m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00587)

Target Name	40S ribosomal protein S6 (S6)
Synonyms	Phosphoprotein NP33; Small ribosomal subunit protein eS6 Click to Show/Hide
Gene Name	S6
Chromosomal Location	9p22.1
Family	Eukaryotic ribosomal protein eS6 family
Function	Component of the 40S small ribosomal subunit. Plays an important role in controlling cell growth and proliferation through the selective translation of particular classes of mRNA. Click to Show/Hide
Gene ID	6194
Uniprot ID	RS6_HUMAN
HGNC ID	HGNC:10429
KEGG ID	hsa:6194

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

S6 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

YTH domain-containing protein 2 (YTHDC2) [READER]

Regulator Info

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	YTHDC2 promotes radiotherapy resistance of NPC cells by activating the IGF1R/ATK/40S ribosomal protein S6 (S6) signaling axis and serves as a potential therapeutic target in radiosensitization of NPC cells.
Target Regulation	Up regulation
Responsed Disease	Nasopharyngeal carcinoma		ICD-11: 2B6B	Disease Info
In-vitro Model	HK1-IRR (HK1-IRR (HK1-ionizing radiation radioresistent cell line) was derived from HK1 after a prolonged exposure of irradiation.HK1, a generous gift from Prof. Ya Cao (Cancer Research Institute, Central South University), was established from a recurrent nasopharynx carcinoma of a Chinese 17-year-old male patient)
	NPC/HK1	Nasopharyngeal carcinoma	Homo sapiens	CVCL_7084
	CNE2-IRR (CNE2-IRR (CNE2-ionizing radiation radioresistent cell line) was derived from CNE2 after a prolonged exposure of irradiation)
	CNE-2	Nasopharyngeal carcinoma	Homo sapiens	CVCL_6889
In-vivo Model	2 × 10⁶ cells resuspended in 50 uL of Matrigel (Corning) were subcutaneously injected into 4-6 weeks old male nude mice. When tumor volumes reached 150-200 mm³, animals were divided into control group and radiotherapy group. In the radiotherapy group, tumors were treated with a single irradiation (4 Gy) when tumor volumes reached approximately 150-200 mm³. The tumor stopped growing in the next few days and then restarted growth.

Nasopharyngeal carcinoma [ICD-11: 2B6B]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	YTHDC2 promotes radiotherapy resistance of NPC cells by activating the IGF1R/ATK/40S ribosomal protein S6 (S6) signaling axis and serves as a potential therapeutic target in radiosensitization of NPC cells.
Responsed Disease	Nasopharyngeal carcinoma [ICD-11: 2B6B]
Target Regulator	YTH domain-containing protein 2 (YTHDC2)		READER	Regulator Info
Target Regulation	Up regulation
In-vitro Model	HK1-IRR (HK1-IRR (HK1-ionizing radiation radioresistent cell line) was derived from HK1 after a prolonged exposure of irradiation.HK1, a generous gift from Prof. Ya Cao (Cancer Research Institute, Central South University), was established from a recurrent nasopharynx carcinoma of a Chinese 17-year-old male patient)
	NPC/HK1	Nasopharyngeal carcinoma	Homo sapiens	CVCL_7084
	CNE2-IRR (CNE2-IRR (CNE2-ionizing radiation radioresistent cell line) was derived from CNE2 after a prolonged exposure of irradiation)
	CNE-2	Nasopharyngeal carcinoma	Homo sapiens	CVCL_6889
In-vivo Model	2 × 10⁶ cells resuspended in 50 uL of Matrigel (Corning) were subcutaneously injected into 4-6 weeks old male nude mice. When tumor volumes reached 150-200 mm³, animals were divided into control group and radiotherapy group. In the radiotherapy group, tumors were treated with a single irradiation (4 Gy) when tumor volumes reached approximately 150-200 mm³. The tumor stopped growing in the next few days and then restarted growth.

