General Information of the m6A Target Gene (ID: M6ATAR00577)
Target Name Hepatitis A virus cellular receptor 2 (HAVCR2)
Synonyms
HAVcr-2; T-cell immunoglobulin and mucin domain-containing protein 3; TIMD-3; T-cell immunoglobulin mucin receptor 3; TIM-3; T-cell membrane protein 3; CD366
    Click to Show/Hide
Gene Name HAVCR2
Chromosomal Location 5q33.3
Family Immunoglobulin superfamily, TIM family
Function
Cell surface receptor implicated in modulating innate and adaptive immune responses. Generally accepted to have an inhibiting function. Reports on stimulating functions suggest that the activity may be influenced by the cellular context and/or the respective ligand. Regulates macrophage activation. Inhibits T-helper type 1 lymphocyte (Th1)-mediated auto- and alloimmune responses and promotes immunological tolerance. In CD8+ cells attenuates TCR-induced signaling, specifically by blocking NF-kappaB and NFAT promoter activities resulting in the loss of IL-2 secretion. The function may implicate its association with LCK proposed to impair phosphorylation of TCR subunits, and/or LGALS9-dependent recruitment of PTPRC to the immunological synapse. In contrast, shown to activate TCR-induced signaling in T-cells probably implicating ZAP70, LCP2, LCK and FYN (By similarity). Expressed on Treg cells can inhibit Th17 cell responses. Receptor for LGALS9. Binding to LGALS9 is believed to result in suppression of T-cell responses; the resulting apoptosis of antigen-specific cells may implicate HAVCR2 phosphorylation and disruption of its association with BAG6. Binding to LGALS9 is proposed to be involved in innate immune response to intracellular pathogens. Expressed on Th1 cells interacts with LGALS9 expressed on Mycobacterium tuberculosis-infected macrophages to stimulate antibactericidal activity including IL-1 beta secretion and to restrict intracellular bacterial growth (By similarity). However, the function as receptor for LGALS9 has been challenged. Also reported to enhance CD8+ T-cell responses to an acute infection such as by Listeria monocytogenes (By similarity). Receptor for phosphatidylserine (PtSer); PtSer-binding is calcium-dependent. May recognize PtSer on apoptotic cells leading to their phagocytosis. Mediates the engulfment of apoptotic cells by dendritic cells. Expressed on T-cells, promotes conjugation but not engulfment of apoptotic cells. Expressed on dendritic cells (DCs) positively regulates innate immune response and in synergy with Toll-like receptors promotes secretion of TNF-alpha. In tumor-imfiltrating DCs suppresses nucleic acid-mediated innate immune repsonse by interaction with HMGB1 and interfering with nucleic acid-sensing and trafficking of nucleid acids to endosomes (By similarity). Expressed on natural killer (NK) cells acts as a coreceptor to enhance IFN-gamma production in response to LGALS9. In contrast, shown to suppress NK cell-mediated cytotoxicity. Negatively regulates NK cell function in LPS-induced endotoxic shock (By similarity).
    Click to Show/Hide
Gene ID 84868
Uniprot ID
HAVR2_HUMAN
HGNC ID
HGNC:18437
KEGG ID
hsa:84868
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
HAVCR2 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Heterogeneous nuclear ribonucleoproteins A2/B1 (HNRNPA2B1) [READER]
Representative RNA-seq result indicating the expression of this target gene regulated by HNRNPA2B1
Cell Line Motor neurons Mus musculus
Treatment: hnRNPA2/B1 mutated spinal cord
Control: Mouse spinal cord
GSE86043
Regulation
logFC: 6.16E-01
p-value: 1.29E-02
More Results Click to View More RNA-seq Results
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary HNRNPA2B1 and HNRNPC were extensively expressed in the Glioblastoma multiforme(GBM) microenvironment.m6A regulators promoted the stemness state in GBM cancer cells. Cell communication analysis identified genes in the GALECTIN signaling network in GBM samples, and expression of these genes (LGALS9, CD44, CD45, and Hepatitis A virus cellular receptor 2 (HAVCR2)) correlated with that of m6A regulators.
Responsed Disease Glioblastoma ICD-11: 2A00.00
In-vitro Model U-87MG ATCC Glioblastoma Homo sapiens CVCL_0022
THP-1 Childhood acute monocytic leukemia Homo sapiens CVCL_0006
Heterogeneous nuclear ribonucleoproteins C1/C2 (HNRNPC) [READER]
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary HNRNPA2B1 and HNRNPC were extensively expressed in the Glioblastoma multiforme(GBM) microenvironment. m6A regulators promoted the stemness state in GBM cancer cells. Cell communication analysis identified genes in the GALECTIN signaling network in GBM samples, and expression of these genes (LGALS9, CD44, CD45, and Hepatitis A virus cellular receptor 2 (HAVCR2)) correlated with that of m6A regulators.
