m6A Target Gene Information
General Information of the m6A Target Gene (ID: M6ATAR00492)
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
CD47
can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Methyltransferase-like 3 (METTL3) [WRITER]
| Representative RNA-seq result indicating the expression of this target gene regulated by METTL3 | ||
| Cell Line | Caco-2 cell line | Homo sapiens |
|
Treatment: shMETTL3 Caco-2 cells
Control: shNTC Caco-2 cells
|
GSE167075 | |
| Regulation |
![]() ![]() |
logFC: 1.18E+00 p-value: 9.07E-25 |
| More Results | Click to View More RNA-seq Results | |
| Representative RIP-seq result supporting the interaction between CD47 and the regulator | ||
| Cell Line | MDA-MB-231 | Homo sapiens |
| Regulation | logFC: 4.98E+00 | GSE60213 |
| In total 1 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [1] | |||
| Response Summary | METTL3/IGF2BP1/Leukocyte surface antigen CD47 (CD47) mediated EMT transition contributes to the incomplete ablation induced metastasis in HCC cells. | |||
| Target Regulation | Up regulation | |||
| Responsed Disease | Hepatocellular carcinoma | ICD-11: 2C12.02 | ||
| Cell Process | Epithelial-mesenchymal transition | |||
| In-vitro Model | Huh-7 | Adult hepatocellular carcinoma | Homo sapiens | CVCL_0336 |
| HCCLM3 | Adult hepatocellular carcinoma | Homo sapiens | CVCL_6832 | |
Insulin-like growth factor 2 mRNA-binding protein 1 (IGF2BP1) [READER]
| Representative RNA-seq result indicating the expression of this target gene regulated by IGF2BP1 | ||
| Cell Line | PANC-1 cell line | Homo sapiens |
|
Treatment: siIGF2BP1 PANC-1 cells
Control: siControl PANC-1 cells
|
GSE161087 | |
| Regulation |
![]() ![]() |
logFC: -8.42E-01 p-value: 5.16E-03 |
| More Results | Click to View More RNA-seq Results | |
| In total 1 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [1] | |||
| Response Summary | METTL3/IGF2BP1/Leukocyte surface antigen CD47 (CD47) mediated EMT transition contributes to the incomplete ablation induced metastasis in HCC cells. | |||
| Target Regulation | Up regulation | |||
| Responsed Disease | Hepatocellular carcinoma | ICD-11: 2C12.02 | ||
| Cell Process | Epithelial-mesenchymal transition | |||
| In-vitro Model | Huh-7 | Adult hepatocellular carcinoma | Homo sapiens | CVCL_0336 |
| HCCLM3 | Adult hepatocellular carcinoma | Homo sapiens | CVCL_6832 | |
Liver cancer [ICD-11: 2C12]
| In total 2 item(s) under this disease | ||||
| Experiment 1 Reporting the m6A-centered Disease Response | [1] | |||
| Response Summary | METTL3/IGF2BP1/Leukocyte surface antigen CD47 (CD47) mediated EMT transition contributes to the incomplete ablation induced metastasis in HCC cells. | |||
| Responsed Disease | Hepatocellular carcinoma [ICD-11: 2C12.02] | |||
| Target Regulator | Insulin-like growth factor 2 mRNA-binding protein 1 (IGF2BP1) | READER | ||
| Target Regulation | Up regulation | |||
| Cell Process | Epithelial-mesenchymal transition | |||
| In-vitro Model | Huh-7 | Adult hepatocellular carcinoma | Homo sapiens | CVCL_0336 |
| HCCLM3 | Adult hepatocellular carcinoma | Homo sapiens | CVCL_6832 | |
| Experiment 2 Reporting the m6A-centered Disease Response | [1] | |||
| Response Summary | METTL3/IGF2BP1/Leukocyte surface antigen CD47 (CD47) mediated EMT transition contributes to the incomplete ablation induced metastasis in HCC cells. | |||
| Responsed Disease | Hepatocellular carcinoma [ICD-11: 2C12.02] | |||
| Target Regulator | Methyltransferase-like 3 (METTL3) | WRITER | ||
| Target Regulation | Up regulation | |||
| Cell Process | Epithelial-mesenchymal transition | |||
| In-vitro Model | Huh-7 | Adult hepatocellular carcinoma | Homo sapiens | CVCL_0336 |
| HCCLM3 | Adult hepatocellular carcinoma | Homo sapiens | CVCL_6832 | |
Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator
DNA modification
m6A Regulator: Insulin-like growth factor 2 mRNA-binding protein 1 (IGF2BP1)
| In total 1 item(s) under this m6A regulator | ||
| Crosstalk ID: M6ACROT02197 | ||
| Epigenetic Regulator | Cysteine methyltransferase DNMT3A (DNMT3A) | |
| Regulated Target | Protein tyrosine phosphatase non-receptor type 13 (PTPN13) | |
| Crosstalk relationship | DNA modification → m6A | |
| Disease | Liver cancer | |
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00492)
| In total 1 m6A sequence/site(s) in this target gene | |||
| mod ID: A2ISITE012013 | Click to Show/Hide the Full List | ||
