m6A Target Gene Information
General Information of the m6A Target Gene (ID: M6ATAR00614)
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
CTNNBIP1
can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Methyltransferase-like 3 (METTL3) [WRITER]
| Representative RNA-seq result indicating the expression of this target gene regulated by METTL3 | ||
| Cell Line | Caco-2 cell line | Homo sapiens |
|
Treatment: shMETTL3 Caco-2 cells
Control: shNTC Caco-2 cells
|
GSE167075 | |
| Regulation |
![]() ![]() |
logFC: -1.02E+00 p-value: 3.20E-17 |
| More Results | Click to View More RNA-seq Results | |
| Representative RIP-seq result supporting the interaction between CTNNBIP1 and the regulator | ||
| Cell Line | MDA-MB-231 | Homo sapiens |
| Regulation | logFC: 1.17E+00 | GSE60213 |
| In total 1 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [1] | |||
| Response Summary | METTL3-mediated m6A modification upregulated circDLC1 expression, and circDLC1 promoted Beta-catenin-interacting protein 1 (CTNNBIP1) transcription by sponging miR-671-5p, thus repressing the malignant proliferation of glioma. | |||
| Target Regulation | Up regulation | |||
| Responsed Disease | Glioma | ICD-11: 2A00.0 | ||
| In-vitro Model | T98G | Glioblastoma | Homo sapiens | CVCL_0556 |
| LN-229 | Glioblastoma | Homo sapiens | CVCL_0393 | |
| LN-18 | Glioblastoma | Homo sapiens | CVCL_0392 | |
| HEB (human normal glial cell line HEB were obtained from Tongpai (Shanghai) biotechnology co., LTD (Shanghai, China)) | ||||
| A-172 | Glioblastoma | Homo sapiens | CVCL_0131 | |
Brain cancer [ICD-11: 2A00]
| In total 1 item(s) under this disease | ||||
| Experiment 1 Reporting the m6A-centered Disease Response | [1] | |||
| Response Summary | METTL3-mediated m6A modification upregulated circDLC1 expression, and circDLC1 promoted Beta-catenin-interacting protein 1 (CTNNBIP1) transcription by sponging miR-671-5p, thus repressing the malignant proliferation of glioma. | |||
| Responsed Disease | Glioma [ICD-11: 2A00.0] | |||
| Target Regulator | Methyltransferase-like 3 (METTL3) | WRITER | ||
| Target Regulation | Up regulation | |||
| In-vitro Model | T98G | Glioblastoma | Homo sapiens | CVCL_0556 |
| LN-229 | Glioblastoma | Homo sapiens | CVCL_0393 | |
| LN-18 | Glioblastoma | Homo sapiens | CVCL_0392 | |
| HEB (human normal glial cell line HEB were obtained from Tongpai (Shanghai) biotechnology co., LTD (Shanghai, China)) | ||||
| A-172 | Glioblastoma | Homo sapiens | CVCL_0131 | |
Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator
Histone modification
m6A Regulator: Methyltransferase-like 3 (METTL3)
| In total 1 item(s) under this m6A regulator | ||
| Crosstalk ID: M6ACROT03319 | ||
| Epigenetic Regulator | Probable JmjC domain-containing histone demethylation protein 2C (JMJD1C) | |
| Regulated Target | Histone H3 lysine 9 monomethylation (H3K9me1) | |
| Crosstalk relationship | Histone modification → m6A | |
| Disease | Brain cancer | |
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00614)
| In total 2 m6A sequence/site(s) in this target gene | |||
| mod ID: A2ISITE000697 | Click to Show/Hide the Full List | ||
| mod site | chr1:9863964-9863965:- | [2] | |
| Sequence | AAATATCTGTGGTCATGGGTAGATCAGCAGAAACCAGGCTG | ||
| Transcript ID List | ENST00000377263.6; ENST00000377258.5; ENST00000377256.1; ENST00000400904.7 | ||
| External Link | RMBase: RNA-editing_site_1095 | ||
| mod ID: A2ISITE000699 | Click to Show/Hide the Full List | ||
| mod site | chr1:9887536-9887537:- | [2] | |
| Sequence | CTAATTTTTGTAATTTTAGTAGAGACAGGGTTTTACTATGT | ||
| Transcript ID List | ENST00000377258.5; ENST00000400904.7; ENST00000377263.6 | ||
| External Link | RMBase: RNA-editing_site_1096 | ||