Responsed Disease Glioblastoma ICD-11: 2A00.00
In-vitro Model U-87MG ATCC Glioblastoma Homo sapiens CVCL_0022
THP-1 Childhood acute monocytic leukemia Homo sapiens CVCL_0006
Brain cancer [ICD-11: 2A00]
In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [1]
Response Summary HNRNPA2B1 and HNRNPC were extensively expressed in the Glioblastoma multiforme(GBM) microenvironment.m6A regulators promoted the stemness state in GBM cancer cells. Cell communication analysis identified genes in the GALECTIN signaling network in GBM samples, and expression of these genes (LGALS9, CD44, CD45, and Hepatitis A virus cellular receptor 2 (HAVCR2)) correlated with that of m6A regulators.
Responsed Disease Glioblastoma [ICD-11: 2A00.00]
Target Regulator Heterogeneous nuclear ribonucleoproteins A2/B1 (HNRNPA2B1) READER
In-vitro Model U-87MG ATCC Glioblastoma Homo sapiens CVCL_0022
THP-1 Childhood acute monocytic leukemia Homo sapiens CVCL_0006
Experiment 2 Reporting the m6A-centered Disease Response [1]
Response Summary HNRNPA2B1 and HNRNPC were extensively expressed in the Glioblastoma multiforme(GBM) microenvironment. m6A regulators promoted the stemness state in GBM cancer cells. Cell communication analysis identified genes in the GALECTIN signaling network in GBM samples, and expression of these genes (LGALS9, CD44, CD45, and Hepatitis A virus cellular receptor 2 (HAVCR2)) correlated with that of m6A regulators.
Responsed Disease Glioblastoma [ICD-11: 2A00.00]
Target Regulator Heterogeneous nuclear ribonucleoproteins C1/C2 (HNRNPC) READER
In-vitro Model U-87MG ATCC Glioblastoma Homo sapiens CVCL_0022
THP-1 Childhood acute monocytic leukemia Homo sapiens CVCL_0006
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00577)
Hepatitis A virus cellular receptor 2 (HAVCR2)
Adenosine-to-Inosine editing (A-to-I)
In total 6 m6A sequence/site(s) in this target gene
mod ID: A2ISITE001245 Click to Show/Hide the Full List
mod site chr5:157106330-157106331:- [2]
Sequence GAGACCAGCCTGGCCAACATAGTAAAACCTTGTCTCCACTA
Transcript ID List ENST00000521665.1; ENST00000522902.1; ENST00000307851.9; rmsk_1799048; ENST00000524219.1; ENST00000522593.5
External Link RMBase: RNA-editing_site_113289
mod ID: A2ISITE001246 Click to Show/Hide the Full List
mod site chr5:157106401-157106402:- [2]
Sequence CGTGGTGGCTCACACCTCTAATCCCAGCACTTTGGGAGGCT
Transcript ID List ENST00000524219.1; rmsk_1799048; ENST00000307851.9; ENST00000521665.1; ENST00000522902.1; ENST00000522593.5
External Link RMBase: RNA-editing_site_113290
mod ID: A2ISITE001247 Click to Show/Hide the Full List
mod site chr5:157106402-157106403:- [2]
Sequence GCGTGGTGGCTCACACCTCTAATCCCAGCACTTTGGGAGGC
Transcript ID List ENST00000521665.1; ENST00000522902.1; ENST00000307851.9; ENST00000524219.1; rmsk_1799048; ENST00000522593.5
External Link RMBase: RNA-editing_site_113291
mod ID: A2ISITE001248 Click to Show/Hide the Full List
mod site chr5:157106408-157106409:- [2]
Sequence GCCTGGGCGTGGTGGCTCACACCTCTAATCCCAGCACTTTG
Transcript ID List ENST00000521665.1; rmsk_1799048; ENST00000524219.1; ENST00000522902.1; ENST00000307851.9; ENST00000522593.5
External Link RMBase: RNA-editing_site_113292
mod ID: A2ISITE001249 Click to Show/Hide the Full List
mod site chr5:157106410-157106411:- [2]
Sequence GTGCCTGGGCGTGGTGGCTCACACCTCTAATCCCAGCACTT
Transcript ID List ENST00000522902.1; ENST00000524219.1; rmsk_1799048; ENST00000522593.5; ENST00000521665.1; ENST00000307851.9
External Link RMBase: RNA-editing_site_113293
mod ID: A2ISITE001250 Click to Show/Hide the Full List
mod site chr5:157134422-157134423:- [3]
