m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00496)

Target Name	Prostate cancer associated transcript 6 (PCAT6)
Synonyms	ncRNA-a2; PCAN-R1; KDM5BAS1; onco-lncRNA-96prostate cancer-associated noncoding RNA 1KDM5B-AS1 Click to Show/Hide
Gene Name	PCAT6
Chromosomal Location	1q32.1
Gene ID	100506696
HGNC ID	HGNC:43714

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

PCAT6 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Methyltransferase-like 3 (METTL3) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by METTL3*
Cell Line	ARPE-19 cell line	Homo sapiens
Treatment: shMETTL3 ARPE-19 cells Control: shControl ARPE-19 cells		GSE202017
Regulation		logFC: 1.32E+00 p-value: 7.57E-06
More Results	Click to View More RNA-seq Results
*Representative RIP-seq result supporting the interaction between PCAT6 and the regulator*
Cell Line	MDA-MB-231	Homo sapiens
Regulation	logFC: 7.42E+00	GSE60213

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	METTL3-mediated m6A modification contributed to Prostate cancer associated transcript 6 (PCAT6) upregulation in an IGF2BP2-dependent manner. Furthermore, PCAT6 upregulated IGF1R expression by enhancing IGF1R mRNA stability through the PCAT6/IGF2BP2/IGF1R RNA-protein three-dimensional complex. The m6 A-induced PCAT6/IGF2BP2/IGF1R axis promotes PCa bone metastasis and tumor growth, suggesting that PCAT6 serves as a promising prognostic marker and therapeutic target against bone-metastatic PCa.
Target Regulation	Up regulation
Responsed Disease	Prostate cancer		ICD-11: 2C82	Disease Info
Cell Process	RNA stability
In-vitro Model	PC-3	Prostate carcinoma	Homo sapiens	CVCL_0035
In-vitro Model	LNCaP C4-2B	Prostate carcinoma	Homo sapiens	CVCL_4784
In-vivo Model	At 1 week post-injection with PC-3 cells, mice were randomly assigned to three groups (n = 8 per group): the ASO-NC group (injection with ASO negative control targeting unknown sequence, 5 nmol in 100 uL PBS for each mouse), the ASO-L group (injection with low-dose ASO targeting PCAT6, 5 nmol in 100 uL PBS for each mouse), and the ASO-H group (injection with high-dose ASO targeting PCAT6, 10 nmol in 100 uL PBS for each mouse).

Insulin-like growth factor 2 mRNA-binding protein 2 (IGF2BP2) [READER]

Regulator Info

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	METTL3-mediated m6A modification contributed to Prostate cancer associated transcript 6 (PCAT6) upregulation in an IGF2BP2-dependent manner. Furthermore, PCAT6 upregulated IGF1R expression by enhancing IGF1R mRNA stability through the PCAT6/IGF2BP2/IGF1R RNA-protein three-dimensional complex. The m6 A-induced PCAT6/IGF2BP2/IGF1R axis promotes PCa bone metastasis and tumor growth, suggesting that PCAT6 serves as a promising prognostic marker and therapeutic target against bone-metastatic PCa.
Target Regulation	Up regulation
Responsed Disease	Prostate cancer		ICD-11: 2C82	Disease Info
Cell Process	RNA stability
In-vitro Model	PC-3	Prostate carcinoma	Homo sapiens	CVCL_0035
In-vitro Model	LNCaP C4-2B	Prostate carcinoma	Homo sapiens	CVCL_4784
In-vivo Model	At 1 week post-injection with PC-3 cells, mice were randomly assigned to three groups (n = 8 per group): the ASO-NC group (injection with ASO negative control targeting unknown sequence, 5 nmol in 100 uL PBS for each mouse), the ASO-L group (injection with low-dose ASO targeting PCAT6, 5 nmol in 100 uL PBS for each mouse), and the ASO-H group (injection with high-dose ASO targeting PCAT6, 10 nmol in 100 uL PBS for each mouse).

Prostate cancer [ICD-11: 2C82]