| mod site | chr3:108054210-108054211:- | [2] | |
| Sequence | TTTGTTTTGTTTTTAGAGACAGGGTCTCATTATGTTGACCA | ||
| Transcript ID List | ENST00000398258.7; ENST00000355354.13; ENST00000471694.1; ENST00000361309.5; ENST00000517766.5 | ||
| External Link | RMBase: RNA-editing_site_98588 | ||
5-methylcytidine (m5C)
N6-methyladenosine (m6A)
| In total 81 m6A sequence/site(s) in this target gene | |||
| mod ID: M6ASITE061968 | Click to Show/Hide the Full List | ||
| mod site | chr3:108043487-108043488:- | [3] | |
| Sequence | TTTTTTGCAGTGATTTGAAGACCAAAGTTGTTTTACAGCTG | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000471694.1; ENST00000355354.13 | ||
| External Link | RMBase: m6A_site_602034 | ||
| mod ID: M6ASITE061969 | Click to Show/Hide the Full List | ||
| mod site | chr3:108043589-108043590:- | [4] | |
| Sequence | AACCATTCTAAATAAAGAGAACTCCAGTGTTGCTATGTGCA | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000355354.13; ENST00000471694.1 | ||
| External Link | RMBase: m6A_site_602035 | ||
| mod ID: M6ASITE061970 | Click to Show/Hide the Full List | ||
| mod site | chr3:108043659-108043660:- | [3] | |
| Sequence | TATTAAATGGAGCATTATTTACAAAAAGCCATTGTTGAGAA | ||
| Motif Score | 2.07285119 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000471694.1; ENST00000355354.13 | ||
| External Link | RMBase: m6A_site_602036 | ||
| mod ID: M6ASITE061971 | Click to Show/Hide the Full List | ||
| mod site | chr3:108043691-108043692:- | [4] | |
| Sequence | ATGACTGGTGAGAGAAGAAAACATTTTGTTTTTATTAAATG | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000355354.13; ENST00000471694.1 | ||
| External Link | RMBase: m6A_site_602037 | ||
| mod ID: M6ASITE061972 | Click to Show/Hide the Full List | ||
| mod site | chr3:108043743-108043744:- | [4] | |
| Sequence | GTACTAAGCTCCTCTGTAAGACAACATCTTAAATCTTAAAA | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000355354.13; ENST00000471694.1 | ||
| External Link | RMBase: m6A_site_602038 | ||
| mod ID: M6ASITE061973 | Click to Show/Hide the Full List | ||
| mod site | chr3:108043761-108043762:- | [3] | |
| Sequence | GAAAAAAAGAAAGCATTTGTACTAAGCTCCTCTGTAAGACA | ||
| Motif Score | 3.278136905 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000471694.1; ENST00000355354.13 | ||
| External Link | RMBase: m6A_site_602039 | ||
| mod ID: M6ASITE061975 | Click to Show/Hide the Full List | ||
| mod site | chr3:108043989-108043990:- | [4] | |
| Sequence | GTTGAGGGATTTTTTTATAAACAGTTTTACTTGTGTCATAT | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa; HEK293T | ||
| Seq Type List | m6A-seq; DART-seq | ||
| Transcript ID List | ENST00000355354.13; ENST00000471694.1 | ||
| External Link | RMBase: m6A_site_602040 | ||
| mod ID: M6ASITE061976 | Click to Show/Hide the Full List | ||
| mod site | chr3:108044061-108044062:- | [4] | |
| Sequence | TAATTTACCTGTTGTTGGAAACTGGAGAAATGATTGTCGGG | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa; HEK293T | ||
| Seq Type List | m6A-seq; DART-seq | ||
| Transcript ID List | ENST00000355354.13; ENST00000471694.1 | ||
| External Link | RMBase: m6A_site_602041 | ||
| mod ID: M6ASITE061977 | Click to Show/Hide the Full List | ||
| mod site | chr3:108044093-108044094:- | [4] | |
| Sequence | TCTGTGGTGTATGTATGGAAACACATACTCCTTAATTTACC | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa; hESC-HEK293T | ||
| Seq Type List | m6A-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000471694.1; ENST00000355354.13 | ||
| External Link | RMBase: m6A_site_602042 | ||
| mod ID: M6ASITE061978 | Click to Show/Hide the Full List | ||
| mod site | chr3:108044211-108044212:- | [4] | |
| Sequence | TTGCACTAACAAAGCTCAAAACACGATAAGTTTACTCCTCC | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa; hESC-HEK293T | ||
| Seq Type List | m6A-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000355354.13; ENST00000471694.1 | ||
| External Link | RMBase: m6A_site_602043 | ||
| mod ID: M6ASITE061979 | Click to Show/Hide the Full List | ||
| mod site | chr3:108044223-108044224:- | [5] | |
| Sequence | CCAAATTGTTATTTGCACTAACAAAGCTCAAAACACGATAA | ||
| Motif Score | 2.168095238 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000355354.13; ENST00000471694.1 | ||
| External Link | RMBase: m6A_site_602044 | ||
| mod ID: M6ASITE061980 | Click to Show/Hide the Full List | ||
| mod site | chr3:108044227-108044228:- | [3] | |
| Sequence | ACCACCAAATTGTTATTTGCACTAACAAAGCTCAAAACACG | ||