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00587)

40S ribosomal protein S6 (S6)

5-methylcytidine (m5C)

In total 2 m6A sequence/site(s) in this target gene
mod ID: M5CSITE004384		Click to Show/Hide the Full List
mod site	chr9:19378920-19378921:-		[2]
Sequence	TCATTCATTGTATGCTCTTGCAGGGTTATGTGGTCCGAATC
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000380394.8; ENST00000380384.5; ENST00000380381.3; ENST00000315377.4
External Link	RMBase: m5C_site_42390
mod ID: M5CSITE004385		Click to Show/Hide the Full List
mod site	chr9:19379587-19379588:-		[2]
Sequence	CCTTCCCAGCCACTGGCTGCCAGAAACTCATTGAAGTGGAC
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000315377.4; ENST00000380394.8; ENST00000380384.5; ENST00000380381.3
External Link	RMBase: m5C_site_42391

N6-methyladenosine (m6A)

In total 35 m6A sequence/site(s) in this target gene
mod ID: M6ASITE087686		Click to Show/Hide the Full List
mod site	chr9:19376140-19376141:-		[3]
Sequence	CCAATGGTGGATAAAGTCAGACCTATTGTGTGTGGTAGTGG
Motif Score	2.876744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000380394.8
External Link	RMBase: m6A_site_817171
mod ID: M6ASITE087687		Click to Show/Hide the Full List
mod site	chr9:19376223-19376224:-		[3]
Sequence	CTTTTCATTGCTGATAGAAAACTACATAAATGAAGAGAGGG
Motif Score	2.627720238
Cell/Tissue List	HeLa; HEK293T; BGC823; LCLs; A549; H1299
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000380394.8
External Link	RMBase: m6A_site_817172
mod ID: M6ASITE087688		Click to Show/Hide the Full List
mod site	chr9:19376260-19376261:-		[3]
Sequence	TAACAAATAAATAAGATCAGACTCTGATCTCTGTTGACTTT
Motif Score	3.319380952
Cell/Tissue List	HeLa; HEK293T; BGC823; LCLs; A549; H1299
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000380394.8; ENST00000498815.1
External Link	RMBase: m6A_site_817173
mod ID: M6ASITE087689		Click to Show/Hide the Full List
mod site	chr9:19376278-19376279:-		[4]
Sequence	GAAATAAGATTTTTTGAGTAACAAATAAATAAGATCAGACT
Motif Score	2.168095238
Cell/Tissue List	HEK293T; hESC-HEK293T; AML
Seq Type List	DART-seq; MAZTER-seq; miCLIP
Transcript ID List	ENST00000380394.8; ENST00000498815.1; ENST00000380384.5
External Link	RMBase: m6A_site_817174
mod ID: M6ASITE087690		Click to Show/Hide the Full List
mod site	chr9:19376321-19376322:-		[4]
Sequence	TTTCCTCTCTGCGAGCTTCTACTTCTAAGTCTGAATCCAGT
Motif Score	2.500660714
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000315377.4; ENST00000380394.8; ENST00000380384.5; ENST00000498815.1
External Link	RMBase: m6A_site_817175
mod ID: M6ASITE087691		Click to Show/Hide the Full List
mod site	chr9:19376343-19376344:-		[3]
Sequence	CAAATTGCGAAGAGACGCAGACTTTCCTCTCTGCGAGCTTC
Motif Score	3.319380952
Cell/Tissue List	HeLa; HEK293T; BGC823; HepG2; hNPCs; fibroblasts; LCLs; A549; H1299; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000498815.1; ENST00000315377.4; ENST00000380384.5; ENST00000380394.8
External Link	RMBase: m6A_site_817176
mod ID: M6ASITE087692		Click to Show/Hide the Full List
mod site	chr9:19376349-19376350:-		[4]
Sequence	CAGGAACAAATTGCGAAGAGACGCAGACTTTCCTCTCTGCG
Motif Score	2.871321429
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000380394.8; ENST00000498815.1; ENST00000315377.4; ENST00000380384.5
External Link	RMBase: m6A_site_817177
mod ID: M6ASITE087693		Click to Show/Hide the Full List
mod site	chr9:19376364-19376365:-		[3]
Sequence	GCTAAGGAGAAGCGCCAGGAACAAATTGCGAAGAGACGCAG
Motif Score	2.951386905
Cell/Tissue List	HeLa; HEK293T; hESC-HEK293T; BGC823; HepG2; hNPCs; fibroblasts; LCLs; A549; H1299; Huh7; AML
Seq Type List	m6A-seq; MeRIP-seq; DART-seq; MAZTER-seq; miCLIP
Transcript ID List	ENST00000380384.5; ENST00000498815.1; ENST00000315377.4; ENST00000380394.8
External Link	RMBase: m6A_site_817178
mod ID: M6ASITE087694		Click to Show/Hide the Full List
mod site	chr9:19376514-19376515:-		[3]
Sequence	GAGGCTGCAGAATATGCTAAACTTTTGGCCAAGAGAATGAA
Motif Score	2.627720238
Cell/Tissue List	HeLa; HEK293T; BGC823; HepG2; hNPCs; fibroblasts; LCLs; A549; H1299; Huh7
Seq Type List	m6A-seq; MeRIP-seq; DART-seq
Transcript ID List	ENST00000498815.1; ENST00000380394.8; ENST00000315377.4; ENST00000380384.5
External Link	RMBase: m6A_site_817179
mod ID: M6ASITE087695		Click to Show/Hide the Full List
mod site	chr9:19376552-19376553:-		[4]
Sequence	TTGCTCTGAAGAAGCAGCGTACCAAGAAAAATAAAGAAGAG
Motif Score	2.8355
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000498815.1; ENST00000315377.4; ENST00000380394.8; ENST00000380384.5
