m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00567)

Target Name	RIG-I-like receptor 1 (RIG-I)
Synonyms	ATP-dependent RNA helicase DDX58; DEAD box protein 58; RIG-I-like receptor 1; RLR-1; Retinoic acid-inducible gene 1 protein; RIG-1; Retinoic acid-inducible gene I protein; RIG-I Click to Show/Hide
Gene Name	RIG-I
Chromosomal Location	9p21.1
Family	Helicase family, RLR subfamily
Function	Innate immune receptor that senses cytoplasmic viral nucleic acids and activates a downstream signaling cascade leading to the production of type I interferons and pro-inflammatory cytokines. Forms a ribonucleoprotein complex with viral RNAs on which it homooligomerizes to form filaments. The homooligomerization allows the recruitment of RNF135 an E3 ubiquitin-protein ligase that activates and amplifies the RIG-I-mediated antiviral signaling in an RNA length-dependent manner through ubiquitination-dependent and -independent mechanisms. Upon activation, associates with mitochondria antiviral signaling protein (MAVS/IPS1) that activates the IKK-related kinases TBK1 and IKBKE which in turn phosphorylate the interferon regulatory factors IRF3 and IRF7, activating transcription of antiviral immunological genes including the IFN-alpha and IFN-beta interferons. Ligands include 5'-triphosphorylated ssRNAs and dsRNAs but also short dsRNAs (<1 kb in length) . In addition to the 5'-triphosphate moiety, blunt-end base pairing at the 5'-end of the RNA is very essential. Overhangs at the non-triphosphorylated end of the dsRNA RNA have no major impact on its activity. A 3'overhang at the 5'triphosphate end decreases and any 5'overhang at the 5' triphosphate end abolishes its activity. Detects both positive and negative strand RNA viruses including members of the families Paramyxoviridae: Human respiratory syncytial virus and measles virus (MeV), Rhabdoviridae: vesicular stomatitis virus (VSV), Orthomyxoviridae: influenza A and B virus, Flaviviridae: Japanese encephalitis virus (JEV), hepatitis C virus (HCV), dengue virus (DENV) and west Nile virus (WNV) . It also detects rotaviruses and reoviruses . Detects and binds to SARS-CoV-2 RNAs which is inhibited by m6A RNA modifications (Ref.65). Also involved in antiviral signaling in response to viruses containing a dsDNA genome such as Epstein-Barr virus (EBV). Detects dsRNA produced from non-self dsDNA by RNA polymerase III, such as Epstein-Barr virus-encoded RNAs (EBERs). May play important roles in granulocyte production and differentiation, bacterial phagocytosis and in the regulation of cell migration. Click to Show/Hide
Gene ID	23586
Uniprot ID	DDX58_HUMAN
HGNC ID	HGNC:19102
KEGG ID	hsa:23586

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

RIG-I can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Methyltransferase-like 3 (METTL3) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by METTL3*
Cell Line	LX2 cell line	Homo sapiens
Treatment: shMETTL3 LX2 cells Control: shLuc LX2 cells		GSE207909
Regulation		logFC: -1.14E+00 p-value: 3.48E-03
More Results	Click to View More RNA-seq Results
*Representative RIP-seq result supporting the interaction between RIG-I and the regulator*
Cell Line	MDA-MB-231	Homo sapiens
Regulation	logFC: 1.75E+00	GSE60213