| Motif Score | 3.252583333 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000471694.1; ENST00000355354.13 | ||
| External Link | RMBase: m6A_site_602045 | ||
| mod ID: M6ASITE061981 | Click to Show/Hide the Full List | ||
| mod site | chr3:108044247-108044248:- | [3] | |
| Sequence | TATAGTCAATTTAGTAAGTGACCACCAAATTGTTATTTGCA | ||
| Motif Score | 2.839113095 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000471694.1; ENST00000355354.13 | ||
| External Link | RMBase: m6A_site_602046 | ||
| mod ID: M6ASITE061982 | Click to Show/Hide the Full List | ||
| mod site | chr3:108044404-108044405:- | [5] | |
| Sequence | TTTTTTTTTTGACTAATTTCACATGCTCTAAAAACCTTCAA | ||
| Motif Score | 2.047297619 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000355354.13; ENST00000471694.1 | ||
| External Link | RMBase: m6A_site_602047 | ||
| mod ID: M6ASITE061983 | Click to Show/Hide the Full List | ||
| mod site | chr3:108044559-108044560:- | [5] | |
| Sequence | CTTCCTGCAGTGTTTTGCATACATCAGAAGCTAGGTACATA | ||
| Motif Score | 2.110482143 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000471694.1; ENST00000355354.13 | ||
| External Link | RMBase: m6A_site_602048 | ||
| mod ID: M6ASITE061984 | Click to Show/Hide the Full List | ||
| mod site | chr3:108044753-108044754:- | [4] | |
| Sequence | TATTTGTCTTCTCCTTCAAAACATTCTCCTTTGCAGTTCCT | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa; hESC-HEK293T | ||
| Seq Type List | m6A-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000355354.13; ENST00000471694.1 | ||
| External Link | RMBase: m6A_site_602049 | ||
| mod ID: M6ASITE061986 | Click to Show/Hide the Full List | ||
| mod site | chr3:108044803-108044804:- | [5] | |
| Sequence | ACCATTTGTCCTTTTCTGCAACAACCTTTCCAGCTACTTTT | ||
| Motif Score | 2.173910714 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000471694.1; ENST00000355354.13 | ||
| External Link | RMBase: m6A_site_602050 | ||
| mod ID: M6ASITE061987 | Click to Show/Hide the Full List | ||
| mod site | chr3:108044930-108044931:- | [6] | |
| Sequence | AATTGCAGACAGTGTTTTGCACATCATGTATCTGTTTTGTC | ||
| Motif Score | 2.830589286 | ||
| Cell/Tissue List | brain; hESC-HEK293T | ||
| Seq Type List | m6A-REF-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000355354.13; ENST00000471694.1 | ||
| External Link | RMBase: m6A_site_602051 | ||
| mod ID: M6ASITE061988 | Click to Show/Hide the Full List | ||
| mod site | chr3:108044962-108044963:- | [5] | |
| Sequence | AATGGCTCCCAAATTCCATCACATCACATTTAAATTGCAGA | ||
| Motif Score | 2.047297619 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000471694.1; ENST00000355354.13 | ||
| External Link | RMBase: m6A_site_602052 | ||
| mod ID: M6ASITE061989 | Click to Show/Hide the Full List | ||
| mod site | chr3:108045048-108045049:- | [6] | |
| Sequence | GCTTCTCTGGATAAGTGACCACAGAAGCAGGAGTCCTCCTG | ||
| Motif Score | 2.053113095 | ||
| Cell/Tissue List | brain | ||
| Seq Type List | m6A-REF-seq | ||
| Transcript ID List | ENST00000355354.13; ENST00000471694.1 | ||
| External Link | RMBase: m6A_site_602053 | ||
| mod ID: M6ASITE061990 | Click to Show/Hide the Full List | ||
| mod site | chr3:108045657-108045658:- | [4] | |
| Sequence | TTGTCATATTTCATGTTGGGACCAAGTAGTTTGCCCATGGC | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000471694.1; ENST00000355354.13 | ||
| External Link | RMBase: m6A_site_602054 | ||
| mod ID: M6ASITE061991 | Click to Show/Hide the Full List | ||
| mod site | chr3:108045916-108045917:- | [4] | |
| Sequence | ATTTTGTGCTTTTAGTAAAAACATTTAAATACAAAGTTCTT | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000471694.1; ENST00000355354.13 | ||
| External Link | RMBase: m6A_site_602055 | ||
| mod ID: M6ASITE061992 | Click to Show/Hide the Full List | ||
| mod site | chr3:108045990-108045991:- | [5] | |
| Sequence | TGCATACGTATGAGATAGGCACATGCATCTTCTGTATGGAC | ||
| Motif Score | 2.830589286 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000355354.13; ENST00000471694.1 | ||
| External Link | RMBase: m6A_site_602056 | ||
| mod ID: M6ASITE061993 | Click to Show/Hide the Full List | ||
| mod site | chr3:108046057-108046058:- | [4] | |
| Sequence | ATCGCCTGGAGTACTTTTAGACTTTTAGCATTCGTTTTTTA | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000471694.1; ENST00000355354.13 | ||
| External Link | RMBase: m6A_site_602057 | ||
| mod ID: M6ASITE061994 | Click to Show/Hide the Full List | ||