Sequence ACCTGCAACTCCCTGGTTCAAGTGATTCTCCTGCCTCAGCC
Transcript ID List ENST00000524219.1
External Link RMBase: RNA-editing_site_113294
5-methylcytidine (m5C)
In total 7 m6A sequence/site(s) in this target gene
mod ID: M5CSITE003678 Click to Show/Hide the Full List
mod site chr5:157139118-157139119:-
Sequence GGAGCCCTGGGAGTATAAAACGAGAAGAGAAACTAGAAGAT
Cell/Tissue List T24
Seq Type List Bisulfite-seq
Transcript ID List ENST00000524289.1; ENST00000524219.1; ENST00000286317.6; ENST00000420343.1
External Link RMBase: m5C_site_36250
mod ID: M5CSITE003679 Click to Show/Hide the Full List
mod site chr5:157139164-157139165:-
Sequence ATGTCTATCCTTATTAATTTCTTGGACCTTTTAGATATTTT
Cell/Tissue List T24
Seq Type List Bisulfite-seq
Transcript ID List ENST00000524289.1; ENST00000420343.1; ENST00000524219.1; ENST00000286317.6
External Link RMBase: m5C_site_36251
mod ID: M5CSITE003680 Click to Show/Hide the Full List
mod site chr5:157139180-157139181:-
Sequence ACTGAGAAAACTTAATATGTCTATCCTTATTAATTTCTTGG
Cell/Tissue List T24
Seq Type List Bisulfite-seq
Transcript ID List ENST00000420343.1; ENST00000524219.1; ENST00000286317.6; ENST00000524289.1
External Link RMBase: m5C_site_36252
mod ID: M5CSITE003681 Click to Show/Hide the Full List
mod site chr5:157139190-157139191:-
Sequence ACAAGAAAGAACTGAGAAAACTTAATATGTCTATCCTTATT
Cell/Tissue List T24
Seq Type List Bisulfite-seq
Transcript ID List ENST00000524289.1; ENST00000524219.1; ENST00000420343.1; ENST00000286317.6
External Link RMBase: m5C_site_36253
mod ID: M5CSITE003682 Click to Show/Hide the Full List
mod site chr5:157139199-157139200:-
Sequence AGTTTGATCACAAGAAAGAACTGAGAAAACTTAATATGTCT
Cell/Tissue List T24
Seq Type List Bisulfite-seq
Transcript ID List ENST00000524219.1; ENST00000524289.1; ENST00000286317.6; ENST00000420343.1
External Link RMBase: m5C_site_36254
mod ID: M5CSITE003683 Click to Show/Hide the Full List
mod site chr5:157139211-157139212:-
Sequence TTCATCCTATGCAGTTTGATCACAAGAAAGAACTGAGAAAA
Cell/Tissue List T24
Seq Type List Bisulfite-seq
Transcript ID List ENST00000286317.6; ENST00000420343.1; ENST00000524219.1; ENST00000524289.1
External Link RMBase: m5C_site_36255
mod ID: M5CSITE003684 Click to Show/Hide the Full List
mod site chr5:157139220-157139221:-
Sequence TCGAACGGCTTCATCCTATGCAGTTTGATCACAAGAAAGAA
Cell/Tissue List T24
Seq Type List Bisulfite-seq
Transcript ID List ENST00000420343.1; ENST00000524289.1; ENST00000286317.6; ENST00000524219.1
External Link RMBase: m5C_site_36256
N6-methyladenosine (m6A)
In total 49 m6A sequence/site(s) in this target gene
mod ID: M6ASITE072411 Click to Show/Hide the Full List
mod site chr5:157086747-157086748:- [4]
Sequence CTTCAGATAAACTAGGGAAAACTGGGTGCTGAGGTGAAAGC
Motif Score 2.627720238
Cell/Tissue List GM12878
Seq Type List m6A-seq
Transcript ID List ENST00000307851.9
External Link RMBase: m6A_site_695291
mod ID: M6ASITE072412 Click to Show/Hide the Full List
mod site chr5:157086757-157086758:- [4]
Sequence GTCCATGAAACTTCAGATAAACTAGGGAAAACTGGGTGCTG
Motif Score 2.627720238
Cell/Tissue List GM12878
Seq Type List m6A-seq
Transcript ID List ENST00000307851.9
External Link RMBase: m6A_site_695292
mod ID: M6ASITE072413 Click to Show/Hide the Full List
mod site chr5:157086768-157086769:- [4]
Sequence GCACATCATATGTCCATGAAACTTCAGATAAACTAGGGAAA
Motif Score 2.627720238
Cell/Tissue List GM12878
Seq Type List m6A-seq
Transcript ID List ENST00000307851.9
External Link RMBase: m6A_site_695293
mod ID: M6ASITE072414 Click to Show/Hide the Full List
mod site chr5:157086878-157086879:- [4]
Sequence CAGAGTTACCCAACCCAGAGACTGTTAATCATGGATGTTAG
Motif Score 3.319380952
