAATCCTTGAGAATCTTTGC
Motif Score 2.859755952
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000380871.5
External Link RMBase: m6A_site_790403
mod ID: M6ASITE084204 Click to Show/Hide the Full List
mod site chr8:23679913-23679914:- [2]
Sequence CTTCTGGTGGTTCTGCTGTTACGTTTGAAGTCTGACAATCC
Motif Score 2.046785714
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000380871.5
External Link RMBase: m6A_site_790404
mod ID: M6ASITE084205 Click to Show/Hide the Full List
mod site chr8:23679949-23679950:- [2]
Sequence GACAGCTTGAGAAGGTCACTACTGCATTTATAGGACCTTCT
Motif Score 2.500660714
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000380871.5
External Link RMBase: m6A_site_790405
mod ID: M6ASITE084206 Click to Show/Hide the Full List
mod site chr8:23680005-23680006:- [2]
Sequence TATTTCTTTCCTTTAAAAATACATAGCATTAAATCCCAAAT
Motif Score 2.110482143
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000380871.5
External Link RMBase: m6A_site_790406
mod ID: M6ASITE084207 Click to Show/Hide the Full List
mod site chr8:23680030-23680031:- [2]
Sequence ATGCATTTTTAAAACTAGCAACTCTTATTTCTTTCCTTTAA
Motif Score 2.595904762
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000380871.5
External Link RMBase: m6A_site_790407
mod ID: M6ASITE084208 Click to Show/Hide the Full List
mod site chr8:23680037-23680038:- [2]
Sequence AAAAGACATGCATTTTTAAAACTAGCAACTCTTATTTCTTT
Motif Score 2.627720238
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000380871.5
External Link RMBase: m6A_site_790408
mod ID: M6ASITE084209 Click to Show/Hide the Full List
mod site chr8:23680052-23680053:- [2]
Sequence GATTCTGAATTGGCTAAAAGACATGCATTTTTAAAACTAGC
Motif Score 2.897386905
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000380871.5
External Link RMBase: m6A_site_790409
mod ID: M6ASITE084210 Click to Show/Hide the Full List
mod site chr8:23680096-23680097:- [2]
Sequence CCAAAGCTTTATCTGTCTTGACTTTTTAAAAAAGTTTGGGG
Motif Score 3.28175
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000380871.5
External Link RMBase: m6A_site_790410
mod ID: M6ASITE084211 Click to Show/Hide the Full List
mod site chr8:23680790-23680791:- [4]
Sequence GATGTCACCAACTGAATTAAACTTAAGTCCAGAAGCCTCCT
Motif Score 2.627720238
Cell/Tissue List HeLa; HEK293T; A549; Huh7; Jurkat; HEK293A-TOA; iSLK; MSC; TIME
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000380871.5
External Link RMBase: m6A_site_790411
mod ID: M6ASITE084212 Click to Show/Hide the Full List
mod site chr8:23680824-23680825:- [4]
Sequence CAAACCTAACAGGAGAAAGGACAACCAGGATGAGGATGTCA
Motif Score 3.643047619
Cell/Tissue List HeLa; HEK293T; A549; hESC-HEK293T; CD8T; Huh7; HEK293A-TOA; iSLK; MSC; TIME
Seq Type List m6A-seq; MeRIP-seq; MAZTER-seq; m6A-CLIP/IP
Transcript ID List ENST00000380871.5
External Link RMBase: m6A_site_790412
mod ID: M6ASITE084213 Click to Show/Hide the Full List
mod site chr8:23680841-23680842:- [4]
Sequence TATCAACTCTGAAAGAGCAAACCTAACAGGAGAAAGGACAA
Motif Score 2.185083333
Cell/Tissue List HeLa; A549; CD8T; Huh7; HEK293A-TOA; iSLK; MSC; TIME
Seq Type List m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List ENST00000380871.5
External Link RMBase: m6A_site_790413