In total 3 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	METTL3 and METTL14 leads to an increase in viral RNA recognition by RIG-I-like receptor 1 (RIG-I), thereby stimulating type I interferon production. The obvious advantage is that m6A deficiency in HBV and HCV induces a higher IFN synthesis and in turn enhance adaptive immunity.
Target Regulation	Down regulation
Responsed Disease	Acute hepatitis B		ICD-11: 1E50.1	Disease Info
Pathway Response	RIG-I-like receptor signaling pathway			hsa04622
In-vitro Model	Huh-7	Adult hepatocellular carcinoma	Homo sapiens	CVCL_0336
In-vitro Model	Hep-G2	Hepatoblastoma	Homo sapiens	CVCL_0027
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	METTL3 and METTL14 leads to an increase in viral RNA recognition by RIG-I-like receptor 1 (RIG-I), thereby stimulating type I interferon production. The obvious advantage is that m6A deficiency in HBV and HCV induces a higher IFN synthesis and in turn enhance adaptive immunity.
Target Regulation	Down regulation
Responsed Disease	Acute hepatitis C		ICD-11: 1E50.2	Disease Info
Pathway Response	RIG-I-like receptor signaling pathway			hsa04622
In-vitro Model	Huh-7	Adult hepatocellular carcinoma	Homo sapiens	CVCL_0336
In-vitro Model	Hep-G2	Hepatoblastoma	Homo sapiens	CVCL_0027
Experiment 3 Reporting the m6A Methylation Regulator of This Target Gene				[2]
Response Summary	In SARS-CoV-2 infection, depletion of the host cell m6A methyltransferase METTL3 decreases m6A levels in SARS-CoV-2 and host genes, and m6A reduction in viral RNA increases RIG-I-like receptor 1 (RIG-I) binding and subsequently enhances the downstream innate immune signaling pathway and inflammatory gene expression.
Target Regulation	Down regulation
Responsed Disease	COVID-19		ICD-11: RA01	Disease Info
Pathway Response	RIG-I-like receptor signaling pathway			hsa04622
Cell Process	Immune responses
In-vitro Model	Calu-3	Lung adenocarcinoma	Homo sapiens	CVCL_0609
	Caco-2	Colon adenocarcinoma	Homo sapiens	CVCL_0025
	HEK293-FT	Normal	Homo sapiens	CVCL_6911

Methyltransferase-like 14 (METTL14) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by METTL14*
Cell Line	Embryonic stem cells	Mus musculus
Treatment: METTL14 knockout mESCs Control: Wild type mESCs		GSE156481
Regulation		logFC: -1.26E+00 p-value: 3.52E-15
More Results	Click to View More RNA-seq Results

In total 2 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	METTL3 and METTL14 leads to an increase in viral RNA recognition by RIG-I-like receptor 1 (RIG-I), thereby stimulating type I interferon production. The obvious advantage is that m6A deficiency in HBV and HCV induces a higher IFN synthesis and in turn enhance adaptive immunity.
Target Regulation	Down regulation
Responsed Disease	Acute hepatitis B		ICD-11: 1E50.1	Disease Info
Pathway Response	RIG-I-like receptor signaling pathway			hsa04622
In-vitro Model	Huh-7	Adult hepatocellular carcinoma	Homo sapiens	CVCL_0336
In-vitro Model	Hep-G2	Hepatoblastoma	Homo sapiens	CVCL_0027
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	METTL3 and METTL14 leads to an increase in viral RNA recognition by RIG-I-like receptor 1 (RIG-I), thereby stimulating type I interferon production. The obvious advantage is that m6A deficiency in HBV and HCV induces a higher IFN synthesis and in turn enhance adaptive immunity.
Target Regulation	Down regulation
Responsed Disease	Acute hepatitis C		ICD-11: 1E50.2	Disease Info
Pathway Response	RIG-I-like receptor signaling pathway			hsa04622
In-vitro Model	Huh-7	Adult hepatocellular carcinoma	Homo sapiens	CVCL_0336
In-vitro Model	Hep-G2	Hepatoblastoma	Homo sapiens	CVCL_0027

RNA demethylase ALKBH5 (ALKBH5) [ERASER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by ALKBH5*
Cell Line	Cal27 cell line	Homo sapiens
Treatment: siALKBH5 Cal27 cells Control: siScramble Cal27 cells		GSE185886
Regulation		logFC: 7.29E-01 p-value: 2.91E-02
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[3]
Response Summary	ALKBH5 overexpression inhibits RIG-I-mediated IFN-Alpha secretion through the IKK-Epsilon/TBK1/IRF3 pathway. Upregulation of AKLBH5 negatively correlates with RIG-I-like receptor 1 (RIG-I) and IFN-Alpha expression in head and neck squamous cell carcinoma (HNSCC) patients.
Target Regulation	Down regulation
Responsed Disease	Head and neck squamous carcinoma		ICD-11: 2B6E	Disease Info
Pathway Response	RIG-I-like receptor signaling pathway			hsa04622
In-vitro Model	CAL-27	Tongue squamous cell carcinoma	Homo sapiens	CVCL_1107
	SCC-4	Tongue squamous cell carcinoma	Homo sapiens	CVCL_1684
	SCC-25	Tongue squamous cell carcinoma	Homo sapiens	CVCL_1682
	HEK293T	Normal	Homo sapiens	CVCL_0063
	()
In-vivo Model	For the subcutaneous implantation model, 1 × 10⁶ Cal27 cells stably transduced with lentivirus were injected into the left or right flanks of BALB/c nude mice (aged 4-6 weeks). Following stable transfection, 2 × 10⁵ SCC7 cells were subcutaneously inoculated into C3H mice (aged 6-8 weeks).

