m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00615)

Target Name	Tissue factor pathway inhibitor 2 (TFPI-2)
Synonyms	TFPI-2; Placental protein 5; PP5 Click to Show/Hide
Gene Name	TFPI-2
Chromosomal Location	7q21.3
Function	May play a role in the regulation of plasmin-mediated matrix remodeling. Inhibits trypsin, plasmin, factor VIIa/tissue factor and weakly factor Xa. Has no effect on thrombin. Click to Show/Hide
Gene ID	7980
Uniprot ID	TFPI2_HUMAN
HGNC ID	HGNC:11761
KEGG ID	hsa:7980

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

TFPI-2 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Fat mass and obesity-associated protein (FTO) [ERASER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by FTO*
Cell Line	253J cell line	Homo sapiens
Treatment: siFTO 253J cells Control: 253J cells		GSE150239
Regulation		logFC: 1.23E+01 p-value: 1.69E-03
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene			[1]
Response Summary	Knockdown of FTO increases m6A methylation of Tissue factor pathway inhibitor 2 (TFPI-2) mRNA in PC cells, thereby increasing mRNA stability via the m6A reader YTHDF1.
Target Regulation	Down regulation
Responsed Disease	Pancreatic cancer	ICD-11: 2C10	Disease Info
Cell Process	Cell growth
	cell migration
	cell invasion

YTH domain-containing family protein 1 (YTHDF1) [READER]

Regulator Info

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene			[1]
Response Summary	Knockdown of FTO increases m6A methylation of Tissue factor pathway inhibitor 2 (TFPI-2) mRNA in PC cells, thereby increasing mRNA stability via the m6A reader YTHDF1.
Target Regulation	Up regulation
Responsed Disease	Pancreatic cancer	ICD-11: 2C10	Disease Info
Cell Process	Cell growth
	cell migration
	cell invasion

Pancreatic cancer [ICD-11: 2C10]

Disease Info

In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response			[1]
Response Summary	Knockdown of FTO increases m6A methylation of Tissue factor pathway inhibitor 2 (TFPI-2) mRNA in PC cells, thereby increasing mRNA stability via the m6A reader YTHDF1.
Responsed Disease	Pancreatic cancer [ICD-11: 2C10]
Target Regulator	Fat mass and obesity-associated protein (FTO)	ERASER	Regulator Info
Target Regulation	Down regulation
Cell Process	Cell growth
	cell migration
	cell invasion
Experiment 2 Reporting the m6A-centered Disease Response			[1]
Response Summary	Knockdown of FTO increases m6A methylation of Tissue factor pathway inhibitor 2 (TFPI-2) mRNA in PC cells, thereby increasing mRNA stability via the m6A reader YTHDF1.
Responsed Disease	Pancreatic cancer [ICD-11: 2C10]
Target Regulator	YTH domain-containing family protein 1 (YTHDF1)	READER	Regulator Info
Target Regulation	Up regulation
Cell Process	Cell growth
	cell migration
	cell invasion

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00615)

Tissue factor pathway inhibitor 2 (TFPI-2)

N6-methyladenosine (m6A)