mod ID: M6ASITE084214 Click to Show/Hide the Full List
mod site chr8:23681050-23681051:- [4]
Sequence GAGACAATGAAACAACAGAGACAGTGAAAGTTTTAATACCT
Motif Score 2.897386905
Cell/Tissue List HeLa; HEK293T; A549; hESC-HEK293T; U2OS; Huh7; Jurkat; HEK293A-TOA; iSLK; MSC; TIME
Seq Type List m6A-seq; MeRIP-seq; MAZTER-seq
Transcript ID List ENST00000380871.5; ENST00000523261.1
External Link RMBase: m6A_site_790414
mod ID: M6ASITE084215 Click to Show/Hide the Full List
mod site chr8:23681059-23681060:- [4]
Sequence TTCACTGGTGAGACAATGAAACAACAGAGACAGTGAAAGTT
Motif Score 2.20572619
Cell/Tissue List HeLa; HEK293T; A549; hESC-HEK293T; U2OS; fibroblasts; CD8T; Huh7; Jurkat; HEK293A-TOA; iSLK; MSC; TIME
Seq Type List m6A-seq; MeRIP-seq; MAZTER-seq; m6A-CLIP/IP
Transcript ID List ENST00000523261.1; ENST00000380871.5
External Link RMBase: m6A_site_790415
mod ID: M6ASITE084216 Click to Show/Hide the Full List
mod site chr8:23681067-23681068:- [4]
Sequence TCAGATTCTTCACTGGTGAGACAATGAAACAACAGAGACAG
Motif Score 2.897386905
Cell/Tissue List HeLa; HEK293T; A549; U2OS; fibroblasts; Huh7; Jurkat; HEK293A-TOA; iSLK; MSC; TIME
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000523261.1; ENST00000380871.5
External Link RMBase: m6A_site_790416
mod ID: M6ASITE084217 Click to Show/Hide the Full List
mod site chr8:23681186-23681187:- [4]
Sequence GACAACCATTATGATCAAAAACTGCCTTCCCCAGGGTGTCT
Motif Score 2.627720238
Cell/Tissue List HeLa; HEK293T; A549; HepG2; U2OS; fibroblasts; GM12878; Huh7; Jurkat; HEK293A-TOA; iSLK; MSC; TIME
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000523261.1; ENST00000380871.5
External Link RMBase: m6A_site_790417
mod ID: M6ASITE084218 Click to Show/Hide the Full List
mod site chr8:23681356-23681357:- [4]
Sequence GCTCTCCTCGGAGCTGGGAGACTTGGAGAAGCACTCCTCTT
Motif Score 3.319380952
Cell/Tissue List HeLa; HepG2; HEK293T; A549; U2OS; H1B; H1A; hESCs; fibroblasts; GM12878; Huh7; Jurkat; HEK293A-TOA; iSLK; MSC; TIME
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000523261.1; ENST00000380871.5
External Link RMBase: m6A_site_790418
mod ID: M6ASITE084219 Click to Show/Hide the Full List
mod site chr8:23681390-23681391:- [4]
Sequence TCCAGAACAGACGCTATAAGACTAAGCGAAAGCAGCTCTCC
Motif Score 3.319380952
Cell/Tissue List HeLa; HepG2; HEK293T; A549; U2OS; H1B; H1A; hESCs; fibroblasts; GM12878; Jurkat; HEK293A-TOA; iSLK; MSC; TIME; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000523261.1; ENST00000380871.5
External Link RMBase: m6A_site_790419
mod ID: M6ASITE084220 Click to Show/Hide the Full List
mod site chr8:23681400-23681401:- [5]
Sequence AAGATATGGTTCCAGAACAGACGCTATAAGACTAAGCGAAA
Motif Score 2.871321429
Cell/Tissue List CD8T
Seq Type List m6A-CLIP/IP
Transcript ID List ENST00000380871.5; ENST00000523261.1
External Link RMBase: m6A_site_790420
mod ID: M6ASITE084221 Click to Show/Hide the Full List
mod site chr8:23681404-23681405:- [4]
Sequence AGTGAAGATATGGTTCCAGAACAGACGCTATAAGACTAAGC
Motif Score 2.951386905
Cell/Tissue List HeLa; HepG2; HEK293T; A549; hESC-HEK293T; U2OS; H1B; H1A; hESCs; fibroblasts; GM12878; CD8T; Jurkat; HEK293A-TOA; iSLK; MSC; TIME; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq; MAZTER-seq; m6A-CLIP/IP