External Link	RMBase: m6A_site_817180
mod ID: M6ASITE087696		Click to Show/Hide the Full List
mod site	chr9:19376587-19376588:-		[5]
Sequence	TACTCCACGTGTCCTGCAGCACAAACGGCGGCGTATTGCTC
Motif Score	2.830589286
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000498815.1; ENST00000380384.5; ENST00000315377.4; ENST00000380394.8
External Link	RMBase: m6A_site_817181
mod ID: M6ASITE087697		Click to Show/Hide the Full List
mod site	chr9:19376606-19376607:-		[4]
Sequence	CCAAGATTCAGCGTCTTGTTACTCCACGTGTCCTGCAGCAC
Motif Score	2.494845238
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000380394.8; ENST00000315377.4; ENST00000380384.5; ENST00000498815.1
External Link	RMBase: m6A_site_817182
mod ID: M6ASITE087698		Click to Show/Hide the Full List
mod site	chr9:19376636-19376637:-		[3]
Sequence	TTTTAGGTAAGAAACCTAGGACCAAAGCACCCAAGATTCAG
Motif Score	3.622404762
Cell/Tissue List	HeLa; HepG2; hNPCs; fibroblasts; LCLs; A549; H1299
Seq Type List	m6A-seq
Transcript ID List	ENST00000315377.4; ENST00000380384.5; ENST00000498815.1; ENST00000380394.8
External Link	RMBase: m6A_site_817183
mod ID: M6ASITE087699		Click to Show/Hide the Full List
mod site	chr9:19376643-19376644:-		[3]
Sequence	TTTGAATTTTTAGGTAAGAAACCTAGGACCAAAGCACCCAA
Motif Score	2.185083333
Cell/Tissue List	HeLa; HepG2; hNPCs; fibroblasts; LCLs; A549; H1299
Seq Type List	m6A-seq
Transcript ID List	ENST00000380394.8; ENST00000498815.1; ENST00000380384.5; ENST00000315377.4
External Link	RMBase: m6A_site_817184
mod ID: M6ASITE087700		Click to Show/Hide the Full List
mod site	chr9:19376687-19376688:-		[3]
Sequence	TAGATGTGGATTCTAACAAAACAAATATTGAAATGATTGAG
Motif Score	2.20572619
Cell/Tissue List	HeLa; HepG2; hNPCs; fibroblasts; LCLs; A549; H1299
Seq Type List	m6A-seq
Transcript ID List	ENST00000498815.1; ENST00000380394.8; ENST00000315377.4; ENST00000380384.5
External Link	RMBase: m6A_site_817185
mod ID: M6ASITE087701		Click to Show/Hide the Full List
mod site	chr9:19378050-19378051:-		[6]
Sequence	ACATGTTTGAGAATTCTGGGACTATTAGCACCACACACTTT
Motif Score	4.065041667
Cell/Tissue List	AML
Seq Type List	miCLIP
Transcript ID List	ENST00000315377.4; ENST00000380384.5; ENST00000380394.8
External Link	RMBase: m6A_site_817186
mod ID: M6ASITE087702		Click to Show/Hide the Full List
mod site	chr9:19378434-19378435:-		[3]
Sequence	AGAGCTAGCAGAATCCGCAAACTTTTCAATCTCTCTAAAGA
Motif Score	2.627720238
Cell/Tissue List	HeLa; HEK293T; HepG2; hNPCs; MT4
Seq Type List	m6A-seq; DART-seq; MeRIP-seq
Transcript ID List	ENST00000380394.8; ENST00000380384.5; ENST00000315377.4
External Link	RMBase: m6A_site_817187
mod ID: M6ASITE087703		Click to Show/Hide the Full List
mod site	chr9:19378481-19378482:-		[4]
Sequence	TTCCTGGACTGACTGATACTACAGTGCCTCGCCGCCTGGGC
Motif Score	2.078666667
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000380394.8; ENST00000315377.4; ENST00000380384.5
External Link	RMBase: m6A_site_817188
mod ID: M6ASITE087704		Click to Show/Hide the Full List
mod site	chr9:19378484-19378485:-		[4]
Sequence	ATATTCCTGGACTGACTGATACTACAGTGCCTCGCCGCCTG
Motif Score	2.53247619
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000380394.8; ENST00000315377.4; ENST00000380384.5
External Link	RMBase: m6A_site_817189
mod ID: M6ASITE087705		Click to Show/Hide the Full List
mod site	chr9:19378490-19378491:-		[4]
Sequence	AGAAGGATATTCCTGGACTGACTGATACTACAGTGCCTCGC
Motif Score	3.28175
Cell/Tissue List	HEK293T; AML
Seq Type List	DART-seq; miCLIP
Transcript ID List	ENST00000315377.4; ENST00000380384.5; ENST00000380394.8
External Link	RMBase: m6A_site_817190
mod ID: M6ASITE087706		Click to Show/Hide the Full List
mod site	chr9:19378494-19378495:-		[3]
Sequence	GGAGAGAAGGATATTCCTGGACTGACTGATACTACAGTGCC
Motif Score	4.065041667
Cell/Tissue List	HeLa; HEK293T; HepG2; hNPCs; MT4; AML
Seq Type List	m6A-seq; DART-seq; MeRIP-seq; miCLIP
Transcript ID List	ENST00000380384.5; ENST00000315377.4; ENST00000380394.8
External Link	RMBase: m6A_site_817191
mod ID: M6ASITE087707		Click to Show/Hide the Full List
mod site	chr9:19378791-19378792:-		[7]
Sequence	CCTGTTACAGACCAAGGAGAACTGGAGAAAGAAAGAGAAAA
Motif Score	3.373380952
Cell/Tissue List	HepG2; MT4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000315377.4; ENST00000380384.5; ENST00000380394.8; ENST00000380381.3
External Link	RMBase: m6A_site_817192
mod ID: M6ASITE087708		Click to Show/Hide the Full List