| mod site | chr3:108046128-108046129:- | [4] | |
| Sequence | ATGATTGAAAAGTAAACAAAACCCACATTTCCTATCCTGGT | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000355354.13; ENST00000471694.1 | ||
| External Link | RMBase: m6A_site_602058 | ||
| mod ID: M6ASITE061995 | Click to Show/Hide the Full List | ||
| mod site | chr3:108046133-108046134:- | [4] | |
| Sequence | CCCCTATGATTGAAAAGTAAACAAAACCCACATTTCCTATC | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa; hESC-HEK293T | ||
| Seq Type List | m6A-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000355354.13; ENST00000471694.1 | ||
| External Link | RMBase: m6A_site_602059 | ||
| mod ID: M6ASITE061997 | Click to Show/Hide the Full List | ||
| mod site | chr3:108046197-108046198:- | [5] | |
| Sequence | GTATCTATGTTGCATGATAAACATTCATCACCTTCCTCCTG | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000471694.1; ENST00000355354.13 | ||
| External Link | RMBase: m6A_site_602060 | ||
| mod ID: M6ASITE061998 | Click to Show/Hide the Full List | ||
| mod site | chr3:108046278-108046279:- | [5] | |
| Sequence | TATGAGTCTCCTGCATGGCAACAAAATGTGTGTCACCATCA | ||
| Motif Score | 2.173910714 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000355354.13; ENST00000471694.1 | ||
| External Link | RMBase: m6A_site_602061 | ||
| mod ID: M6ASITE061999 | Click to Show/Hide the Full List | ||
| mod site | chr3:108046300-108046301:- | [3] | |
| Sequence | AAAGCAAGATTGAAATTTGAACTATGAGTCTCCTGCATGGC | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000355354.13; ENST00000471694.1 | ||
| External Link | RMBase: m6A_site_602062 | ||
| mod ID: M6ASITE062000 | Click to Show/Hide the Full List | ||
| mod site | chr3:108046545-108046546:- | [3] | |
| Sequence | CCCTGTCTTGTCCTCCTGTTACTTGCTTCTGCTGTACAAGA | ||
| Motif Score | 2.494845238 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000355354.13; ENST00000471694.1 | ||
| External Link | RMBase: m6A_site_602063 | ||
| mod ID: M6ASITE062001 | Click to Show/Hide the Full List | ||
| mod site | chr3:108046566-108046567:- | [4] | |
| Sequence | TATTCACATAACCCCTTGAAACCCTGTCTTGTCCTCCTGTT | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000471694.1; ENST00000355354.13 | ||
| External Link | RMBase: m6A_site_602064 | ||
| mod ID: M6ASITE062002 | Click to Show/Hide the Full List | ||
| mod site | chr3:108046646-108046647:- | [4] | |
| Sequence | CCACATTCCCCCTTCAACAAACAGTGTAACAGGTCCTTCCC | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000471694.1; ENST00000355354.13 | ||
| External Link | RMBase: m6A_site_602065 | ||
| mod ID: M6ASITE062003 | Click to Show/Hide the Full List | ||
| mod site | chr3:108047007-108047008:- | [5] | |
| Sequence | TAGGGGCAATAGTAGAATGGACAATTTCCAAGAATGATGCC | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000471694.1; ENST00000355354.13 | ||
| External Link | RMBase: m6A_site_602066 | ||
| mod ID: M6ASITE062004 | Click to Show/Hide the Full List | ||
| mod site | chr3:108047144-108047145:- | [3] | |
| Sequence | TTGTCACCTATGAGACCCTTACGTGATTGTTAGTTAAGTTT | ||
| Motif Score | 2.046785714 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000471694.1; ENST00000517766.5; ENST00000398258.7; ENST00000355354.13; ENST00000361309.5 | ||
| External Link | RMBase: m6A_site_602067 | ||
| mod ID: M6ASITE062005 | Click to Show/Hide the Full List | ||
| mod site | chr3:108047150-108047151:- | [4] | |
| Sequence | AACTGGTTGTCACCTATGAGACCCTTACGTGATTGTTAGTT | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000361309.5; ENST00000471694.1; ENST00000517766.5; ENST00000355354.13; ENST00000398258.7 | ||
| External Link | RMBase: m6A_site_602068 | ||
| mod ID: M6ASITE062006 | Click to Show/Hide the Full List | ||
| mod site | chr3:108047159-108047160:- | [3] | |
| Sequence | AAGAAAAGTAACTGGTTGTCACCTATGAGACCCTTACGTGA | ||
| Motif Score | 2.026654762 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000398258.7; ENST00000471694.1; ENST00000355354.13; ENST00000517766.5; ENST00000361309.5 | ||
| External Link | RMBase: m6A_site_602069 | ||
| mod ID: M6ASITE062008 | Click to Show/Hide the Full List | ||
| mod site | chr3:108047169-108047170:- | [3] | |
| Sequence | GAGAAGAAACAAGAAAAGTAACTGGTTGTCACCTATGAGAC | ||
| Motif Score | 2.590089286 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000471694.1; ENST00000361309.5; ENST00000517766.5; ENST00000355354.13; ENST00000398258.7 | ||
| External Link | RMBase: m6A_site_602070 | ||