In total 18 m6A sequence/site(s) in this target gene
mod ID: M6ASITE080975		Click to Show/Hide the Full List
mod site	chr7:93885575-93885576:-		[2]
Sequence	ATAAACACACATATACACAAACATCACAGAAGATACTAAAG
Motif Score	2.20572619
Cell/Tissue List	HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000222543.11
External Link	RMBase: m6A_site_765424
mod ID: M6ASITE080976		Click to Show/Hide the Full List
mod site	chr7:93885591-93885592:-		[2]
Sequence	GCCTAGAACAGTATGAATAAACACACATATACACAAACATC
Motif Score	2.20572619
Cell/Tissue List	HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000222543.11
External Link	RMBase: m6A_site_765425
mod ID: M6ASITE080977		Click to Show/Hide the Full List
mod site	chr7:93885604-93885605:-		[2]
Sequence	TAAGAAACACAGGGCCTAGAACAGTATGAATAAACACACAT
Motif Score	2.951386905
Cell/Tissue List	HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000222543.11
External Link	RMBase: m6A_site_765426
mod ID: M6ASITE080978		Click to Show/Hide the Full List
mod site	chr7:93885618-93885619:-		[2]
Sequence	ACTCCCAGGATACATAAGAAACACAGGGCCTAGAACAGTAT
Motif Score	2.20572619
Cell/Tissue List	HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000222543.11
External Link	RMBase: m6A_site_765427
mod ID: M6ASITE080979		Click to Show/Hide the Full List
mod site	chr7:93886387-93886388:-		[3]
Sequence	TATATTTTAGTCCCAAGAAGACAAAGTCGCAGATTAACAAC
Motif Score	2.897386905
Cell/Tissue List	fibroblasts; A549
Seq Type List	m6A-seq
Transcript ID List	ENST00000649730.1; ENST00000222543.11
External Link	RMBase: m6A_site_765428
mod ID: M6ASITE080980		Click to Show/Hide the Full List
mod site	chr7:93886433-93886434:-		[3]
Sequence	AAAAAGGACTAGCAAATAAAACTCATTTTGCATTTAAAAGT
Motif Score	2.627720238
Cell/Tissue List	fibroblasts; A549; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000649730.1; ENST00000222543.11; ENST00000451238.1
External Link	RMBase: m6A_site_765429
mod ID: M6ASITE080981		Click to Show/Hide the Full List
mod site	chr7:93886446-93886447:-		[3]
Sequence	CATATTTGAGAATAAAAAGGACTAGCAAATAAAACTCATTT
Motif Score	4.065041667
Cell/Tissue List	fibroblasts; A549; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000649730.1; ENST00000451238.1; ENST00000222543.11
External Link	RMBase: m6A_site_765430
mod ID: M6ASITE080982		Click to Show/Hide the Full List
mod site	chr7:93886489-93886490:-		[3]
Sequence	CATAACTGAAACAACATAAGACAATATAATCATGTGCTTTT
Motif Score	2.897386905
Cell/Tissue List	fibroblasts; A549; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000650573.1; ENST00000649730.1; ENST00000222543.11; ENST00000451238.1
External Link	RMBase: m6A_site_765431
mod ID: M6ASITE080983		Click to Show/Hide the Full List
mod site	chr7:93886499-93886500:-		[3]
Sequence	AGAAGAGGATCATAACTGAAACAACATAAGACAATATAATC
Motif Score	2.20572619
Cell/Tissue List	A549; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000650573.1; ENST00000451238.1; ENST00000222543.11; ENST00000649730.1
External Link	RMBase: m6A_site_765432
mod ID: M6ASITE080984		Click to Show/Hide the Full List
mod site	chr7:93887347-93887348:-		[2]
Sequence	ATTTTAATCCAAGATACAGAACCTGTGATGCTTTCACCTAT
Motif Score	2.930744048
Cell/Tissue List	HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000649730.1; ENST00000451238.1; ENST00000650573.1; ENST00000222543.11
External Link	RMBase: m6A_site_765433
mod ID: M6ASITE080985		Click to Show/Hide the Full List
mod site	chr7:93887352-93887353:-		[4]
Sequence	CTATTATTTTAATCCAAGATACAGAACCTGTGATGCTTTCA
Motif Score	2.110482143
Cell/Tissue List	liver
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000222543.11; ENST00000451238.1; ENST00000650573.1; ENST00000649730.1
External Link	RMBase: m6A_site_765434
mod ID: M6ASITE080986		Click to Show/Hide the Full List
mod site	chr7:93887396-93887397:-		[2]
Sequence	TACAGTCCAAAAGATGAGGGACTGTGCTCTGCCAATGTGAC
Motif Score	4.065041667
Cell/Tissue List	HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000222543.11; ENST00000650573.1; ENST00000451238.1; ENST00000649730.1; ENST00000647793.1; ENST00000649913.1
External Link	RMBase: m6A_site_765435
mod ID: M6ASITE080987		Click to Show/Hide the Full List
mod site	chr7:93889084-93889085:-		[2]
Sequence	TCACCGGAACCGGATTGAGAACAGGTTTCCAGATGAAGCTA
Motif Score	2.951386905
Cell/Tissue List	HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000649730.1; ENST00000650573.1; ENST00000649913.1; ENST00000222543.11; ENST00000451238.1; ENST00000647793.1
External Link	RMBase: m6A_site_765436
mod ID: M6ASITE080988		Click to Show/Hide the Full List
mod site	chr7:93889096-93889097:-		[2]
Sequence	TTCCGGTGGGTGTCACCGGAACCGGATTGAGAACAGGTTTC
Motif Score	2.930744048
Cell/Tissue List	HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000649730.1; ENST00000650573.1; ENST00000451238.1; ENST00000647793.1; ENST00000649913.1; ENST00000222543.11
External Link	RMBase: m6A_site_765437
mod ID: M6ASITE080989		Click to Show/Hide the Full List
mod site	chr7:93890111-93890112:-		[5]
Sequence	GTGCCCTGCGCGCACCCAGGACTCTCGCGCTCCTTGCGCCG
Motif Score	4.065041667
Cell/Tissue List	MSC; TIME; HEC-1-A
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000461482.1; ENST00000222543.11; ENST00000647793.1; ENST00000649730.1; ENST00000649913.1; ENST00000650573.1; ENST00000451238.1
External Link	RMBase: m6A_site_765438
mod ID: M6ASITE080990		Click to Show/Hide the Full List
mod site	chr7:93890278-93890279:-		[6]
Sequence	CTCCTGCCCCTAGACTACGGACCCTGCCGGGCCCTACTTCT
Motif Score	3.622404762
Cell/Tissue List	A549; GSC-11; MSC; TIME; iSLK; HEC-1-A
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000222543.11; ENST00000649730.1; ENST00000650573.1; ENST00000461482.1; ENST00000647793.1; ENST00000649913.1
External Link	RMBase: m6A_site_765439
mod ID: M6ASITE080991		Click to Show/Hide the Full List
mod site	chr7:93890285-93890286:-		[6]
Sequence	GATCTGTCTCCTGCCCCTAGACTACGGACCCTGCCGGGCCC
Motif Score	3.319380952
Cell/Tissue List	A549; GSC-11; MSC; TIME; iSLK; HEC-1-A
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000647793.1; ENST00000222543.11; ENST00000649913.1; ENST00000649730.1; ENST00000650573.1; ENST00000461482.1
External Link	RMBase: m6A_site_765440
mod ID: M6ASITE080992		Click to Show/Hide the Full List
mod site	chr7:93890673-93890674:-		[6]
Sequence	CCCGACCCCCTGCACCATGGACCCCGCTCGCCCCCTGGGGC
Motif Score	3.622404762
Cell/Tissue List	A549; H1A; fibroblasts; GSC-11; iSLK; MSC; TIME; endometrial; HEC-1-A
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000222543.11; ENST00000649730.1; ENST00000649913.1; ENST00000647793.1; ENST00000650573.1; ENST00000461482.1
External Link	RMBase: m6A_site_765441