Disease Info

In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	METTL3-mediated m6A modification contributed to Prostate cancer associated transcript 6 (PCAT6) upregulation in an IGF2BP2-dependent manner. Furthermore, PCAT6 upregulated IGF1R expression by enhancing IGF1R mRNA stability through the PCAT6/IGF2BP2/IGF1R RNA-protein three-dimensional complex. The m6 A-induced PCAT6/IGF2BP2/IGF1R axis promotes PCa bone metastasis and tumor growth, suggesting that PCAT6 serves as a promising prognostic marker and therapeutic target against bone-metastatic PCa.
Responsed Disease	Prostate cancer [ICD-11: 2C82]
Target Regulator	Insulin-like growth factor 2 mRNA-binding protein 2 (IGF2BP2)		READER	Regulator Info
Target Regulation	Up regulation
Cell Process	RNA stability
In-vitro Model	PC-3	Prostate carcinoma	Homo sapiens	CVCL_0035
	LNCaP C4-2B	Prostate carcinoma	Homo sapiens	CVCL_4784
In-vivo Model	At 1 week post-injection with PC-3 cells, mice were randomly assigned to three groups (n = 8 per group): the ASO-NC group (injection with ASO negative control targeting unknown sequence, 5 nmol in 100 uL PBS for each mouse), the ASO-L group (injection with low-dose ASO targeting PCAT6, 5 nmol in 100 uL PBS for each mouse), and the ASO-H group (injection with high-dose ASO targeting PCAT6, 10 nmol in 100 uL PBS for each mouse).
Experiment 2 Reporting the m6A-centered Disease Response				[1]
Response Summary	METTL3-mediated m6A modification contributed to Prostate cancer associated transcript 6 (PCAT6) upregulation in an IGF2BP2-dependent manner. Furthermore, PCAT6 upregulated IGF1R expression by enhancing IGF1R mRNA stability through the PCAT6/IGF2BP2/IGF1R RNA-protein three-dimensional complex. The m6 A-induced PCAT6/IGF2BP2/IGF1R axis promotes PCa bone metastasis and tumor growth, suggesting that PCAT6 serves as a promising prognostic marker and therapeutic target against bone-metastatic PCa.
Responsed Disease	Prostate cancer [ICD-11: 2C82]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Cell Process	RNA stability
In-vitro Model	PC-3	Prostate carcinoma	Homo sapiens	CVCL_0035
	LNCaP C4-2B	Prostate carcinoma	Homo sapiens	CVCL_4784
In-vivo Model	At 1 week post-injection with PC-3 cells, mice were randomly assigned to three groups (n = 8 per group): the ASO-NC group (injection with ASO negative control targeting unknown sequence, 5 nmol in 100 uL PBS for each mouse), the ASO-L group (injection with low-dose ASO targeting PCAT6, 5 nmol in 100 uL PBS for each mouse), and the ASO-H group (injection with high-dose ASO targeting PCAT6, 10 nmol in 100 uL PBS for each mouse).

Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator

Non-coding RNA

m6A Regulator: Methyltransferase-like 3 (METTL3)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05571		Crosstalk Info
Epigenetic Regulator	Prostate cancer associated transcript 6 (PCAT6)
Regulated Target	Insulin like growth factor 2 mRNA binding protein 2 (IGF2BP2)
Crosstalk relationship	m6A → ncRNA
Disease	Prostate cancer	Disease Info

m6A Regulator: Insulin-like growth factor 2 mRNA-binding protein 2 (IGF2BP2)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05572		Crosstalk Info
Epigenetic Regulator	Prostate cancer associated transcript 6 (PCAT6)
Regulated Target	Insulin like growth factor 2 mRNA binding protein 2 (IGF2BP2)
Crosstalk relationship	m6A → ncRNA
Disease	Prostate cancer	Disease Info

m6A Regulator: Insulin-like growth factor 2 mRNA-binding protein 1 (IGF2BP1)

Regulator Info

In total 4 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05803		Crosstalk Info
Epigenetic Regulator	Prostate cancer associated transcript 6 (PCAT6)
Regulated Target	MiR-513 family
Crosstalk relationship	m6A → ncRNA
Disease	Glioblastoma	Disease Info
Crosstalk ID: M6ACROT05882		Crosstalk Info
Epigenetic Regulator	MicroRNA 513a-1 (MIR513A1)
Regulated Target	Insulin like growth factor 2 mRNA binding protein 1 (IGF2BP1)
Crosstalk relationship	m6A → ncRNA
Disease	Glioblastoma	Disease Info
Crosstalk ID: M6ACROT05883		Crosstalk Info
Epigenetic Regulator	Prostate cancer associated transcript 6 (PCAT6)
Regulated Target	MiR-513 family
Crosstalk relationship	ncRNA → m6A
Disease	Glioblastoma	Disease Info
Crosstalk ID: M6ACROT05884		Crosstalk Info
Epigenetic Regulator	MicroRNA 513a-1 (MIR513A1)
Regulated Target	Insulin like growth factor 2 mRNA binding protein 1 (IGF2BP1)
Crosstalk relationship	ncRNA → m6A
Disease	Glioblastoma	Disease Info

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00496)

Prostate cancer associated transcript 6 (PCAT6)

N6-methyladenosine (m6A)