Cell/Tissue List GM12878; CD4T; iSLK; endometrial; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000307851.9
External Link RMBase: m6A_site_695294
mod ID: M6ASITE072415 Click to Show/Hide the Full List
mod site chr5:157086899-157086900:- [5]
Sequence TTGCCTCTGTATTTAAGCCAACAGAGTTACCCAACCCAGAG
Motif Score 2.173910714
Cell/Tissue List kidney; hESC-HEK293T; CD8T
Seq Type List m6A-REF-seq; MAZTER-seq; m6A-CLIP/IP
Transcript ID List ENST00000307851.9
External Link RMBase: m6A_site_695295
mod ID: M6ASITE072416 Click to Show/Hide the Full List
mod site chr5:157086931-157086932:- [4]
Sequence GGGACCTGCACTGAACTTAAACAGGCATGTCATTGCCTCTG
Motif Score 2.20572619
Cell/Tissue List GM12878; CD4T; iSLK; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000307851.9
External Link RMBase: m6A_site_695296
mod ID: M6ASITE072417 Click to Show/Hide the Full List
mod site chr5:157086937-157086938:- [4]
Sequence TGAACTGGGACCTGCACTGAACTTAAACAGGCATGTCATTG
Motif Score 3.373380952
Cell/Tissue List GM12878; CD4T; iSLK; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000307851.9
External Link RMBase: m6A_site_695297
mod ID: M6ASITE072418 Click to Show/Hide the Full List
mod site chr5:157086948-157086949:- [4]
Sequence CACATGGGAATTGAACTGGGACCTGCACTGAACTTAAACAG
Motif Score 3.622404762
Cell/Tissue List GM12878; CD4T; iSLK; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000307851.9
External Link RMBase: m6A_site_695298
mod ID: M6ASITE072419 Click to Show/Hide the Full List
mod site chr5:157086954-157086955:- [4]
Sequence ATGACTCACATGGGAATTGAACTGGGACCTGCACTGAACTT
Motif Score 3.373380952
Cell/Tissue List GM12878; CD4T; iSLK; endometrial
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000307851.9
External Link RMBase: m6A_site_695299
mod ID: M6ASITE072420 Click to Show/Hide the Full List
mod site chr5:157087054-157087055:- [4]
Sequence GTGTTTTGTCTTTTTCAGAAACTATGAGCTGTGTCACCTGA
Motif Score 2.627720238
Cell/Tissue List GM12878
Seq Type List m6A-seq
Transcript ID List ENST00000307851.9
External Link RMBase: m6A_site_695300
mod ID: M6ASITE072421 Click to Show/Hide the Full List
mod site chr5:157106617-157106618:- [4]
Sequence TCATCAAACCAGGTGAGTGGACATTTGCATGCCATCTTTAT
Motif Score 3.643047619
Cell/Tissue List GM12878
Seq Type List m6A-seq
Transcript ID List ENST00000522593.5; ENST00000524219.1; ENST00000522902.1; ENST00000521665.1; ENST00000307851.9
External Link RMBase: m6A_site_695301
mod ID: M6ASITE072422 Click to Show/Hide the Full List
mod site chr5:157106630-157106631:- [4]
Sequence AACCTGAAGTTGGTCATCAAACCAGGTGAGTGGACATTTGC
Motif Score 2.185083333
Cell/Tissue List GM12878
Seq Type List m6A-seq
Transcript ID List ENST00000522593.5; ENST00000524219.1; ENST00000307851.9; ENST00000521665.1; ENST00000522902.1
External Link RMBase: m6A_site_695302
mod ID: M6ASITE072423 Click to Show/Hide the Full List
mod site chr5:157106709-157106710:- [4]
Sequence AGAGAATGTGACTCTAGCAGACAGTGGGATCTACTGCTGCC
Motif Score 2.897386905
Cell/Tissue List GM12878
Seq Type List m6A-seq
Transcript ID List ENST00000522902.1; ENST00000522593.5; ENST00000517358.1; ENST00000524219.1; ENST00000521665.1; ENST00000307851.9
External Link RMBase: m6A_site_695303
mod ID: M6ASITE072424 Click to Show/Hide the Full List
mod site chr5:157106785-157106786:- [5]
Sequence AAAGGGATGTGAATTATTGGACATCCAGATACTGGCTAAAT
Motif Score 3.643047619
Cell/Tissue List kidney; GM12878
Seq Type List m6A-REF-seq; m6A-seq
Transcript ID List ENST00000522902.1; ENST00000307851.9; ENST00000522593.5; ENST00000521665.1; ENST00000524219.1; ENST00000517358.1
External Link RMBase: m6A_site_695304