| mod ID: M6ASITE062009 | Click to Show/Hide the Full List | ||
| mod site | chr3:108047181-108047182:- | [4] | |
| Sequence | TTCACTGTTGGGGAGAAGAAACAAGAAAAGTAACTGGTTGT | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa; hESC-HEK293T; hNPCs | ||
| Seq Type List | m6A-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000361309.5; ENST00000355354.13; ENST00000517766.5; ENST00000398258.7; ENST00000471694.1 | ||
| External Link | RMBase: m6A_site_602071 | ||
| mod ID: M6ASITE062010 | Click to Show/Hide the Full List | ||
| mod site | chr3:108047231-108047232:- | [3] | |
| Sequence | GTAAGACGTGAAAGGAATACACTTGTGTTTAAGCACCATGG | ||
| Motif Score | 2.506922619 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000471694.1; ENST00000355354.13; ENST00000361309.5; ENST00000398258.7; ENST00000517766.5 | ||
| External Link | RMBase: m6A_site_602072 | ||
| mod ID: M6ASITE062011 | Click to Show/Hide the Full List | ||
| mod site | chr3:108047233-108047234:- | [3] | |
| Sequence | TAGTAAGACGTGAAAGGAATACACTTGTGTTTAAGCACCAT | ||
| Motif Score | 2.110482143 | ||
| Cell/Tissue List | HEK293T; hESC-HEK293T | ||
| Seq Type List | DART-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000398258.7; ENST00000355354.13; ENST00000361309.5; ENST00000471694.1; ENST00000517766.5 | ||
| External Link | RMBase: m6A_site_602073 | ||
| mod ID: M6ASITE062012 | Click to Show/Hide the Full List | ||
| mod site | chr3:108047246-108047247:- | [3] | |
| Sequence | CCGATTTGGAGAGTAGTAAGACGTGAAAGGAATACACTTGT | ||
| Motif Score | 2.871321429 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000398258.7; ENST00000517766.5; ENST00000361309.5; ENST00000471694.1; ENST00000355354.13 | ||
| External Link | RMBase: m6A_site_602074 | ||
| mod ID: M6ASITE062013 | Click to Show/Hide the Full List | ||
| mod site | chr3:108047269-108047270:- | [4] | |
| Sequence | TAACTGAAGTGAAGTGATGGACTCCGATTTGGAGAGTAGTA | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa; hNPCs | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000398258.7; ENST00000471694.1; ENST00000517766.5; ENST00000355354.13; ENST00000361309.5 | ||
| External Link | RMBase: m6A_site_602075 | ||
| mod ID: M6ASITE062014 | Click to Show/Hide the Full List | ||
| mod site | chr3:108050587-108050588:- | [4] | |
| Sequence | TTTCAGAAAGCTGTAGAGGAACCCCTTAATGGTATGTGGTT | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HeLa; hNPCs | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000471694.1; ENST00000398258.7; ENST00000355354.13; ENST00000517766.5; ENST00000361309.5 | ||
| External Link | RMBase: m6A_site_602076 | ||
| mod ID: M6ASITE062015 | Click to Show/Hide the Full List | ||
| mod site | chr3:108051950-108051951:- | [5] | |
| Sequence | GCTTCCAATCAGAAGACTATACAACCTCCTAGGGTAAGTTA | ||
| Motif Score | 2.110482143 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000355354.13; ENST00000398258.7; ENST00000471694.1; ENST00000517766.5; ENST00000361309.5 | ||
| External Link | RMBase: m6A_site_602077 | ||
| mod ID: M6ASITE062016 | Click to Show/Hide the Full List | ||
| mod site | chr3:108051955-108051956:- | [4] | |
| Sequence | TATCAGCTTCCAATCAGAAGACTATACAACCTCCTAGGGTA | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000398258.7; ENST00000471694.1; ENST00000517766.5; ENST00000355354.13; ENST00000361309.5 | ||
| External Link | RMBase: m6A_site_602078 | ||
| mod ID: M6ASITE062017 | Click to Show/Hide the Full List | ||
| mod site | chr3:108052035-108052036:- | [4] | |
| Sequence | ACATTTTATCTTAAAATTAAACATTACCAAATGCCTTAGTT | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000398258.7; ENST00000361309.5; ENST00000471694.1; ENST00000517766.5; ENST00000355354.13 | ||
| External Link | RMBase: m6A_site_602079 | ||
| mod ID: M6ASITE062019 | Click to Show/Hide the Full List | ||
| mod site | chr3:108052353-108052354:- | [4] | |
| Sequence | AGGGAGATGGAGTAGTGGGGACAAATTCTGGCACATTCTGT | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; MT4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000361309.5; ENST00000398258.7; ENST00000517766.5; ENST00000355354.13; ENST00000471694.1 | ||
| External Link | RMBase: m6A_site_602080 | ||
| mod ID: M6ASITE062020 | Click to Show/Hide the Full List | ||
| mod site | chr3:108052392-108052393:- | [4] | |
| Sequence | AAAGAGACTGAGCTTGTAAGACACAGGAGCAGTGAGCTAAG | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa; MT4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000361309.5; ENST00000398258.7; ENST00000471694.1; ENST00000517766.5; ENST00000355354.13 | ||