Transcript ID List ENST00000523261.1; ENST00000380871.5
External Link RMBase: m6A_site_790421
mod ID: M6ASITE084222 Click to Show/Hide the Full List
mod site chr8:23681429-23681430:- [4]
Sequence AGAACCTCAAGCTCACGGAGACCCAAGTGAAGATATGGTTC
Motif Score 2.876744048
Cell/Tissue List HeLa; HepG2; HEK293T; A549; U2OS; H1B; H1A; hESCs; fibroblasts; GM12878; Jurkat; HEK293A-TOA; iSLK; MSC; TIME; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000380871.5; ENST00000523261.1
External Link RMBase: m6A_site_790422
mod ID: M6ASITE084223 Click to Show/Hide the Full List
mod site chr8:23681446-23681447:- [4]
Sequence ACGGGCCCACCTGGCCAAGAACCTCAAGCTCACGGAGACCC
Motif Score 2.930744048
Cell/Tissue List HeLa; HepG2; HEK293T; A549; U2OS; H1A; hESCs; Jurkat; HEK293A-TOA; iSLK; MSC; TIME; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000523261.1; ENST00000380871.5
External Link RMBase: m6A_site_790423
mod ID: M6ASITE084224 Click to Show/Hide the Full List
mod site chr8:23681570-23681571:- [4]
Sequence CCCTTCCAAGGCTTCCCCAAACCCCTAAGCAGCCGCAGAAG
Motif Score 2.185083333
Cell/Tissue List HeLa; A549; U2OS; Jurkat; GSC-11; HEK293T; HEK293A-TOA; iSLK; MSC; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000523261.1; ENST00000380871.5
External Link RMBase: m6A_site_790424
mod ID: M6ASITE084225 Click to Show/Hide the Full List
mod site chr8:23681602-23681603:- [6]
Sequence TTATCTGTTGGACTCTGAAAACACTTCAGGCGCCCTTCCAA
Motif Score 2.20572619
Cell/Tissue List A549; U2OS; Jurkat; GSC-11; HEK293T; HEK293A-TOA; iSLK; MSC; HEC-1-A
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000523261.1; ENST00000380871.5
External Link RMBase: m6A_site_790425
mod ID: M6ASITE084226 Click to Show/Hide the Full List
mod site chr8:23681611-23681612:- [6]
Sequence CTTGGGGTCTTATCTGTTGGACTCTGAAAACACTTCAGGCG
Motif Score 4.065041667
Cell/Tissue List A549; U2OS; Jurkat; GSC-11; HEK293T; HEK293A-TOA; iSLK; MSC; HEC-1-A
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000523261.1; ENST00000380871.5
External Link RMBase: m6A_site_790426
mod ID: M6ASITE084227 Click to Show/Hide the Full List
mod site chr8:23682612-23682613:- [4]
Sequence AGGCCGAGACGCTGGCAGAGACCGAGCCAGGTAAGCGGCGA
Motif Score 2.876744048
Cell/Tissue List HeLa; HepG2; A549; HEK293T; Jurkat; GSC-11; HEK293A-TOA; iSLK; MSC; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000523261.1; ENST00000380871.5
External Link RMBase: m6A_site_790427
mod ID: M6ASITE084228 Click to Show/Hide the Full List
mod site chr8:23682739-23682740:- [4]
Sequence GGCCGCACGAGCAGCCAGAGACAGCGCGACCCGGAGCCGGA
Motif Score 2.897386905
Cell/Tissue List HeLa; HepG2; A549; U2OS; Jurkat; GSC-11; HEK293T; HEK293A-TOA; iSLK; MSC; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000523261.1; ENST00000380871.5
External Link RMBase: m6A_site_790428
mod ID: M6ASITE084229 Click to Show/Hide the Full List
mod site chr8:23682791-23682792:- [4]
Sequence CACGTCCTTCCTCATCCAGGACATCCTGCGGGACGGCGCGC
Motif Score 3.643047619
Cell/Tissue List HeLa; A549; U2OS; Jurkat; GSC-11; HEK293T; iSLK; TIME; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000523261.1; ENST00000380871.5
External Link RMBase: m6A_site_790429