mod site	chr9:19378801-19378802:-		[7]
Sequence	AAGGGGCATTCCTGTTACAGACCAAGGAGAACTGGAGAAAG
Motif Score	2.876744048
Cell/Tissue List	HepG2; MT4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000315377.4; ENST00000380394.8; ENST00000380384.5; ENST00000380381.3
External Link	RMBase: m6A_site_817193
mod ID: M6ASITE087709		Click to Show/Hide the Full List
mod site	chr9:19378805-19378806:-		[8]
Sequence	GAGTAAGGGGCATTCCTGTTACAGACCAAGGAGAACTGGAG
Motif Score	2.07285119
Cell/Tissue List	brain
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000380381.3; ENST00000315377.4; ENST00000380394.8; ENST00000380384.5
External Link	RMBase: m6A_site_817194
mod ID: M6ASITE087710		Click to Show/Hide the Full List
mod site	chr9:19378882-19378883:-		[5]
Sequence	ATCAGTGGTGGGAACGACAAACAAGGTTTCCCCATGAAGCA
Motif Score	2.20572619
Cell/Tissue List	hESC-HEK293T; HepG2; MT4
Seq Type List	MAZTER-seq; m6A-seq; MeRIP-seq
Transcript ID List	ENST00000380381.3; ENST00000380394.8; ENST00000380384.5; ENST00000315377.4
External Link	RMBase: m6A_site_817195
mod ID: M6ASITE087711		Click to Show/Hide the Full List
mod site	chr9:19378886-19378887:-		[4]
Sequence	CCGAATCAGTGGTGGGAACGACAAACAAGGTTTCCCCATGA
Motif Score	2.865571429
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000315377.4; ENST00000380394.8; ENST00000380384.5; ENST00000380381.3
External Link	RMBase: m6A_site_817196
mod ID: M6ASITE087712		Click to Show/Hide the Full List
mod site	chr9:19378889-19378890:-		[4]
Sequence	GGTCCGAATCAGTGGTGGGAACGACAAACAAGGTTTCCCCA
Motif Score	2.925321429
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000380394.8; ENST00000380384.5; ENST00000380381.3; ENST00000315377.4
External Link	RMBase: m6A_site_817197
mod ID: M6ASITE087713		Click to Show/Hide the Full List
mod site	chr9:19379508-19379509:-		[4]
Sequence	GGCCACAGAAGTTGCTGCTGACGCTCTGGGTGAAGAATGGA
Motif Score	2.833690476
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000380381.3; ENST00000380384.5; ENST00000315377.4; ENST00000380394.8
External Link	RMBase: m6A_site_817198
mod ID: M6ASITE087714		Click to Show/Hide the Full List
mod site	chr9:19379524-19379525:-		[4]
Sequence	TCTATGAGAAGCGTATGGCCACAGAAGTTGCTGCTGACGCT
Motif Score	2.053113095
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000380384.5; ENST00000380394.8; ENST00000380381.3; ENST00000315377.4
External Link	RMBase: m6A_site_817199
mod ID: M6ASITE087715		Click to Show/Hide the Full List
mod site	chr9:19379555-19379556:-		[3]
Sequence	GAAGTGGACGATGAACGCAAACTTCGTACTTTCTATGAGAA
Motif Score	2.627720238
Cell/Tissue List	HeLa; HepG2
Seq Type List	m6A-seq
Transcript ID List	ENST00000380394.8; ENST00000380381.3; ENST00000315377.4; ENST00000380384.5
External Link	RMBase: m6A_site_817200
mod ID: M6ASITE087716		Click to Show/Hide the Full List
mod site	chr9:19379561-19379562:-		[4]
Sequence	CTCATTGAAGTGGACGATGAACGCAAACTTCGTACTTTCTA
Motif Score	2.925321429
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000380384.5; ENST00000380381.3; ENST00000315377.4; ENST00000380394.8
External Link	RMBase: m6A_site_817201
mod ID: M6ASITE087717		Click to Show/Hide the Full List
mod site	chr9:19379568-19379569:-		[4]
Sequence	CCAGAAACTCATTGAAGTGGACGATGAACGCAAACTTCGTA
Motif Score	3.616982143
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000315377.4; ENST00000380384.5; ENST00000380381.3; ENST00000380394.8
External Link	RMBase: m6A_site_817202
mod ID: M6ASITE087718		Click to Show/Hide the Full List
mod site	chr9:19379582-19379583:-		[3]
Sequence	CCAGCCACTGGCTGCCAGAAACTCATTGAAGTGGACGATGA
Motif Score	2.627720238
Cell/Tissue List	HeLa; HepG2
Seq Type List	m6A-seq
Transcript ID List	ENST00000380394.8; ENST00000380381.3; ENST00000380384.5; ENST00000315377.4
External Link	RMBase: m6A_site_817203
mod ID: M6ASITE087719		Click to Show/Hide the Full List
mod site	chr9:19379613-19379614:-		[3]
Sequence	CCCTTTTAATCCTTAGCTGAACATCTCCTTCCCAGCCACTG
Motif Score	2.951386905
Cell/Tissue List	HeLa; hESC-HEK293T
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000380394.8; ENST00000380381.3; ENST00000380384.5; ENST00000315377.4
External Link	RMBase: m6A_site_817204
mod ID: M6ASITE087720		Click to Show/Hide the Full List
mod site	chr9:19380164-19380165:-		[3]
Sequence	GTGATGGTGGCGAGTGTTAGACTGGGTTTGGGGAACGTGAA
Motif Score	3.319380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000380394.8; ENST00000380381.3; ENST00000380384.5; ENST00000315377.4
External Link	RMBase: m6A_site_817205