| External Link | RMBase: m6A_site_602081 | ||
| mod ID: M6ASITE062021 | Click to Show/Hide the Full List | ||
| mod site | chr3:108052406-108052407:- | [7] | |
| Sequence | GGAGTGATGTGGAGAAAGAGACTGAGCTTGTAAGACACAGG | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | MT4 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000471694.1; ENST00000361309.5; ENST00000355354.13; ENST00000398258.7; ENST00000517766.5 | ||
| External Link | RMBase: m6A_site_602082 | ||
| mod ID: M6ASITE062022 | Click to Show/Hide the Full List | ||
| mod site | chr3:108052432-108052433:- | [7] | |
| Sequence | GGAGCTTTGAAACTGGAAAGACCCAGGGAGTGATGTGGAGA | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | MT4 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000398258.7; ENST00000517766.5; ENST00000471694.1; ENST00000361309.5; ENST00000355354.13 | ||
| External Link | RMBase: m6A_site_602083 | ||
| mod ID: M6ASITE062023 | Click to Show/Hide the Full List | ||
| mod site | chr3:108052441-108052442:- | [7] | |
| Sequence | TAGCTCTTTGGAGCTTTGAAACTGGAAAGACCCAGGGAGTG | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | MT4 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000398258.7; ENST00000471694.1; ENST00000361309.5; ENST00000517766.5; ENST00000355354.13 | ||
| External Link | RMBase: m6A_site_602084 | ||
| mod ID: M6ASITE062024 | Click to Show/Hide the Full List | ||
| mod site | chr3:108053174-108053175:- | [7] | |
| Sequence | TGGTAAATAAATAGTAAGGAACACAGAGCAGTCCTGGAGGC | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | MT4 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000398258.7; ENST00000355354.13; ENST00000361309.5; ENST00000517766.5; ENST00000471694.1 | ||
| External Link | RMBase: m6A_site_602085 | ||
| mod ID: M6ASITE062025 | Click to Show/Hide the Full List | ||
| mod site | chr3:108053250-108053251:- | [7] | |
| Sequence | TTGGCTTTCCTTGGGTCAGGACCCACCCTTTTCCCTGCCAG | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | MT4 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000471694.1; ENST00000361309.5; ENST00000517766.5; ENST00000355354.13; ENST00000398258.7 | ||
| External Link | RMBase: m6A_site_602086 | ||
| mod ID: M6ASITE062026 | Click to Show/Hide the Full List | ||
| mod site | chr3:108053443-108053444:- | [4] | |
| Sequence | TTTCTTACCTACAGCTTTGGACTCATCCTTGTCTCCTTTCT | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000398258.7; ENST00000517766.5; ENST00000361309.5; ENST00000471694.1; ENST00000355354.13 | ||
| External Link | RMBase: m6A_site_602087 | ||
| mod ID: M6ASITE062027 | Click to Show/Hide the Full List | ||
| mod site | chr3:108053469-108053470:- | [4] | |
| Sequence | CTATTCATGCCTTCTCACAGACAACTTTTCTTACCTACAGC | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000398258.7; ENST00000517766.5; ENST00000471694.1; ENST00000361309.5; ENST00000355354.13 | ||
| External Link | RMBase: m6A_site_602088 | ||
| mod ID: M6ASITE062028 | Click to Show/Hide the Full List | ||
| mod site | chr3:108057504-108057505:- | [3] | |
| Sequence | ATCTTAGCTCTAGCACAATTACTTGGACTAGTTTATATGAA | ||
| Motif Score | 2.494845238 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000355354.13; ENST00000361309.5; ENST00000517766.5; ENST00000398258.7 | ||
| External Link | RMBase: m6A_site_602089 | ||
| mod ID: M6ASITE062030 | Click to Show/Hide the Full List | ||
| mod site | chr3:108057510-108057511:- | [5] | |
| Sequence | TTGAGTATCTTAGCTCTAGCACAATTACTTGGACTAGTTTA | ||
| Motif Score | 2.830589286 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000517766.5; ENST00000361309.5; ENST00000355354.13; ENST00000398258.7 | ||
| External Link | RMBase: m6A_site_602090 | ||
| mod ID: M6ASITE062031 | Click to Show/Hide the Full List | ||
| mod site | chr3:108058355-108058356:- | [4] | |
| Sequence | TATATCCTCGCTGTGGTTGGACTGAGTCTCTGTATTGCGGG | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa; HEK293T | ||
| Seq Type List | m6A-seq; DART-seq | ||
| Transcript ID List | ENST00000398258.7; ENST00000361309.5; ENST00000355354.13; ENST00000517766.5 | ||
| External Link | RMBase: m6A_site_602091 | ||
| mod ID: M6ASITE062032 | Click to Show/Hide the Full List | ||
| mod site | chr3:108059471-108059472:- | [3] | |
| Sequence | AGGGATATTAATATTACTTCACTACTATGTGTTTAGTACAG | ||
