m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00576)

Target Name	Receptor-type tyrosine-protein phosphatase C (CD45)
Synonyms	Leukocyte common antigen; L-CA; T200; CD45 Click to Show/Hide
Gene Name	CD45
Chromosomal Location	1q31.3-q32.1
Family	Protein-tyrosine phosphatase family, Receptor class 1/6 subfamily
Function	Protein tyrosine-protein phosphatase required for T-cell activation through the antigen receptor. Acts as a positive regulator of T-cell coactivation upon binding to DPP4. The first PTPase domain has enzymatic activity, while the second one seems to affect the substrate specificity of the first one. Upon T-cell activation, recruits and dephosphorylates SKAP1 and FYN. Dephosphorylates LYN, and thereby modulates LYN activity (By similarity). oteins upon T-cell receptor stimulation and impaired T-cell proliferation. Click to Show/Hide
Gene ID	5788
Uniprot ID	PTPRC_HUMAN
HGNC ID	HGNC:9666
KEGG ID	hsa:5788

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

CD45 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Heterogeneous nuclear ribonucleoproteins A2/B1 (HNRNPA2B1) [READER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by HNRNPA2B1*
Cell Line	MDA-MB-231	Homo sapiens
Treatment: HNRNPA2B1 knockdown MDA-MB-231 cells Control: MDA-MB-231 cells		GSE70061
Regulation		logFC: -6.37E-01 p-value: 1.03E-02
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	HNRNPA2B1 and HNRNPC were extensively expressed in the Glioblastoma multiforme(GBM) microenvironment.m6A regulators promoted the stemness state in GBM cancer cells. Cell communication analysis identified genes in the GALECTIN signaling network in GBM samples, and expression of these genes (LGALS9, CD44, Receptor-type tyrosine-protein phosphatase C (CD45), and HAVCR2) correlated with that of m6A regulators.
Responsed Disease	Glioblastoma		ICD-11: 2A00.00	Disease Info
In-vitro Model	U-87MG ATCC	Glioblastoma	Homo sapiens	CVCL_0022
In-vitro Model	THP-1	Childhood acute monocytic leukemia	Homo sapiens	CVCL_0006

Heterogeneous nuclear ribonucleoproteins C1/C2 (HNRNPC) [READER]

Regulator Info

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	HNRNPA2B1 and HNRNPC were extensively expressed in the Glioblastoma multiforme(GBM) microenvironment. m6A regulators promoted the stemness state in GBM cancer cells. Cell communication analysis identified genes in the GALECTIN signaling network in GBM samples, and expression of these genes (LGALS9, CD44, Receptor-type tyrosine-protein phosphatase C (CD45), and HAVCR2) correlated with that of m6A regulators.
Responsed Disease	Glioblastoma		ICD-11: 2A00.00	Disease Info
In-vitro Model	U-87MG ATCC	Glioblastoma	Homo sapiens	CVCL_0022
In-vitro Model	THP-1	Childhood acute monocytic leukemia	Homo sapiens	CVCL_0006

Brain cancer [ICD-11: 2A00]

Disease Info

In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	HNRNPA2B1 and HNRNPC were extensively expressed in the Glioblastoma multiforme(GBM) microenvironment.m6A regulators promoted the stemness state in GBM cancer cells. Cell communication analysis identified genes in the GALECTIN signaling network in GBM samples, and expression of these genes (LGALS9, CD44, Receptor-type tyrosine-protein phosphatase C (CD45), and HAVCR2) correlated with that of m6A regulators.
Responsed Disease	Glioblastoma [ICD-11: 2A00.00]
Target Regulator	Heterogeneous nuclear ribonucleoproteins A2/B1 (HNRNPA2B1)		READER	Regulator Info
In-vitro Model	U-87MG ATCC	Glioblastoma	Homo sapiens	CVCL_0022
In-vitro Model	THP-1	Childhood acute monocytic leukemia	Homo sapiens	CVCL_0006
Experiment 2 Reporting the m6A-centered Disease Response				[1]
Response Summary	HNRNPA2B1 and HNRNPC were extensively expressed in the Glioblastoma multiforme(GBM) microenvironment. m6A regulators promoted the stemness state in GBM cancer cells. Cell communication analysis identified genes in the GALECTIN signaling network in GBM samples, and expression of these genes (LGALS9, CD44, Receptor-type tyrosine-protein phosphatase C (CD45), and HAVCR2) correlated with that of m6A regulators.
Responsed Disease	Glioblastoma [ICD-11: 2A00.00]
Target Regulator	Heterogeneous nuclear ribonucleoproteins C1/C2 (HNRNPC)		READER	Regulator Info
In-vitro Model	U-87MG ATCC	Glioblastoma	Homo sapiens	CVCL_0022
In-vitro Model	THP-1	Childhood acute monocytic leukemia	Homo sapiens	CVCL_0006