Acute viral hepatitis [ICD-11: 1E50]

Disease Info

In total 4 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	METTL3 and METTL14 leads to an increase in viral RNA recognition by RIG-I-like receptor 1 (RIG-I), thereby stimulating type I interferon production. The obvious advantage is that m6A deficiency in HBV and HCV induces a higher IFN synthesis and in turn enhance adaptive immunity.
Responsed Disease	Acute hepatitis B [ICD-11: 1E50.1]
Target Regulator	Methyltransferase-like 14 (METTL14)		WRITER	Regulator Info
Target Regulation	Down regulation
Pathway Response	RIG-I-like receptor signaling pathway			hsa04622
In-vitro Model	Huh-7	Adult hepatocellular carcinoma	Homo sapiens	CVCL_0336
In-vitro Model	Hep-G2	Hepatoblastoma	Homo sapiens	CVCL_0027
Experiment 2 Reporting the m6A-centered Disease Response				[1]
Response Summary	METTL3 and METTL14 leads to an increase in viral RNA recognition by RIG-I-like receptor 1 (RIG-I), thereby stimulating type I interferon production. The obvious advantage is that m6A deficiency in HBV and HCV induces a higher IFN synthesis and in turn enhance adaptive immunity.
Responsed Disease	Acute hepatitis C [ICD-11: 1E50.2]
Target Regulator	Methyltransferase-like 14 (METTL14)		WRITER	Regulator Info
Target Regulation	Down regulation
Pathway Response	RIG-I-like receptor signaling pathway			hsa04622
In-vitro Model	Huh-7	Adult hepatocellular carcinoma	Homo sapiens	CVCL_0336
In-vitro Model	Hep-G2	Hepatoblastoma	Homo sapiens	CVCL_0027
Experiment 3 Reporting the m6A-centered Disease Response				[1]
Response Summary	METTL3 and METTL14 leads to an increase in viral RNA recognition by RIG-I-like receptor 1 (RIG-I), thereby stimulating type I interferon production. The obvious advantage is that m6A deficiency in HBV and HCV induces a higher IFN synthesis and in turn enhance adaptive immunity.
Responsed Disease	Acute hepatitis B [ICD-11: 1E50.1]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Down regulation
Pathway Response	RIG-I-like receptor signaling pathway			hsa04622
In-vitro Model	Huh-7	Adult hepatocellular carcinoma	Homo sapiens	CVCL_0336
In-vitro Model	Hep-G2	Hepatoblastoma	Homo sapiens	CVCL_0027
Experiment 4 Reporting the m6A-centered Disease Response				[1]
Response Summary	METTL3 and METTL14 leads to an increase in viral RNA recognition by RIG-I-like receptor 1 (RIG-I), thereby stimulating type I interferon production. The obvious advantage is that m6A deficiency in HBV and HCV induces a higher IFN synthesis and in turn enhance adaptive immunity.
Responsed Disease	Acute hepatitis C [ICD-11: 1E50.2]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Down regulation
Pathway Response	RIG-I-like receptor signaling pathway			hsa04622
In-vitro Model	Huh-7	Adult hepatocellular carcinoma	Homo sapiens	CVCL_0336
In-vitro Model	Hep-G2	Hepatoblastoma	Homo sapiens	CVCL_0027

Head and neck squamous carcinoma [ICD-11: 2B6E]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[3]
Response Summary	ALKBH5 overexpression inhibits RIG-I-mediated IFN-Alpha secretion through the IKK-Epsilon/TBK1/IRF3 pathway. Upregulation of AKLBH5 negatively correlates with RIG-I-like receptor 1 (RIG-I) and IFN-Alpha expression in head and neck squamous cell carcinoma (HNSCC) patients.
Responsed Disease	Head and neck squamous carcinoma [ICD-11: 2B6E]
Target Regulator	RNA demethylase ALKBH5 (ALKBH5)		ERASER	Regulator Info
Target Regulation	Down regulation
Pathway Response	RIG-I-like receptor signaling pathway			hsa04622
In-vitro Model	CAL-27	Tongue squamous cell carcinoma	Homo sapiens	CVCL_1107
	SCC-4	Tongue squamous cell carcinoma	Homo sapiens	CVCL_1684
	SCC-25	Tongue squamous cell carcinoma	Homo sapiens	CVCL_1682
	HEK293T	Normal	Homo sapiens	CVCL_0063
	()
In-vivo Model	For the subcutaneous implantation model, 1 × 10⁶ Cal27 cells stably transduced with lentivirus were injected into the left or right flanks of BALB/c nude mice (aged 4-6 weeks). Following stable transfection, 2 × 10⁵ SCC7 cells were subcutaneously inoculated into C3H mice (aged 6-8 weeks).