mod ID: M6ASITE072425 Click to Show/Hide the Full List
mod site chr5:157106812-157106813:- [4]
Sequence GTGGCAACGTGGTGCTCAGGACTGATGAAAGGGATGTGAAT
Motif Score 4.065041667
Cell/Tissue List GM12878; CD8T
Seq Type List m6A-seq; m6A-CLIP/IP
Transcript ID List ENST00000522902.1; ENST00000521665.1; ENST00000307851.9; ENST00000524219.1; ENST00000522593.5; ENST00000517358.1
External Link RMBase: m6A_site_695305
mod ID: M6ASITE072426 Click to Show/Hide the Full List
mod site chr5:157106880-157106881:- [6]
Sequence CACCCCAGCCGCCCCAGGGAACCTCGTGCCCGTCTGCTGGG
Motif Score 2.930744048
Cell/Tissue List endometrial
Seq Type List m6A-seq
Transcript ID List ENST00000524219.1; ENST00000522593.5; ENST00000307851.9; ENST00000517358.1; ENST00000521665.1; ENST00000522902.1
External Link RMBase: m6A_site_695306
mod ID: M6ASITE072427 Click to Show/Hide the Full List
mod site chr5:157137476-157137477:- [7]
Sequence AGCATTGGTATCACTTGGGGACTTACTAGAAATAAAAGTTT
Motif Score 4.065041667
Cell/Tissue List TREX
Seq Type List MeRIP-seq
Transcript ID List rmsk_1799151; ENST00000286317.6; ENST00000524219.1
External Link RMBase: m6A_site_695307
mod ID: M6ASITE072428 Click to Show/Hide the Full List
mod site chr5:157137502-157137503:- [8]
Sequence CTTAAAGTGTGTGGTCCTGGACCAGCAGCATTGGTATCACT
Motif Score 3.622404762
Cell/Tissue List HEK293A-TOA; TREX; iSLK
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000286317.6; ENST00000524219.1; rmsk_1799151
External Link RMBase: m6A_site_695308
mod ID: M6ASITE072429 Click to Show/Hide the Full List
mod site chr5:157137652-157137653:- [9]
Sequence CTCTGCCCCTAGCTAATTGGACTTTATATGAGCACTTTCTT
Motif Score 4.065041667
Cell/Tissue List HeLa; HEK293T; HepG2; hESCs; GM12878; Huh7; iSLK; MSC; TIME; TREX
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000286317.6; rmsk_1799152; ENST00000524219.1
External Link RMBase: m6A_site_695309
mod ID: M6ASITE072430 Click to Show/Hide the Full List
mod site chr5:157137698-157137699:- [9]
Sequence TTCTTTGAATGACCGTGAGGACTAAGTCTTCCTTTCAGTAA
Motif Score 4.065041667
Cell/Tissue List HeLa; HEK293T; HepG2; GM12878; Huh7; iSLK; MSC; TIME; TREX
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000286317.6; ENST00000524219.1; rmsk_1799152
External Link RMBase: m6A_site_695310
mod ID: M6ASITE072431 Click to Show/Hide the Full List
mod site chr5:157137824-157137825:- [9]
Sequence AATCCAGGCTTGCCCCATAAACATTTCTTGCATGATCCTCC
Motif Score 2.20572619
Cell/Tissue List HeLa; HEK293T; A549; HepG2; U2OS; H1A; H1B; GM12878; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000524219.1; ENST00000286317.6; rmsk_1799152
External Link RMBase: m6A_site_695311
mod ID: M6ASITE072432 Click to Show/Hide the Full List
mod site chr5:157137884-157137885:- [9]
Sequence CTCCCAGCATCTCTGTGAGAACATATGACTAAGTCGTAGGC
Motif Score 2.951386905
Cell/Tissue List HeLa; HEK293T; HepG2; U2OS; H1A; H1B; A549; GM12878; Huh7; HEK293A-TOA; iSLK; TREX
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000286317.6; ENST00000524219.1; rmsk_1799152
External Link RMBase: m6A_site_695312
mod ID: M6ASITE072433 Click to Show/Hide the Full List
mod site chr5:157137915-157137916:- [9]
Sequence ATGTGGCAATCCAGCCAGGGACATTTCCCTACTCCCAGCAT
Motif Score 3.643047619
Cell/Tissue List HeLa; HEK293T; HepG2; U2OS; H1A; H1B; A549; HEK293A-TOA
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000524219.1; ENST00000286317.6; rmsk_1799152
External Link RMBase: m6A_site_695313
mod ID: M6ASITE072434 Click to Show/Hide the Full List
mod site chr5:157137986-157137987:- [8]
Sequence AAAGGGGTTTGATGGCAGAGACTGCTAGGTGTCTACCAAAG
Motif Score 3.319380952
Cell/Tissue List HEK293T; HEK293A-TOA