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00576)

Receptor-type tyrosine-protein phosphatase C (CD45)

Adenosine-to-Inosine editing (A-to-I)

In total 2 m6A sequence/site(s) in this target gene
mod ID: A2ISITE001151		Click to Show/Hide the Full List
mod site	chr1:198698706-198698707:+		[2]
Sequence	GTGTGTATATATATATTTGTATATACTGTTAAGTATATATA
Transcript ID List	ENST00000391970.3; rmsk_349493; ENST00000367367.8; ENST00000348564.11; ENST00000427110.6; ENST00000418674.1; ENST00000529828.5; ENST00000367379.6; ENST00000462363.6; ENST00000643513.1; ENST00000484135.1; ENST00000442510.8; ENST00000645247.1; ENST00000530727.5
External Link	RMBase: RNA-editing_site_11280
mod ID: A2ISITE001162		Click to Show/Hide the Full List
mod site	chr1:198698708-198698709:+		[2]
Sequence	GTGTATATATATATTTGTATATACTGTTAAGTATATATAAA
Transcript ID List	ENST00000529828.5; ENST00000484135.1; rmsk_349493; ENST00000348564.11; ENST00000427110.6; ENST00000530727.5; ENST00000645247.1; ENST00000442510.8; ENST00000418674.1; ENST00000462363.6; ENST00000643513.1; ENST00000391970.3; ENST00000367379.6; ENST00000367367.8
External Link	RMBase: RNA-editing_site_11281

N6-methyladenosine (m6A)