COVID-19 [ICD-11: RA01]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[2]
Response Summary	In SARS-CoV-2 infection, depletion of the host cell m6A methyltransferase METTL3 decreases m6A levels in SARS-CoV-2 and host genes, and m6A reduction in viral RNA increases RIG-I-like receptor 1 (RIG-I) binding and subsequently enhances the downstream innate immune signaling pathway and inflammatory gene expression.
Responsed Disease	COVID-19 [ICD-11: RA01]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Down regulation
Pathway Response	RIG-I-like receptor signaling pathway			hsa04622
Cell Process	Immune responses
In-vitro Model	Calu-3	Lung adenocarcinoma	Homo sapiens	CVCL_0609
	Caco-2	Colon adenocarcinoma	Homo sapiens	CVCL_0025
	HEK293-FT	Normal	Homo sapiens	CVCL_6911

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00567)

RIG-I-like receptor 1 (RIG-I)

Adenosine-to-Inosine editing (A-to-I)

In total 13 m6A sequence/site(s) in this target gene
mod ID: A2ISITE003113		Click to Show/Hide the Full List
mod site	chr9:32455467-32455468:-		[5]
Sequence	GTTAGTTCTCATGAGATCTGATGGTTTTATAAGTGTTTGAC
Transcript ID List	rmsk_2734529; ENST00000379883.3
External Link	RMBase: RNA-editing_site_134688
mod ID: A2ISITE003114		Click to Show/Hide the Full List
mod site	chr9:32456303-32456304:-		[6]
Sequence	CTCTACAGTGGTCAGCTTTTAGTAGAGAGCATAAAAATGAT
Transcript ID List	ENST00000379883.3; ENST00000379868.5
External Link	RMBase: RNA-editing_site_134689
mod ID: A2ISITE003115		Click to Show/Hide the Full List
mod site	chr9:32456317-32456318:-		[5]
Sequence	GCAATGTGTATCCACTCTACAGTGGTCAGCTTTTAGTAGAG
Transcript ID List	ENST00000379868.5; ENST00000379883.3
External Link	RMBase: RNA-editing_site_134690
mod ID: A2ISITE003116		Click to Show/Hide the Full List
mod site	chr9:32456319-32456320:-		[5]
Sequence	TAGCAATGTGTATCCACTCTACAGTGGTCAGCTTTTAGTAG
Transcript ID List	ENST00000379883.3; ENST00000379868.5
External Link	RMBase: RNA-editing_site_134691
mod ID: A2ISITE003117		Click to Show/Hide the Full List
mod site	chr9:32456366-32456367:-		[5]
Sequence	TTTTTATGCTTACTACTAAAAGCTGTCCACTGTAGAGTTGC
Transcript ID List	ENST00000379883.3; ENST00000379868.5
External Link	RMBase: RNA-editing_site_134693
mod ID: A2ISITE003118		Click to Show/Hide the Full List
mod site	chr9:32456369-32456370:-		[6]
Sequence	CCATTTTTATGCTTACTACTAAAAGCTGTCCACTGTAGAGT
Transcript ID List	ENST00000379868.5; ENST00000379883.3
External Link	RMBase: RNA-editing_site_134694
mod ID: A2ISITE003119		Click to Show/Hide the Full List
mod site	chr9:32456372-32456373:-		[6]
Sequence	AAGCCATTTTTATGCTTACTACTAAAAGCTGTCCACTGTAG
Transcript ID List	ENST00000379883.3; ENST00000379868.5
External Link	RMBase: RNA-editing_site_134695
mod ID: A2ISITE003120		Click to Show/Hide the Full List
mod site	chr9:32456381-32456382:-		[5]
Sequence	GAGAACATAAAGCCATTTTTATGCTTACTACTAAAAGCTGT
Transcript ID List	ENST00000379883.3; ENST00000379868.5
External Link	RMBase: RNA-editing_site_134696
mod ID: A2ISITE003121		Click to Show/Hide the Full List
mod site	chr9:32456414-32456415:-		[6]
Sequence	TAGCAACGTGTGGTATGGCTACACAGAGAACATGAGAACAT
Transcript ID List	ENST00000379868.5; ENST00000379883.3
External Link	RMBase: RNA-editing_site_134697
mod ID: A2ISITE003122		Click to Show/Hide the Full List
mod site	chr9:32456450-32456451:-		[6]
Sequence	TATATGTAATGGTTATATGTACTCATGTTCCTGGTGTAGCA
Transcript ID List	ENST00000379868.5; ENST00000379883.3
External Link	RMBase: RNA-editing_site_134698
mod ID: A2ISITE003123		Click to Show/Hide the Full List
mod site	chr9:32456454-32456455:-		[6]
Sequence	TATGTATATGTAATGGTTATATGTACTCATGTTCCTGGTGT
Transcript ID List	ENST00000379883.3; ENST00000379868.5
External Link	RMBase: RNA-editing_site_134699
mod ID: A2ISITE003124		Click to Show/Hide the Full List
mod site	chr9:32456487-32456488:-		[5]
Sequence	TATGTATATGTAACTAATATACATACATACAGGTATGTATA
Transcript ID List	ENST00000379883.3; ENST00000379868.5
External Link	RMBase: RNA-editing_site_134700
mod ID: A2ISITE003125		Click to Show/Hide the Full List
mod site	chr9:32456489-32456490:-		[5]
Sequence	CATATGTATATGTAACTAATATACATACATACAGGTATGTA
Transcript ID List	ENST00000379868.5; ENST00000379883.3
External Link	RMBase: RNA-editing_site_134701