2'-O-Methylation (2'-O-Me)

In total 6 m6A sequence/site(s) in this target gene
mod ID: 2OMSITE000496		Click to Show/Hide the Full List
mod site	chr9:19376339-19376340:-		[9]
Sequence	TTGCGAAGAGACGCAGACTTTCCTCTCTGCGAGCTTCTACT
Cell/Tissue List	HEK293
Seq Type List	Nm-seq
Transcript ID List	ENST00000498815.1; ENST00000380394.8; ENST00000380384.5; ENST00000315377.4
External Link	RMBase: Nm_site_6581
mod ID: 2OMSITE000497		Click to Show/Hide the Full List
mod site	chr9:19376340-19376341:-		[9]
Sequence	ATTGCGAAGAGACGCAGACTTTCCTCTCTGCGAGCTTCTAC
Cell/Tissue List	HEK293
Seq Type List	Nm-seq
Transcript ID List	ENST00000315377.4; ENST00000380384.5; ENST00000380394.8; ENST00000498815.1
External Link	RMBase: Nm_site_6582
mod ID: 2OMSITE000498		Click to Show/Hide the Full List
mod site	chr9:19376553-19376554:-		[9]
Sequence	ATTGCTCTGAAGAAGCAGCGTACCAAGAAAAATAAAGAAGA
Cell/Tissue List	HEK293; HeLa
Seq Type List	Nm-seq
Transcript ID List	ENST00000380384.5; ENST00000380394.8; ENST00000498815.1; ENST00000315377.4
External Link	RMBase: Nm_site_6583
mod ID: 2OMSITE000499		Click to Show/Hide the Full List
mod site	chr9:19378730-19378731:-		[9]
Sequence	GGATGCAAATCTGAGCGTTCTCAACTTGGTTATTGTAAAAA
Cell/Tissue List	HeLa
Seq Type List	Nm-seq
Transcript ID List	ENST00000315377.4; ENST00000380394.8; ENST00000380384.5
External Link	RMBase: Nm_site_6584
mod ID: 2OMSITE000500		Click to Show/Hide the Full List
mod site	chr9:19378732-19378733:-		[9]
Sequence	GTGGATGCAAATCTGAGCGTTCTCAACTTGGTTATTGTAAA
Cell/Tissue List	HEK293
Seq Type List	Nm-seq
Transcript ID List	ENST00000315377.4; ENST00000380394.8; ENST00000380384.5
External Link	RMBase: Nm_site_6585
mod ID: 2OMSITE000501		Click to Show/Hide the Full List
mod site	chr9:19379608-19379609:-		[9]
Sequence	TTAATCCTTAGCTGAACATCTCCTTCCCAGCCACTGGCTGC
Cell/Tissue List	HeLa
Seq Type List	Nm-seq
Transcript ID List	ENST00000380394.8; ENST00000380381.3; ENST00000380384.5; ENST00000315377.4
External Link	RMBase: Nm_site_6586