In total 19 m6A sequence/site(s) in this target gene
mod ID: M6ASITE073658		Click to Show/Hide the Full List
mod site	chr1:198680184-198680185:+		[3]
Sequence	TATTATTAAAGGCTTCACAAACTGTCTTGTTTAATAGCCAC
Motif Score	2.627720238
Cell/Tissue List	CD8T
Seq Type List	m6A-CLIP/IP
Transcript ID List	ENST00000530727.5; ENST00000367364.5; ENST00000413409.6; ENST00000643513.1; ENST00000462363.6; ENST00000367367.8; ENST00000645247.1; ENST00000348564.11; ENST00000529828.5; ENST00000367379.6; ENST00000427110.6; ENST00000418674.1; ENST00000442510.8; ENST00000391970.3
External Link	RMBase: m6A_site_70684
mod ID: M6ASITE073659		Click to Show/Hide the Full List
mod site	chr1:198680554-198680555:+		[3]
Sequence	ATGTAAAGTGAATCGTAAAGACTTTGGAATCTCCTACTAAA
Motif Score	3.319380952
Cell/Tissue List	CD8T
Seq Type List	m6A-CLIP/IP
Transcript ID List	ENST00000643513.1; ENST00000645247.1; ENST00000462363.6; ENST00000418674.1; ENST00000413409.6; ENST00000367364.5; ENST00000427110.6; ENST00000367379.6; ENST00000348564.11; ENST00000442510.8; ENST00000529828.5; ENST00000391970.3; ENST00000367367.8; ENST00000530727.5
External Link	RMBase: m6A_site_70685
mod ID: M6ASITE073660		Click to Show/Hide the Full List
mod site	chr1:198709776-198709777:+		[4]
Sequence	CTCAGAAATACTCTATAATAACCACAAGTTTACTAACGCAA
Motif Score	2.147452381
Cell/Tissue List	AML
Seq Type List	miCLIP
Transcript ID List	ENST00000348564.11; ENST00000442510.8; ENST00000367367.8; ENST00000530727.5; ENST00000529828.5
External Link	RMBase: m6A_site_70686
mod ID: M6ASITE073661		Click to Show/Hide the Full List
mod site	chr1:198748175-198748176:+		[5]
Sequence	AGAAGAAAATAAAAGTAAAAACAGGAATTCTAATGTCATCC
Motif Score	2.20572619
Cell/Tissue List	CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000348564.11; ENST00000442510.8
External Link	RMBase: m6A_site_70687
mod ID: M6ASITE073662		Click to Show/Hide the Full List
mod site	chr1:198749440-198749441:+		[5]
Sequence	TATAACAGAGTGCCACTTAAACATGAGCTGGAAATGAGTAA
Motif Score	2.20572619
Cell/Tissue List	CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000348564.11; ENST00000442510.8
External Link	RMBase: m6A_site_70688
mod ID: M6ASITE073663		Click to Show/Hide the Full List
mod site	chr1:198749515-198749516:+		[5]
Sequence	GATGACAGTGATTCAGAGGAACCAAGCAAATACATCAATGC
Motif Score	2.930744048
Cell/Tissue List	CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000442510.8; ENST00000348564.11
External Link	RMBase: m6A_site_70689
mod ID: M6ASITE073664		Click to Show/Hide the Full List
mod site	chr1:198750502-198750503:+		[5]
Sequence	TCTAAAAAGAGCTACTGGAAACCTGAAGTGATGATTGCTGC
Motif Score	2.185083333
Cell/Tissue List	CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000442510.8; ENST00000348564.11
External Link	RMBase: m6A_site_70690
mod ID: M6ASITE073665		Click to Show/Hide the Full List
mod site	chr1:198750529-198750530:+		[5]
Sequence	GTGATGATTGCTGCTCAGGGACCACTGAAGGAGACCATTGG
Motif Score	3.622404762
Cell/Tissue List	CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000348564.11; ENST00000442510.8
External Link	RMBase: m6A_site_70691
mod ID: M6ASITE073666		Click to Show/Hide the Full List
mod site	chr1:198750542-198750543:+		[5]
Sequence	CTCAGGGACCACTGAAGGAGACCATTGGTGACTTTTGGCAG
Motif Score	2.876744048
Cell/Tissue List	CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000442510.8; ENST00000348564.11
External Link	RMBase: m6A_site_70692
mod ID: M6ASITE073667		Click to Show/Hide the Full List
mod site	chr1:198750607-198750608:+		[5]
Sequence	GTTATTGTTATGCTGACAGAACTGAAACATGGAGACCAGGT
Motif Score	3.373380952
Cell/Tissue List	CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000348564.11; ENST00000442510.8
External Link	RMBase: m6A_site_70693
mod ID: M6ASITE073668		Click to Show/Hide the Full List
mod site	chr1:198750613-198750614:+		[5]
Sequence	GTTATGCTGACAGAACTGAAACATGGAGACCAGGTTTGTAC
Motif Score	2.20572619
Cell/Tissue List	CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000442510.8; ENST00000348564.11
External Link	RMBase: m6A_site_70694
mod ID: M6ASITE073669		Click to Show/Hide the Full List
mod site	chr1:198750621-198750622:+		[5]
Sequence	GACAGAACTGAAACATGGAGACCAGGTTTGTACTTTTGAGG
Motif Score	2.876744048
Cell/Tissue List	CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000348564.11; ENST00000442510.8
External Link	RMBase: m6A_site_70695
mod ID: M6ASITE073670		Click to Show/Hide the Full List
mod site	chr1:198755961-198755962:+		[6]
Sequence	ACCTACCCTGCTCAGAATGGACAAGTAAAGAAAAACAACCA
Motif Score	3.643047619
Cell/Tissue List	LCLs
Seq Type List	m6A-seq
Transcript ID List	ENST00000442510.8; ENST00000348564.11
External Link	RMBase: m6A_site_70696
mod ID: M6ASITE073671		Click to Show/Hide the Full List
mod site	chr1:198755975-198755976:+		[6]
Sequence	GAATGGACAAGTAAAGAAAAACAACCATCAAGAAGATAAAA
Motif Score	2.20572619
Cell/Tissue List	LCLs
Seq Type List	m6A-seq
Transcript ID List	ENST00000442510.8; ENST00000348564.11
External Link	RMBase: m6A_site_70697
mod ID: M6ASITE073672		Click to Show/Hide the Full List
mod site	chr1:198756017-198756018:+		[6]
Sequence	TGAATTTGATAATGAAGTGGACAAAGTAAAGCAGGATGCTA
Motif Score	3.643047619
Cell/Tissue List	LCLs; CD8T
Seq Type List	m6A-seq; m6A-CLIP/IP
Transcript ID List	ENST00000348564.11; ENST00000442510.8
External Link	RMBase: m6A_site_70698
mod ID: M6ASITE073674		Click to Show/Hide the Full List
mod site	chr1:198756087-198756088:+		[6]
Sequence	AAGCTCCCTGAAGCAAAGGAACAGGCTGAAGGTTCTGAACC
Motif Score	2.951386905
Cell/Tissue List	LCLs
Seq Type List	m6A-seq
Transcript ID List	ENST00000348564.11; ENST00000442510.8
External Link	RMBase: m6A_site_70699
mod ID: M6ASITE073681		Click to Show/Hide the Full List
mod site	chr1:198756105-198756106:+		[6]
Sequence	GAACAGGCTGAAGGTTCTGAACCCACGAGTGGCACTGAGGG
Motif Score	2.930744048
Cell/Tissue List	LCLs
Seq Type List	m6A-seq
Transcript ID List	ENST00000348564.11; ENST00000442510.8
External Link	RMBase: m6A_site_70700
mod ID: M6ASITE073692		Click to Show/Hide the Full List
mod site	chr1:198756132-198756133:+		[6]
Sequence	AGTGGCACTGAGGGGCCAGAACATTCTGTCAATGGTCCTGC
Motif Score	2.951386905
Cell/Tissue List	LCLs
Seq Type List	m6A-seq
Transcript ID List	ENST00000348564.11; ENST00000442510.8
External Link	RMBase: m6A_site_70701
mod ID: M6ASITE073703		Click to Show/Hide the Full List
mod site	chr1:198756187-198756188:+		[3]
Sequence	ATCAAGGTTCATAGGAAAAGACATAAATGAGGAAACTCCAA
Motif Score	2.897386905
Cell/Tissue List	CD8T; AML
Seq Type List	m6A-CLIP/IP; miCLIP
Transcript ID List	ENST00000348564.11; ENST00000442510.8
External Link	RMBase: m6A_site_70702