In total 8 m6A sequence/site(s) in this target gene
mod ID: M6ASITE076469		Click to Show/Hide the Full List
mod site	chr1:202810962-202810963:+		[3]
Sequence	CTGGACGCCCCAGAGGCCGGACCTGGGCAACCCCAGCCTGG
Motif Score	3.622404762
Cell/Tissue List	HeLa; HepG2; H1A; H1B; Jurkat; MSC; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000425295.1; ENST00000417262.5; ENST00000553157.1
External Link	RMBase: m6A_site_72920
mod ID: M6ASITE076470		Click to Show/Hide the Full List
mod site	chr1:202811089-202811090:+		[3]
Sequence	GCCCAGGCGGCCGGAGCGGAACCCAGCCCCGCTCCGAGTGC
Motif Score	2.930744048
Cell/Tissue List	HeLa; HepG2; A549; H1A; H1B; LCLs; MM6; Jurkat; GSC-11; MSC; TREX; iSLK; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000417262.5; ENST00000553157.1; ENST00000425295.1
External Link	RMBase: m6A_site_72921
mod ID: M6ASITE076471		Click to Show/Hide the Full List
mod site	chr1:202811123-202811124:+		[3]
Sequence	CGAGTGCCACGTCTCCAGGAACCCCCTCCTTACTCTTGGAC
Motif Score	2.930744048
Cell/Tissue List	HeLa; HepG2; A549; H1A; H1B; LCLs; MM6; Jurkat; GSC-11; iSLK; MSC; TREX; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000425295.1; ENST00000417262.5; ENST00000553157.1
External Link	RMBase: m6A_site_72922
mod ID: M6ASITE076472		Click to Show/Hide the Full List
mod site	chr1:202811142-202811143:+		[4]
Sequence	AACCCCCTCCTTACTCTTGGACAACACTCCGCCCCCGCCCG
Motif Score	3.643047619
Cell/Tissue List	HepG2; HeLa; A549; H1A; H1B; LCLs; MM6; Jurkat; GSC-11; iSLK; MSC; TREX; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000553157.1; ENST00000417262.5; ENST00000425295.1
External Link	RMBase: m6A_site_72923
mod ID: M6ASITE076473		Click to Show/Hide the Full List
mod site	chr1:202811179-202811180:+		[4]
Sequence	CCCGGGCCTCCGTCCCCCAAACCGCCCTCATTTGTGCAGCG
Motif Score	2.185083333
Cell/Tissue List	HepG2; HeLa; A549; H1A; H1B; LCLs; MM6; Jurkat; GSC-11; iSLK; MSC; TREX; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000417262.5; ENST00000425295.1; ENST00000553157.1
External Link	RMBase: m6A_site_72924
mod ID: M6ASITE076474		Click to Show/Hide the Full List
mod site	chr1:202811213-202811214:+		[4]
Sequence	TGCAGCGCCAGATCCTTCGGACACATCCCTAGGTGTCTCCA
Motif Score	3.643047619
Cell/Tissue List	HepG2; HeLa; A549; H1A; H1B; MM6; Huh7; Jurkat; iSLK; MSC; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000417262.5; ENST00000425295.1; ENST00000553157.1
External Link	RMBase: m6A_site_72925
mod ID: M6ASITE076475		Click to Show/Hide the Full List
mod site	chr1:202811261-202811262:+		[5]
Sequence	TCGGTCCATCCAACTCCCAGACCTCACGTCAACCGGCTGCA
Motif Score	2.876744048
Cell/Tissue List	HEK293T; HeLa; H1A; MM6; Huh7; Jurkat; MSC; TREX; iSLK
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000425295.1; ENST00000553157.1; ENST00000417262.5
External Link	RMBase: m6A_site_72926
mod ID: M6ASITE076476		Click to Show/Hide the Full List
mod site	chr1:202811819-202811820:+		[3]
Sequence	TGTCAGATGTCCCCTGTGAAACCCACAAACGCTTGCGATTT
Motif Score	2.185083333
Cell/Tissue List	HeLa; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000417262.5; ENST00000425295.1; ENST00000553157.1
External Link	RMBase: m6A_site_72927

Ref 1	m(6) A modification of lncRNA PCAT6 promotes bone metastasis in prostate cancer through IGF2BP2-mediated IGF1R mRNA stabilization. Clin Transl Med. 2021 Jun;11(6):e426. doi: 10.1002/ctm2.426.
Ref 2	Inhibition of IKappaB phosphorylation prevents load-induced cardiac dysfunction in mice. Am J Physiol Heart Circ Physiol. 2012 Dec 15;303(12):H1435-45. doi: 10.1152/ajpheart.00290.2012. Epub 2012 Oct 5.
Ref 3	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 4	Histone H3 trimethylation at lysine 36 guides m(6)A RNA modification co-transcriptionally. Nature. 2019 Mar;567(7748):414-419. doi: 10.1038/s41586-019-1016-7. Epub 2019 Mar 13.
Ref 5	Viral N(6)-methyladenosine upregulates replication and pathogenesis of human respiratory syncytial virus. Nat Commun. 2019 Oct 9;10(1):4595. doi: 10.1038/s41467-019-12504-y.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map