| Motif Score | 2.469291667 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000355354.13; ENST00000517766.5; ENST00000644850.1; ENST00000361309.5 | ||
| External Link | RMBase: m6A_site_602092 | ||
| mod ID: M6ASITE062033 | Click to Show/Hide the Full List | ||
| mod site | chr3:108059493-108059494:- | [6] | |
| Sequence | TTGGTTTAATTGTGACTTCTACAGGGATATTAATATTACTT | ||
| Motif Score | 2.078666667 | ||
| Cell/Tissue List | HEK293 | ||
| Seq Type List | m6A-REF-seq | ||
| Transcript ID List | ENST00000517766.5; ENST00000355354.13; ENST00000361309.5; ENST00000644850.1 | ||
| External Link | RMBase: m6A_site_602093 | ||
| mod ID: M6ASITE062034 | Click to Show/Hide the Full List | ||
| mod site | chr3:108059499-108059500:- | [3] | |
| Sequence | CTGGCCTTGGTTTAATTGTGACTTCTACAGGGATATTAATA | ||
| Motif Score | 3.28175 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000361309.5; ENST00000644850.1; ENST00000517766.5; ENST00000355354.13 | ||
| External Link | RMBase: m6A_site_602094 | ||
| mod ID: M6ASITE062035 | Click to Show/Hide the Full List | ||
| mod site | chr3:108060793-108060794:- | [4] | |
| Sequence | ATTGCTTTACTTGTTGCTGGACTAGTGATCACTGTCATTGT | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000644850.1; ENST00000361309.5; ENST00000355354.13 | ||
| External Link | RMBase: m6A_site_602095 | ||
| mod ID: M6ASITE062036 | Click to Show/Hide the Full List | ||
| mod site | chr3:108060805-108060806:- | [3] | |
| Sequence | GATGAGAAAACAATTGCTTTACTTGTTGCTGGACTAGTGAT | ||
| Motif Score | 2.494845238 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000644850.1; ENST00000361309.5; ENST00000355354.13 | ||
| External Link | RMBase: m6A_site_602096 | ||
| mod ID: M6ASITE062037 | Click to Show/Hide the Full List | ||
| mod site | chr3:108060816-108060817:- | [4] | |
| Sequence | CCGGTGGTATGGATGAGAAAACAATTGCTTTACTTGTTGCT | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa; hESC-HEK293T | ||
| Seq Type List | m6A-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000644850.1; ENST00000361309.5; ENST00000355354.13 | ||
| External Link | RMBase: m6A_site_602097 | ||
| mod ID: M6ASITE062038 | Click to Show/Hide the Full List | ||
| mod site | chr3:108071108-108071109:- | [4] | |
| Sequence | GCTATACTCCTGTTCTGGGGACAGTTTGGTATTAAAAGTAA | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000361309.5; ENST00000644850.1; ENST00000355354.13 | ||
| External Link | RMBase: m6A_site_602098 | ||
| mod ID: M6ASITE062039 | Click to Show/Hide the Full List | ||
| mod site | chr3:108080058-108080059:- | [4] | |
| Sequence | TGCTGTCTCACACACAGGAAACTACACTTGTGAAGTAACAG | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000355354.13; ENST00000644850.1; ENST00000361309.5 | ||
| External Link | RMBase: m6A_site_602099 | ||
| mod ID: M6ASITE062041 | Click to Show/Hide the Full List | ||
| mod site | chr3:108080065-108080066:- | [3] | |
| Sequence | AGAGTGATGCTGTCTCACACACAGGAAACTACACTTGTGAA | ||
| Motif Score | 2.084928571 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000644850.1; ENST00000361309.5; ENST00000355354.13 | ||
| External Link | RMBase: m6A_site_602100 | ||
| mod ID: M6ASITE062042 | Click to Show/Hide the Full List | ||
| mod site | chr3:108080069-108080070:- | [5] | |
| Sequence | GATAAGAGTGATGCTGTCTCACACACAGGAAACTACACTTG | ||
| Motif Score | 2.047297619 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000644850.1; ENST00000361309.5; ENST00000355354.13 | ||
| External Link | RMBase: m6A_site_602101 | ||
| mod ID: M6ASITE062043 | Click to Show/Hide the Full List | ||
| mod site | chr3:108080117-108080118:- | [3] | |
| Sequence | AAAATTGAAGTCTCACAATTACTAAAAGGAGATGCCTCTTT | ||
| Motif Score | 2.494845238 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000355354.13; ENST00000644850.1; ENST00000361309.5 | ||
| External Link | RMBase: m6A_site_602102 | ||
| mod ID: M6ASITE062044 | Click to Show/Hide the Full List | ||
| mod site | chr3:108080123-108080124:- | [5] | |
| Sequence | AGTGCAAAAATTGAAGTCTCACAATTACTAAAAGGAGATGC | ||
| Motif Score | 2.047297619 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000644850.1; ENST00000361309.5; ENST00000355354.13 | ||
| External Link | RMBase: m6A_site_602103 | ||
| mod ID: M6ASITE062045 | Click to Show/Hide the Full List | ||
| mod site | chr3:108080151-108080152:- | [8] | |
| Sequence | CAAGTCCACTGTCCCCACTGACTTTAGTAGTGCAAAAATTG | ||
| Motif Score | 3.28175 | ||
| Cell/Tissue List | CD8T; A549; AML | ||
| Seq Type List | m6A-CLIP/IP; miCLIP | ||