5-methylcytidine (m5C)

In total 1 m6A sequence/site(s) in this target gene
mod ID: M5CSITE004394		Click to Show/Hide the Full List
mod site	chr9:32459401-32459402:-		[7]
Sequence	CAGAAAGTGCAAAGCCTTGGCATGTTACACAGCTGACGTAA
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000379868.5; ENST00000379883.3
External Link	RMBase: m5C_site_42415

N6-methyladenosine (m6A)

In total 29 m6A sequence/site(s) in this target gene
mod ID: M6ASITE087866		Click to Show/Hide the Full List
mod site	chr9:32456163-32456164:-		[8]
Sequence	TGTTGATGTTCAACACCTGGACTGAATGTCTGTTCTCAGAT
Motif Score	4.065041667
Cell/Tissue List	MSC
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000379883.3; ENST00000379868.5
External Link	RMBase: m6A_site_818395
mod ID: M6ASITE087867		Click to Show/Hide the Full List
mod site	chr9:32456171-32456172:-		[9]
Sequence	TATAATGATGTTGATGTTCAACACCTGGACTGAATGTCTGT
Motif Score	2.173910714
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000379868.5; ENST00000379883.3
External Link	RMBase: m6A_site_818396
mod ID: M6ASITE087868		Click to Show/Hide the Full List
mod site	chr9:32457065-32457066:-		[10]
Sequence	TAACTTTGAGTGGAGAAGAAACAAACATAGTGGGTATAATC
Motif Score	2.20572619
Cell/Tissue List	HepG2; HEK293T; HeLa; A549; hESCs; fibroblasts; GM12878; MM6; Huh7; GSC-11; iSLK; MSC; TIME; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000379868.5; ENST00000379883.3
External Link	RMBase: m6A_site_818397
mod ID: M6ASITE087869		Click to Show/Hide the Full List
mod site	chr9:32457083-32457084:-		[11]
Sequence	TCAGCTACAGGGAATGAGTAACTTTGAGTGGAGAAGAAACA
Motif Score	2.590089286
Cell/Tissue List	CD8T
Seq Type List	m6A-CLIP/IP
Transcript ID List	ENST00000379868.5; ENST00000379883.3
External Link	RMBase: m6A_site_818398
mod ID: M6ASITE087870		Click to Show/Hide the Full List
mod site	chr9:32457170-32457171:-		[12]
Sequence	ACTGTACTCGAAGTGGAAGGACTTTCATTTTGAGAAGATAC
Motif Score	4.065041667
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; H1A; hESCs; fibroblasts; GM12878; LCLs; CD8T; MM6; Huh7; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List	ENST00000379868.5; ENST00000379883.3
External Link	RMBase: m6A_site_818399
mod ID: M6ASITE087871		Click to Show/Hide the Full List
mod site	chr9:32457192-32457193:-		[12]
Sequence	ATATTGCAACTGGAGTTCAGACACTGTACTCGAAGTGGAAG
Motif Score	2.897386905
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; hESCs; fibroblasts; GM12878; LCLs; MM6; Huh7; CD4T; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000379883.3; ENST00000379868.5
External Link	RMBase: m6A_site_818400
mod ID: M6ASITE087872		Click to Show/Hide the Full List
mod site	chr9:32457204-32457205:-		[11]
Sequence	TTGTGGTGGAGGATATTGCAACTGGAGTTCAGACACTGTAC
Motif Score	2.595904762
Cell/Tissue List	CD8T
Seq Type List	m6A-CLIP/IP
Transcript ID List	ENST00000379883.3; ENST00000379868.5
External Link	RMBase: m6A_site_818401
mod ID: M6ASITE087873		Click to Show/Hide the Full List
mod site	chr9:32457258-32457259:-		[12]
Sequence	GAATCCATGTGAAGTACAAGACATTTGAGATTCCAGTTATA
Motif Score	2.897386905
Cell/Tissue List	HeLa; HEK293T; A549; HepG2; hESCs; fibroblasts; GM12878; MM6; Huh7; CD4T; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000379883.3; ENST00000379868.5
External Link	RMBase: m6A_site_818402