5-methylcytidine (m5C)
N6-methyladenosine (m6A)
| In total 32 m6A sequence/site(s) in this target gene | |||
| mod ID: M6ASITE061711 | Click to Show/Hide the Full List | ||
| mod site | chr1:9848297-9848298:- | [3] | |
| Sequence | TCTGTTGGAGAAAGAAATTAACAATAAAGAATTTTCATAGG | ||
| Motif Score | 2.168095238 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000377263.6 | ||
| External Link | RMBase: m6A_site_5983 | ||
| mod ID: M6ASITE061712 | Click to Show/Hide the Full List | ||
| mod site | chr1:9848401-9848402:- | [3] | |
| Sequence | TCACAGGCCTTGCTTTTGTAACAATGATGACCCCGGCCTGT | ||
| Motif Score | 2.168095238 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000377263.6 | ||
| External Link | RMBase: m6A_site_5984 | ||
| mod ID: M6ASITE061713 | Click to Show/Hide the Full List | ||
| mod site | chr1:9848419-9848420:- | [4] | |
| Sequence | AGCCTGTCCTTGTCACGATCACAGGCCTTGCTTTTGTAACA | ||
| Motif Score | 2.047297619 | ||
| Cell/Tissue List | kidney | ||
| Seq Type List | m6A-REF-seq | ||
| Transcript ID List | ENST00000377263.6 | ||
| External Link | RMBase: m6A_site_5985 | ||
| mod ID: M6ASITE061714 | Click to Show/Hide the Full List | ||
| mod site | chr1:9848480-9848481:- | [4] | |
| Sequence | GTAGCTCCTATAAAGGGCCCACACCTGGTGGATACCTGGTT | ||
| Motif Score | 2.053113095 | ||
| Cell/Tissue List | liver; hESC-HEK293T | ||
| Seq Type List | m6A-REF-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000377263.6 | ||
| External Link | RMBase: m6A_site_5986 | ||
| mod ID: M6ASITE061715 | Click to Show/Hide the Full List | ||
| mod site | chr1:9848523-9848524:- | [3] | |
| Sequence | TGGAGTCAGGTGTCGAGGCCACATTGCTGGCTGCCCCCTCT | ||
| Motif Score | 2.053113095 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000377263.6 | ||
| External Link | RMBase: m6A_site_5987 | ||
| mod ID: M6ASITE061716 | Click to Show/Hide the Full List | ||
| mod site | chr1:9848670-9848671:- | [3] | |
| Sequence | CATGTGCTGTGTGAGTGAGCACACCCGTGTGCACACTCATA | ||
| Motif Score | 2.830589286 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000377263.6 | ||
| External Link | RMBase: m6A_site_5988 | ||
| mod ID: M6ASITE061717 | Click to Show/Hide the Full List | ||
| mod site | chr1:9848746-9848747:- | [3] | |
| Sequence | CAGCTGTGGGGAACACAGCTACAACCCTACCCTGGCAGGGA | ||
| Motif Score | 2.078666667 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000377263.6 | ||
| External Link | RMBase: m6A_site_5989 | ||
| mod ID: M6ASITE061718 | Click to Show/Hide the Full List | ||
| mod site | chr1:9848817-9848818:- | [5] | |
| Sequence | GATTCGAGCATCAGGCTAAGACCCTGTGTCCTCCACCATGC | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000377263.6 | ||
| External Link | RMBase: m6A_site_5990 | ||
| mod ID: M6ASITE061719 | Click to Show/Hide the Full List | ||
| mod site | chr1:9849509-9849510:- | [6] | |
| Sequence | CCCAGGAGACCTCCAGCTAAACACCAACCCCTGACCTACCC | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000377263.6 | ||
| External Link | RMBase: m6A_site_5991 | ||
| mod ID: M6ASITE061720 | Click to Show/Hide the Full List | ||
| mod site | chr1:9849521-9849522:- | [6] | |
| Sequence | TGGCTCACAAGGCCCAGGAGACCTCCAGCTAAACACCAACC | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000377263.6 | ||
| External Link | RMBase: m6A_site_5992 | ||
| mod ID: M6ASITE061721 | Click to Show/Hide the Full List | ||
| mod site | chr1:9849562-9849563:- | [6] | |
| Sequence | GAGGTCTCTGGGAGCCCAGAACCCACATAAAAGCCCCAGCT | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000377263.6 | ||
| External Link | RMBase: m6A_site_5993 | ||
| mod ID: M6ASITE061722 | Click to Show/Hide the Full List | ||
| mod site | chr1:9849602-9849603:- | [6] | |