| Transcript ID List | ENST00000361309.5; ENST00000644850.1; ENST00000355354.13 | ||
| External Link | RMBase: m6A_site_602104 | ||
| mod ID: M6ASITE062046 | Click to Show/Hide the Full List | ||
| mod site | chr3:108080172-108080173:- | [4] | |
| Sequence | CACCTTTGATGGAGCTCTAAACAAGTCCACTGTCCCCACTG | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa; hESC-HEK293T; hNPCs | ||
| Seq Type List | m6A-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000361309.5; ENST00000644850.1; ENST00000355354.13 | ||
| External Link | RMBase: m6A_site_602105 | ||
| mod ID: M6ASITE062047 | Click to Show/Hide the Full List | ||
| mod site | chr3:108080193-108080194:- | [3] | |
| Sequence | ATTTAAAGGAAGAGATATTTACACCTTTGATGGAGCTCTAA | ||
| Motif Score | 2.07285119 | ||
| Cell/Tissue List | HEK293T; hESC-HEK293T | ||
| Seq Type List | DART-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000361309.5; ENST00000355354.13; ENST00000644850.1 | ||
| External Link | RMBase: m6A_site_602106 | ||
| mod ID: M6ASITE062048 | Click to Show/Hide the Full List | ||
| mod site | chr3:108080241-108080242:- | [4] | |
| Sequence | TACTAATATGGAGGCACAAAACACTACTGAAGTATACGTAA | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa; hESC-HEK293T | ||
| Seq Type List | m6A-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000644850.1; ENST00000355354.13; ENST00000361309.5 | ||
| External Link | RMBase: m6A_site_602107 | ||
| mod ID: M6ASITE062049 | Click to Show/Hide the Full List | ||
| mod site | chr3:108080246-108080247:- | [5] | |
| Sequence | TTTGTTACTAATATGGAGGCACAAAACACTACTGAAGTATA | ||
| Motif Score | 2.830589286 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000355354.13; ENST00000361309.5; ENST00000644850.1 | ||
| External Link | RMBase: m6A_site_602108 | ||
| mod ID: M6ASITE062050 | Click to Show/Hide the Full List | ||
| mod site | chr3:108080260-108080261:- | [3] | |
| Sequence | TCGTCATTCCATGCTTTGTTACTAATATGGAGGCACAAAAC | ||
| Motif Score | 2.494845238 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000355354.13; ENST00000644850.1; ENST00000361309.5 | ||
| External Link | RMBase: m6A_site_602109 | ||
| mod ID: M6ASITE062052 | Click to Show/Hide the Full List | ||
| mod site | chr3:108080286-108080287:- | [5] | |
| Sequence | AGAATTCACGTTTTGTAATGACACTGTCGTCATTCCATGCT | ||
| Motif Score | 2.859755952 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000361309.5; ENST00000644850.1; ENST00000355354.13 | ||
| External Link | RMBase: m6A_site_602110 | ||
| mod ID: M6ASITE062053 | Click to Show/Hide the Full List | ||
| mod site | chr3:108080317-108080318:- | [5] | |
| Sequence | CTCAGCTACTATTTAATAAAACAAAATCTGTAGAATTCACG | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000644850.1; ENST00000361309.5; ENST00000355354.13 | ||
| External Link | RMBase: m6A_site_602111 | ||
| mod ID: M6ASITE062054 | Click to Show/Hide the Full List | ||
| mod site | chr3:108090948-108090949:- | [9] | |
| Sequence | GGCGGCGGCTGCTGCTCCGGACACCTGCGGCGGCGGCGGCG | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | A549; hESC-HEK293T; GSC-11; HEK293A-TOA; iSLK; TIME | ||
| Seq Type List | MeRIP-seq; MAZTER-seq; m6A-seq | ||
| Transcript ID List | ENST00000361309.5; ENST00000644850.1; ENST00000355354.13 | ||
| External Link | RMBase: m6A_site_602112 | ||
| mod ID: M6ASITE062055 | Click to Show/Hide the Full List | ||
| mod site | chr3:108091740-108091741:- | [10] | |
| Sequence | GAGGATGAAAACACTAAAGAACCAAGTGAGAAAGAGGGAAG | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HEK293A-TOA | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000644850.1 | ||
| External Link | RMBase: m6A_site_602113 | ||
| mod ID: M6ASITE062056 | Click to Show/Hide the Full List | ||
| mod site | chr3:108091750-108091751:- | [10] | |
| Sequence | ACCCTGATCAGAGGATGAAAACACTAAAGAACCAAGTGAGA | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HEK293A-TOA | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000644850.1 | ||
| External Link | RMBase: m6A_site_602114 | ||
Pseudouridine (Pseudo)
| In total 1 m6A sequence/site(s) in this target gene | |||
| mod ID: PSESITE000188 | Click to Show/Hide the Full List | ||
| mod site | chr3:108080194-108080195:- | [11] | |
| Sequence | AATTTAAAGGAAGAGATATTTACACCTTTGATGGAGCTCTA | ||
| Transcript ID List | ENST00000361309.5; ENST00000355354.13; ENST00000644850.1 | ||
| External Link | RMBase: Pseudo_site_3570 | ||
References