Ref 1	Roles of the m(6)A Modification of RNA in the Glioblastoma Microenvironment as Revealed by Single-Cell Analyses. Front Immunol. 2022 Apr 26;13:798583. doi: 10.3389/fimmu.2022.798583. eCollection 2022.
Ref 2	Accurate identification of A-to-I RNA editing in human by transcriptome sequencing. Genome Res. 2012 Jan;22(1):142-50. doi: 10.1101/gr.124107.111. Epub 2011 Sep 29.
Ref 3	A majority of m6A residues are in the last exons, allowing the potential for 3' UTR regulation. Genes Dev. 2015 Oct 1;29(19):2037-53. doi: 10.1101/gad.269415.115. Epub 2015 Sep 24.
Ref 4	The N(6)-methyladenosine (m(6)A)-forming enzyme METTL3 controls myeloid differentiation of normal hematopoietic and leukemia cells. Nat Med. 2017 Nov;23(11):1369-1376. doi: 10.1038/nm.4416. Epub 2017 Sep 18.
Ref 5	Suppression of m(6)A reader Ythdf2 promotes hematopoietic stem cell expansion. Cell Res. 2018 Sep;28(9):904-917. doi: 10.1038/s41422-018-0072-0. Epub 2018 Jul 31.
Ref 6	N6-Methyladenosine in Flaviviridae Viral RNA Genomes Regulates Infection. Cell Host Microbe. 2016 Nov 9;20(5):654-665. doi: 10.1016/j.chom.2016.09.015. Epub 2016 Oct 20.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map