mod ID: M6ASITE087874		Click to Show/Hide the Full List
mod site	chr9:32457296-32457297:-		[13]
Sequence	GATATTCTGTGCCCGACAGAACTGCAGCCATGACTGGGGAA
Motif Score	3.373380952
Cell/Tissue List	HEK293T; HeLa; A549; HepG2; hESCs; fibroblasts; GM12878; CD8T; Huh7; GSC-11; HEK293A-TOA; iSLK; MSC; HEC-1-A; NB4
Seq Type List	MeRIP-seq; m6A-seq; m6A-CLIP/IP
Transcript ID List	ENST00000379883.3; ENST00000379868.5
External Link	RMBase: m6A_site_818403
mod ID: M6ASITE087875		Click to Show/Hide the Full List
mod site	chr9:32457364-32457365:-		[13]
Sequence	AAGGAATGCTTTGTGAGTAGACCACATCCCAAGCCAAAGCA
Motif Score	2.876744048
Cell/Tissue List	HEK293T; HeLa; HepG2; fibroblasts; A549; Huh7
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000379883.3; ENST00000379868.5
External Link	RMBase: m6A_site_818404
mod ID: M6ASITE087876		Click to Show/Hide the Full List
mod site	chr9:32473017-32473018:-		[12]
Sequence	CCTAAACTCAGTTTTCTAAAACCTGGCATATTGACTGGACG
Motif Score	2.185083333
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000379868.5; ENST00000379883.3
External Link	RMBase: m6A_site_818406
mod ID: M6ASITE087877		Click to Show/Hide the Full List
mod site	chr9:32473032-32473033:-		[12]
Sequence	TGGATTGAAGGAAATCCTAAACTCAGTTTTCTAAAACCTGG
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000379868.5; ENST00000379883.3
External Link	RMBase: m6A_site_818407
mod ID: M6ASITE087878		Click to Show/Hide the Full List
mod site	chr9:32476999-32477000:-		[12]
Sequence	TAACAATTCTCTTTGTGAAAACCAGAGCACTTGTGGACGTA
Motif Score	2.185083333
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000379868.5; ENST00000379883.3
External Link	RMBase: m6A_site_818408
mod ID: M6ASITE087879		Click to Show/Hide the Full List
mod site	chr9:32477023-32477024:-		[12]
Sequence	AGTACCACTTAAACCCAGAGACAATAACAATTCTCTTTGTG
Motif Score	2.897386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000379883.3; ENST00000379868.5
External Link	RMBase: m6A_site_818409
mod ID: M6ASITE087880		Click to Show/Hide the Full List
mod site	chr9:32488849-32488850:-		[12]
Sequence	GTTTCACTGCTTATATGTGAACATCATCTTAAAAAATTCCC
Motif Score	2.951386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000379868.5; ENST00000379883.3
External Link	RMBase: m6A_site_818410
mod ID: M6ASITE087881		Click to Show/Hide the Full List
mod site	chr9:32488875-32488876:-		[12]
Sequence	TGTTAAAAGGTTGTGGAAAAACCTTTGTTTCACTGCTTATA
Motif Score	2.185083333
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000379868.5; ENST00000379883.3
External Link	RMBase: m6A_site_818411
mod ID: M6ASITE087882		Click to Show/Hide the Full List
mod site	chr9:32489366-32489367:-		[12]
Sequence	GCCTGCTATGAAAGGAAAAAACACAATAATATGTGCTCCTA
Motif Score	2.20572619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000379868.5; ENST00000379883.3
External Link	RMBase: m6A_site_818412
mod ID: M6ASITE087883		Click to Show/Hide the Full List
mod site	chr9:32489416-32489417:-		[12]
Sequence	AACTTGTACAGCCCATTTAAACCAAGAAATTACCAATTAGA
Motif Score	2.185083333
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000379883.3; ENST00000379868.5
External Link	RMBase: m6A_site_818413
mod ID: M6ASITE087884		Click to Show/Hide the Full List
mod site	chr9:32489435-32489436:-		[12]
Sequence	TCCAGAAGTGTCTGATACAAACTTGTACAGCCCATTTAAAC