Ref 1	m(6)A RNA demethylase FTO promotes the growth, migration and invasion of pancreatic cancer cells through inhibiting TFPI-2. Epigenetics. 2022 Apr 11:1-15. doi: 10.1080/15592294.2022.2061117. Online ahead of print.
Ref 2	m(6)A mRNA methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer. Nat Cell Biol. 2018 Sep;20(9):1074-1083. doi: 10.1038/s41556-018-0174-4. Epub 2018 Aug 27.
Ref 3	Perturbation of m6A writers reveals two distinct classes of mRNA methylation at internal and 5' sites. Cell Rep. 2014 Jul 10;8(1):284-96. doi: 10.1016/j.celrep.2014.05.048. Epub 2014 Jun 26.
Ref 4	Single-base mapping of m(6)A by an antibody-independent method. Sci Adv. 2019 Jul 3;5(7):eaax0250. doi: 10.1126/sciadv.aax0250. eCollection 2019 Jul.
Ref 5	Viral and cellular N(6)-methyladenosine and N(6),2'-O-dimethyladenosine epitranscriptomes in the KSHV life cycle. Nat Microbiol. 2018 Jan;3(1):108-120. doi: 10.1038/s41564-017-0056-8. Epub 2017 Nov 6.
Ref 6	Viral N(6)-methyladenosine upregulates replication and pathogenesis of human respiratory syncytial virus. Nat Commun. 2019 Oct 9;10(1):4595. doi: 10.1038/s41467-019-12504-y.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map