| Sequence | CCCAGTGTGAGACCCCAAAGACTCTGGAGGTCATCTGGCGG | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000377263.6 | ||
| External Link | RMBase: m6A_site_5994 | ||
| mod ID: M6ASITE061723 | Click to Show/Hide the Full List | ||
| mod site | chr1:9849611-9849612:- | [6] | |
| Sequence | GGAGCTTCTCCCAGTGTGAGACCCCAAAGACTCTGGAGGTC | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000377263.6 | ||
| External Link | RMBase: m6A_site_5995 | ||
| mod ID: M6ASITE061769 | Click to Show/Hide the Full List | ||
| mod site | chr1:9849975-9849976:- | [3] | |
| Sequence | TGAGGGTCCACCTGGAGAGTACATTTGCTTTAATGAGTGCA | ||
| Motif Score | 2.856142857 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000377263.6 | ||
| External Link | RMBase: m6A_site_5996 | ||
| mod ID: M6ASITE061770 | Click to Show/Hide the Full List | ||
| mod site | chr1:9850108-9850109:- | [3] | |
| Sequence | AAGAACTTGCTGCTGCCTTCACATTTGGGGTTTGTGTTTGA | ||
| Motif Score | 2.047297619 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000377263.6; ENST00000400904.7 | ||
| External Link | RMBase: m6A_site_5997 | ||
| mod ID: M6ASITE061771 | Click to Show/Hide the Full List | ||
| mod site | chr1:9850131-9850132:- | [5] | |
| Sequence | CGCTTTGCAATATTTATTACACAAAGAACTTGCTGCTGCCT | ||
| Motif Score | 2.084928571 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000377263.6; ENST00000400904.7 | ||
| External Link | RMBase: m6A_site_5998 | ||
| mod ID: M6ASITE061772 | Click to Show/Hide the Full List | ||
| mod site | chr1:9850133-9850134:- | [5] | |
| Sequence | TGCGCTTTGCAATATTTATTACACAAAGAACTTGCTGCTGC | ||
| Motif Score | 2.07285119 | ||
| Cell/Tissue List | HEK293T; hESC-HEK293T | ||
| Seq Type List | DART-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000400904.7; ENST00000377263.6 | ||
| External Link | RMBase: m6A_site_5999 | ||
| mod ID: M6ASITE061773 | Click to Show/Hide the Full List | ||
| mod site | chr1:9850159-9850160:- | [6] | |
| Sequence | TTTGACTTGAAAAGAAAGAAACCAAGTGCGCTTTGCAATAT | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000400904.7; ENST00000377263.6 | ||
| External Link | RMBase: m6A_site_6000 | ||
| mod ID: M6ASITE061774 | Click to Show/Hide the Full List | ||
| mod site | chr1:9850175-9850176:- | [5] | |
| Sequence | GACATTAGTCGTTATATTTGACTTGAAAAGAAAGAAACCAA | ||
| Motif Score | 3.28175 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000400904.7; ENST00000377263.6 | ||
| External Link | RMBase: m6A_site_6001 | ||
| mod ID: M6ASITE061775 | Click to Show/Hide the Full List | ||
| mod site | chr1:9850194-9850195:- | [6] | |
| Sequence | TGCAGAAAACAGGGTCTGGGACATTAGTCGTTATATTTGAC | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; HEK293T; hESC-HEK293T | ||
| Seq Type List | m6A-seq; DART-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000377263.6; ENST00000400904.7 | ||
| External Link | RMBase: m6A_site_6002 | ||
| mod ID: M6ASITE061795 | Click to Show/Hide the Full List | ||
| mod site | chr1:9850206-9850207:- | [6] | |
| Sequence | CCCTATTTTGAATGCAGAAAACAGGGTCTGGGACATTAGTC | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000377263.6; ENST00000400904.7 | ||
| External Link | RMBase: m6A_site_6003 | ||
| mod ID: M6ASITE061800 | Click to Show/Hide the Full List | ||
| mod site | chr1:9850233-9850234:- | [4] | |
| Sequence | CAGGTGTTCTGCTGATATCAACAGCTTCCCTATTTTGAATG | ||
| Motif Score | 2.173910714 | ||
| Cell/Tissue List | kidney | ||
| Seq Type List | m6A-REF-seq | ||
| Transcript ID List | ENST00000400904.7; ENST00000377263.6 | ||
| External Link | RMBase: m6A_site_6004 | ||
| mod ID: M6ASITE061801 | Click to Show/Hide the Full List | ||
| mod site | chr1:9850309-9850310:- | [5] | |