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000379883.3; ENST00000379868.5
External Link	RMBase: m6A_site_818414
mod ID: M6ASITE087885		Click to Show/Hide the Full List
mod site	chr9:32492409-32492410:-		[14]
Sequence	GAAAGGAACAAGTTCAGTGAACTGTGGATTGTAGAGAAAGG
Motif Score	3.373380952
Cell/Tissue List	HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000379883.3; ENST00000379868.5
External Link	RMBase: m6A_site_818415
mod ID: M6ASITE087886		Click to Show/Hide the Full List
mod site	chr9:32492422-32492423:-		[14]
Sequence	TGCTTTGGAGAAAGAAAGGAACAAGTTCAGTGAACTGTGGA
Motif Score	2.951386905
Cell/Tissue List	HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000379883.3; ENST00000379868.5
External Link	RMBase: m6A_site_818416
mod ID: M6ASITE087887		Click to Show/Hide the Full List
mod site	chr9:32492445-32492446:-		[15]
Sequence	AACTGGCCCAAAACTTTGAAACTTGCTTTGGAGAAAGAAAG
Motif Score	2.627720238
Cell/Tissue List	HEK293T; HEC-1-A
Seq Type List	DART-seq; m6A-seq
Transcript ID List	ENST00000379883.3; ENST00000379868.5
External Link	RMBase: m6A_site_818417
mod ID: M6ASITE087888		Click to Show/Hide the Full List
mod site	chr9:32492453-32492454:-		[14]
Sequence	ACAAGGAAAACTGGCCCAAAACTTTGAAACTTGCTTTGGAG
Motif Score	2.627720238
Cell/Tissue List	HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000379883.3; ENST00000379868.5
External Link	RMBase: m6A_site_818418
mod ID: M6ASITE087889		Click to Show/Hide the Full List
mod site	chr9:32492464-32492465:-		[14]
Sequence	TCTCAGATCAGACAAGGAAAACTGGCCCAAAACTTTGAAAC
Motif Score	2.627720238
Cell/Tissue List	HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000379883.3; ENST00000379868.5
External Link	RMBase: m6A_site_818419
mod ID: M6ASITE087890		Click to Show/Hide the Full List
mod site	chr9:32492473-32492474:-		[14]
Sequence	GGAATGCCTTCTCAGATCAGACAAGGAAAACTGGCCCAAAA
Motif Score	2.897386905
Cell/Tissue List	HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000379868.5; ENST00000379883.3
External Link	RMBase: m6A_site_818420
mod ID: M6ASITE087891		Click to Show/Hide the Full List
mod site	chr9:32500908-32500909:-		[12]
Sequence	GTATATTCAGGCTGAGAAAAACAACAAGGGCCCAATGGAGG
Motif Score	2.20572619
Cell/Tissue List	HeLa; A549; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000379868.5; ENST00000379883.3
External Link	RMBase: m6A_site_818421
mod ID: M6ASITE087892		Click to Show/Hide the Full List
mod site	chr9:32526104-32526105:-		[12]
Sequence	TTATATCCGGAAGACCCTGGACCCTACCTACATCCTGAGCT
Motif Score	3.622404762
Cell/Tissue List	HeLa; A549; TIME; iSLK; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000379883.3; ENST00000379868.5
External Link	RMBase: m6A_site_818422
mod ID: M6ASITE087893		Click to Show/Hide the Full List
mod site	chr9:32526111-32526112:-		[12]
Sequence	TCCAGGATTATATCCGGAAGACCCTGGACCCTACCTACATC
Motif Score	2.876744048
Cell/Tissue List	HeLa; A549; TIME; iSLK; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000379868.5; ENST00000379883.3
External Link	RMBase: m6A_site_818423
mod ID: M6ASITE087894		Click to Show/Hide the Full List
mod site	chr9:32526193-32526194:-		[11]
Sequence	TGAGGCACAGCCTGCGGGGAACGTAGCTAGCTGCAAGCAGA
Motif Score	2.925321429
Cell/Tissue List	CD8T
Seq Type List	m6A-CLIP/IP
Transcript ID List	ENST00000379883.3; ENST00000379868.5
External Link	RMBase: m6A_site_818424