Ref 1	m(6)A Reader YTHDC2 Promotes Radiotherapy Resistance of Nasopharyngeal Carcinoma via Activating IGF1R/AKT/S6 Signaling Axis. Front Oncol. 2020 Jul 31;10:1166. doi: 10.3389/fonc.2020.01166. eCollection 2020.
Ref 2	5-methylcytosine promotes mRNA export - NSUN2 as the methyltransferase and ALYREF as an m(5)C reader. Cell Res. 2017 May;27(5):606-625. doi: 10.1038/cr.2017.55. Epub 2017 Apr 18.
Ref 3	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 4	DART-seq: an antibody-free method for global m(6)A detection. Nat Methods. 2019 Dec;16(12):1275-1280. doi: 10.1038/s41592-019-0570-0. Epub 2019 Sep 23.
Ref 5	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.
Ref 6	The N(6)-methyladenosine (m(6)A)-forming enzyme METTL3 controls myeloid differentiation of normal hematopoietic and leukemia cells. Nat Med. 2017 Nov;23(11):1369-1376. doi: 10.1038/nm.4416. Epub 2017 Sep 18.
Ref 7	Topology of the human and mouse m6A RNA methylomes revealed by m6A-seq. Nature. 2012 Apr 29;485(7397):201-6. doi: 10.1038/nature11112.
Ref 8	Single-base mapping of m(6)A by an antibody-independent method. Sci Adv. 2019 Jul 3;5(7):eaax0250. doi: 10.1126/sciadv.aax0250. eCollection 2019 Jul.
Ref 9	Nm-seq maps 2'-O-methylation sites in human mRNA with base precision. Nat Methods. 2017 Jul;14(7):695-698. doi: 10.1038/nmeth.4294. Epub 2017 May 15.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map