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List rmsk_1799152; ENST00000524219.1; ENST00000286317.6
External Link RMBase: m6A_site_695314
mod ID: M6ASITE072435 Click to Show/Hide the Full List
mod site chr5:157138457-157138458:- [10]
Sequence TGTTTTAGAGTTGCAGTAAAACTTTGATGATAACCTCAATA
Motif Score 2.627720238
Cell/Tissue List HEK293T; Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000286317.6; ENST00000524219.1; ENST00000420343.1
External Link RMBase: m6A_site_695315
mod ID: M6ASITE072436 Click to Show/Hide the Full List
mod site chr5:157138486-157138487:- [11]
Sequence GTTAGCTGCTGTTGTATGGGACATTCCTATGTTTTAGAGTT
Motif Score 3.643047619
Cell/Tissue List HEK293T; hESC-HEK293T; A549; Huh7
Seq Type List MeRIP-seq; MAZTER-seq; m6A-CLIP/IP
Transcript ID List ENST00000420343.1; ENST00000524219.1; ENST00000286317.6
External Link RMBase: m6A_site_695316
mod ID: M6ASITE072437 Click to Show/Hide the Full List
mod site chr5:157138554-157138555:- [10]
Sequence TCGCTGTATAACAAGCATAGACAAATGAGTGTCCCTGCACT
Motif Score 2.897386905
Cell/Tissue List HEK293T; fibroblasts; Huh7; TIME
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000420343.1; ENST00000524219.1; ENST00000286317.6
External Link RMBase: m6A_site_695317
mod ID: M6ASITE072438 Click to Show/Hide the Full List
mod site chr5:157138630-157138631:- [12]
Sequence AAGTTTCACTAAAAATGTAAACAGCTTTAATCTTGACTCCA
Motif Score 2.20572619
Cell/Tissue List HEK293T; HeLa; A549; U2OS; fibroblasts; GM12878; Huh7; HEK293A-TOA; iSLK; MSC; TIME
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000524219.1; ENST00000286317.6; ENST00000420343.1
External Link RMBase: m6A_site_695318
mod ID: M6ASITE072439 Click to Show/Hide the Full List
mod site chr5:157138663-157138664:- [9]
Sequence ATTAGTTCATTTTCTTTTGGACAGTCTTAAGAGAAGTTTCA
Motif Score 3.643047619
Cell/Tissue List HeLa; HEK293T; A549; hESC-HEK293T; U2OS; fibroblasts; GM12878; CD8T; Huh7; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; AML
Seq Type List m6A-seq; MeRIP-seq; MAZTER-seq; m6A-CLIP/IP; miCLIP
Transcript ID List ENST00000420343.1; ENST00000524219.1; ENST00000286317.6
External Link RMBase: m6A_site_695319
mod ID: M6ASITE072440 Click to Show/Hide the Full List
mod site chr5:157138735-157138736:- [9]
Sequence ATTGATGAGATGAATGAAAGACCATGAAAGATGTTTCTTTT
Motif Score 2.876744048
Cell/Tissue List HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; MM6; Huh7; Jurkat; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A; NB4
Seq Type List m6A-seq; MeRIP-seq; DART-seq
Transcript ID List ENST00000420343.1; ENST00000524219.1; ENST00000286317.6
External Link RMBase: m6A_site_695320
mod ID: M6ASITE072441 Click to Show/Hide the Full List
mod site chr5:157138825-157138826:- [9]
Sequence AATTGTACTGGACAGAATGAACATCAAAGAGAAAATTCAGG
Motif Score 2.951386905
Cell/Tissue List HeLa; CD34; HepG2; HEK293T; brain; A549; hESC-HEK293T; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A; GSCs; NB4
Seq Type List m6A-seq; MeRIP-seq; m6A-REF-seq; MAZTER-seq
Transcript ID List ENST00000420343.1; ENST00000286317.6; ENST00000524219.1
External Link RMBase: m6A_site_695321
mod ID: M6ASITE072442 Click to Show/Hide the Full List
mod site chr5:157138834-157138835:- [9]
Sequence GATAGCAACAATTGTACTGGACAGAATGAACATCAAAGAGA
Motif Score 3.643047619
Cell/Tissue List HeLa; CD34; HepG2; HEK293T; A549; hESC-HEK293T; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; CD8T; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A; GSCs; NB4
Seq Type List m6A-seq; MeRIP-seq; MAZTER-seq; m6A-CLIP/IP
Transcript ID List ENST00000420343.1; ENST00000286317.6; ENST00000524219.1