Ref 1	N (6)-Methyladenosine modification of hepatitis B and C viral RNAs attenuates host innate immunity via RIG-I signaling. J Biol Chem. 2020 Sep 11;295(37):13123-13133. doi: 10.1074/jbc.RA120.014260. Epub 2020 Jul 27.
Ref 2	METTL3 regulates viral m6A RNA modification and host cell innate immune responses during SARS-CoV-2 infection. Cell Rep. 2021 May 11;35(6):109091. doi: 10.1016/j.celrep.2021.109091. Epub 2021 May 3.
Ref 3	The m6A demethylase ALKBH5 promotes tumor progression by inhibiting RIG-I expression and interferon alpha production through the IKKEpsilon/TBK1/IRF3 pathway in head and neck squamous cell carcinoma. Mol Cancer. 2022 Apr 9;21(1):97. doi: 10.1186/s12943-022-01572-2.
Ref 4	The selectivity of protein kinase inhibitors: a further update. Biochem J. 2007 Dec 15;408(3):297-315. doi: 10.1042/BJ20070797.
Ref 5	Systematic identification of abundant A-to-I editing sites in the human transcriptome. Nat Biotechnol. 2004 Aug;22(8):1001-5. doi: 10.1038/nbt996. Epub 2004 Jul 18.
Ref 6	RADAR: a rigorously annotated database of A-to-I RNA editing. Nucleic Acids Res. 2014 Jan;42(Database issue):D109-13. doi: 10.1093/nar/gkt996. Epub 2013 Oct 25.
Ref 7	5-methylcytosine promotes mRNA export - NSUN2 as the methyltransferase and ALYREF as an m(5)C reader. Cell Res. 2017 May;27(5):606-625. doi: 10.1038/cr.2017.55. Epub 2017 Apr 18.
Ref 8	Viral and cellular N(6)-methyladenosine and N(6),2'-O-dimethyladenosine epitranscriptomes in the KSHV life cycle. Nat Microbiol. 2018 Jan;3(1):108-120. doi: 10.1038/s41564-017-0056-8. Epub 2017 Nov 6.
Ref 9	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.
Ref 10	Histone H3 trimethylation at lysine 36 guides m(6)A RNA modification co-transcriptionally. Nature. 2019 Mar;567(7748):414-419. doi: 10.1038/s41586-019-1016-7. Epub 2019 Mar 13.
Ref 11	A majority of m6A residues are in the last exons, allowing the potential for 3' UTR regulation. Genes Dev. 2015 Oct 1;29(19):2037-53. doi: 10.1101/gad.269415.115. Epub 2015 Sep 24.
Ref 12	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 13	Viral N(6)-methyladenosine upregulates replication and pathogenesis of human respiratory syncytial virus. Nat Commun. 2019 Oct 9;10(1):4595. doi: 10.1038/s41467-019-12504-y.
Ref 14	m(6)A mRNA methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer. Nat Cell Biol. 2018 Sep;20(9):1074-1083. doi: 10.1038/s41556-018-0174-4. Epub 2018 Aug 27.
Ref 15	DART-seq: an antibody-free method for global m(6)A detection. Nat Methods. 2019 Dec;16(12):1275-1280. doi: 10.1038/s41592-019-0570-0. Epub 2019 Sep 23.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map