| Sequence | AGGTCTGATTGGCTGCTTAAACTGGAAAGGATCTGTGATTG | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000400904.7; ENST00000377263.6 | ||
| External Link | RMBase: m6A_site_6005 | ||
| mod ID: M6ASITE061802 | Click to Show/Hide the Full List | ||
| mod site | chr1:9850429-9850430:- | [5] | |
| Sequence | ACCTTTTATTTTTATTTCTGACTCTTATTTTTTAAAAAATT | ||
| Motif Score | 3.28175 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000400904.7; ENST00000377263.6 | ||
| External Link | RMBase: m6A_site_6006 | ||
| mod ID: M6ASITE061803 | Click to Show/Hide the Full List | ||
| mod site | chr1:9850449-9850450:- | [7] | |
| Sequence | TTAAATCTTGACCAACAGAAACCTTTTATTTTTATTTCTGA | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | hESCs | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000400904.7; ENST00000377263.6; ENST00000377258.5 | ||
| External Link | RMBase: m6A_site_6007 | ||
| mod ID: M6ASITE061804 | Click to Show/Hide the Full List | ||
| mod site | chr1:9850482-9850483:- | [7] | |
| Sequence | GTGATTGGCTGCAGGAAGAAACTTTTTTATTTTTTAAATCT | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | hESCs | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000400904.7; ENST00000377263.6; ENST00000377258.5 | ||
| External Link | RMBase: m6A_site_6008 | ||
| mod ID: M6ASITE061805 | Click to Show/Hide the Full List | ||
| mod site | chr1:9850506-9850507:- | [7] | |
| Sequence | TAATTGGCTTAAAGGGATGGACTTGTGATTGGCTGCAGGAA | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | hESCs | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000400904.7; ENST00000377263.6; ENST00000377258.5 | ||
| External Link | RMBase: m6A_site_6009 | ||
| mod ID: M6ASITE061806 | Click to Show/Hide the Full List | ||
| mod site | chr1:9850544-9850545:- | [3] | |
| Sequence | TGGGGCTGGCATCAAGGGAGACACCAGTGGTGCGTTTATAA | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | hESC-HEK293T; hESCs | ||
| Seq Type List | MAZTER-seq; m6A-seq | ||
| Transcript ID List | ENST00000377258.5; ENST00000377263.6; ENST00000400904.7 | ||
| External Link | RMBase: m6A_site_6010 | ||
| mod ID: M6ASITE061807 | Click to Show/Hide the Full List | ||
| mod site | chr1:9850700-9850701:- | [8] | |
| Sequence | GTAGCTGCAAAGCCCTTGGAACACCCTGGATGCTGTTGAGG | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HepG2; hESC-HEK293T; peripheral-blood | ||
| Seq Type List | m6A-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000377258.5; ENST00000377256.1; ENST00000377263.6; ENST00000400904.7 | ||
| External Link | RMBase: m6A_site_6011 | ||
| mod ID: M6ASITE061808 | Click to Show/Hide the Full List | ||
| mod site | chr1:9850730-9850731:- | [9] | |
| Sequence | TTCCAGGTCGGAGACGGAAGACCGGAGGCAGTAGCTGCAAA | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HepG2; peripheral-blood | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000377256.1; ENST00000377258.5; ENST00000400904.7; ENST00000377263.6 | ||
| External Link | RMBase: m6A_site_6012 | ||
| mod ID: M6ASITE061809 | Click to Show/Hide the Full List | ||
| mod site | chr1:9872020-9872021:- | [3] | |
| Sequence | GAAGAGTCCGGAGGAGATGTACATTCAGCAGAAGGTCCGAG | ||
| Motif Score | 2.856142857 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000377256.1; ENST00000377263.6; ENST00000377258.5; ENST00000400904.7 | ||
| External Link | RMBase: m6A_site_6013 | ||
| mod ID: M6ASITE061810 | Click to Show/Hide the Full List | ||
| mod site | chr1:9872059-9872060:- | [8] | |
| Sequence | AGAGCCAGGCAGGGGGATGAACCGCGAGGGAGCTCCCGGGA | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HepG2; endometrial; NB4 | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000377263.6; ENST00000400904.7; ENST00000377256.1; ENST00000377258.5 | ||
| External Link | RMBase: m6A_site_6014 | ||
References