External Link RMBase: m6A_site_695322
mod ID: M6ASITE072443 Click to Show/Hide the Full List
mod site chr5:157138847-157138848:- [11]
Sequence AATGGATGCTGATGATAGCAACAATTGTACTGGACAGAATG
Motif Score 2.173910714
Cell/Tissue List hESC-HEK293T; A549
Seq Type List MAZTER-seq; m6A-CLIP/IP
Transcript ID List ENST00000524289.1; ENST00000420343.1; ENST00000286317.6; ENST00000524219.1
External Link RMBase: m6A_site_695323
mod ID: M6ASITE072444 Click to Show/Hide the Full List
mod site chr5:157138870-157138871:- [9]
Sequence GGAATGAGAGTAAAAACTGAACCAATGGATGCTGATGATAG
Motif Score 2.930744048
Cell/Tissue List HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A; GSCs; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000524219.1; ENST00000286317.6; ENST00000420343.1; ENST00000524289.1
External Link RMBase: m6A_site_695324
mod ID: M6ASITE072445 Click to Show/Hide the Full List
mod site chr5:157138875-157138876:- [9]
Sequence AAGCAGGAATGAGAGTAAAAACTGAACCAATGGATGCTGAT
Motif Score 2.627720238
Cell/Tissue List HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A; GSCs; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000420343.1; ENST00000524219.1; ENST00000524289.1; ENST00000286317.6
External Link RMBase: m6A_site_695325
mod ID: M6ASITE072446 Click to Show/Hide the Full List
mod site chr5:157138986-157138987:- [9]
Sequence AGAAACGTCAACGGCTTGAAACAGCTGAGAGATTTCAAAAG
Motif Score 2.20572619
Cell/Tissue List HeLa; CD34; HepG2; HEK293T; A549; U2OS; hNPCs; hESCs; fibroblasts; GM12878; LCLs; MM6; Huh7; HEK293A-TOA; iSLK; MSC; TREX
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000420343.1; ENST00000286317.6; ENST00000524289.1; ENST00000524219.1
External Link RMBase: m6A_site_695326
mod ID: M6ASITE072447 Click to Show/Hide the Full List
mod site chr5:157139031-157139032:- [9]
Sequence GACCCCACCAAGCAAGAGAGACCTTGAGAGTCATGATGGAG
Motif Score 2.876744048
Cell/Tissue List HeLa; CD34; HepG2; HEK293T; A549; U2OS; hNPCs; hESCs; fibroblasts; GM12878; LCLs; MM6; Huh7; HEK293A-TOA; iSLK; MSC; TREX
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000524289.1; ENST00000420343.1; ENST00000286317.6; ENST00000524219.1
External Link RMBase: m6A_site_695327
mod ID: M6ASITE072448 Click to Show/Hide the Full List
mod site chr5:157139080-157139081:- [11]
Sequence GATCTTAAGCTGCTTTTTGTACACGTGCATCATCTTATAAA
Motif Score 2.856142857
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000524289.1; ENST00000524219.1; ENST00000420343.1; ENST00000286317.6
External Link RMBase: m6A_site_695328
mod ID: M6ASITE072449 Click to Show/Hide the Full List
mod site chr5:157139107-157139108:- [9]
Sequence AGTATAAAACGAGAAGAGAAACTAGAAGATCTTAAGCTGCT
Motif Score 2.627720238
Cell/Tissue List HeLa; HepG2; HEK293T; A549; U2OS; hNPCs; hESCs; fibroblasts; GM12878; LCLs; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000524289.1; ENST00000524219.1; ENST00000420343.1; ENST00000286317.6
External Link RMBase: m6A_site_695329
mod ID: M6ASITE072450 Click to Show/Hide the Full List
mod site chr5:157139159-157139160:- [9]
Sequence TATCCTTATTAATTTCTTGGACCTTTTAGATATTTTAATAA
Motif Score 3.622404762
Cell/Tissue List HeLa; HepG2; HEK293T; A549; U2OS; hNPCs; hESCs; fibroblasts; GM12878; LCLs; CD8T; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX
Seq Type List m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List ENST00000420343.1; ENST00000524289.1; ENST00000524219.1; ENST00000286317.6
External Link RMBase: m6A_site_695330
mod ID: M6ASITE072451 Click to Show/Hide the Full List
mod site chr5:157139191-157139192:- [9]
Sequence CACAAGAAAGAACTGAGAAAACTTAATATGTCTATCCTTAT
Motif Score 2.627720238
Cell/Tissue List HeLa; HepG2; HEK293T; A549; U2OS; hNPCs; hESCs; fibroblasts; GM12878; LCLs; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX
Seq Type List m6A-seq; MeRIP-seq; DART-seq
Transcript ID List ENST00000524289.1; ENST00000286317.6; ENST00000420343.1; ENST00000524219.1
External Link RMBase: m6A_site_695331
mod ID: M6ASITE072452 Click to Show/Hide the Full List
mod site chr5:157139200-157139201:- [9]
Sequence CAGTTTGATCACAAGAAAGAACTGAGAAAACTTAATATGTC
Motif Score 3.373380952
Cell/Tissue List HeLa; HepG2; HEK293T; A549; U2OS; hNPCs; hESCs; fibroblasts; GM12878; LCLs; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX
Seq Type List m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List ENST00000524289.1; ENST00000286317.6; ENST00000420343.1; ENST00000524219.1
External Link RMBase: m6A_site_695332
mod ID: M6ASITE072453 Click to Show/Hide the Full List
mod site chr5:157139210-157139211:- [11]
Sequence TCATCCTATGCAGTTTGATCACAAGAAAGAACTGAGAAAAC
Motif Score 2.047297619
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000286317.6; ENST00000420343.1; ENST00000524289.1; ENST00000524219.1
External Link RMBase: m6A_site_695333
mod ID: M6ASITE072454 Click to Show/Hide the Full List
mod site chr5:157139236-157139237:- [13]
Sequence TTGGAAAGTCAGGGCATCGAACGGCTTCATCCTATGCAGTT
Motif Score 2.925321429
Cell/Tissue List CD8T; A549
Seq Type List m6A-CLIP/IP
Transcript ID List ENST00000524219.1; ENST00000420343.1; ENST00000286317.6; ENST00000524289.1
External Link RMBase: m6A_site_695334
mod ID: M6ASITE072455 Click to Show/Hide the Full List
mod site chr5:157139306-157139307:- [11]
Sequence CCCTCCAATAAAAGACAGTTACATGATGTTTGGCAATCAGT
Motif Score 2.07285119
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000524289.1; ENST00000286317.6; ENST00000420343.1; ENST00000524219.1
External Link RMBase: m6A_site_695335
mod ID: M6ASITE072456 Click to Show/Hide the Full List
mod site chr5:157139312-157139313:- [9]
Sequence GCCTCCCCCTCCAATAAAAGACAGTTACATGATGTTTGGCA
Motif Score 2.897386905
Cell/Tissue List HeLa; HepG2; HEK293T; A549; hESC-HEK293T; U2OS; hNPCs; hESCs; fibroblasts; GM12878; LCLs; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX; AML
Seq Type List m6A-seq; MeRIP-seq; MAZTER-seq; miCLIP
Transcript ID List ENST00000286317.6; ENST00000524219.1; ENST00000524289.1; ENST00000420343.1
External Link RMBase: m6A_site_695336
mod ID: M6ASITE072457 Click to Show/Hide the Full List
mod site chr5:157139422-157139423:- [9]
Sequence TGATAGTCCACAATGGGTGAACCACAGCAAGTGAGTGCACT
Motif Score 2.930744048
Cell/Tissue List HeLa; HEK293T; A549; HepG2; U2OS; hESCs; GM12878; HEK293A-TOA; MSC; TIME
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000524289.1; ENST00000524219.1; ENST00000420343.1; ENST00000286317.6
External Link RMBase: m6A_site_695337
mod ID: M6ASITE072458 Click to Show/Hide the Full List
mod site chr5:157139433-157139434:- [11]
Sequence CCATAGGTTCTTGATAGTCCACAATGGGTGAACCACAGCAA
Motif Score 2.053113095
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000524219.1; ENST00000420343.1; ENST00000286317.6; ENST00000524289.1
External Link RMBase: m6A_site_695338
mod ID: M6ASITE072459 Click to Show/Hide the Full List
mod site chr5:157142408-157142409:- [9]
Sequence CTTCTGGGAGCAGTTATGAAACAGCTGAGGTATGGGGGCAG
Motif Score 2.20572619
Cell/Tissue List HeLa; HEK293T; A549; HepG2; U2OS; hESCs; Huh7; HEK293A-TOA; MSC; TIME
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000286317.6; ENST00000524219.1; ENST00000524289.1; ENST00000420343.1; rmsk_1799163
External Link RMBase: m6A_site_695339