m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00490)

Target Name	Nucleobindin-1 (NUCB1)
Gene Name	NUCB1
Chromosomal Location	19q13.33
Family	Nucleobindin family
Function	Major calcium-binding protein of the Golgi which may have a role in calcium homeostasis (By similarity). Acts as a non-receptor guanine nucleotide exchange factor which binds to and activates alpha subunits of guanine nucleotide-binding proteins (G proteins) (By similarity). Click to Show/Hide
Gene ID	4924
Uniprot ID	NUCB1_HUMAN
HGNC ID	HGNC:8043
KEGG ID	hsa:4924

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

NUCB1 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Browse Drug

Methyltransferase-like 3 (METTL3) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by METTL3*
Cell Line	DKO-1 cell line	Homo sapiens
Treatment: METTL3 knockdown DKO-1 cell Control: DKO-1 cell		GSE182382
Regulation		logFC: -7.45E-01 p-value: 2.41E-03
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	METTL3-mediated m6A modification on Nucleobindin-1 (NUCB1) 5'UTR via the reader YTHDF2 as a mechanism for NUCB1 downregulation in PDAC. This study revealed crucial functions of NUCB1 in suppressing proliferation and enhancing the effects of gemcitabine in pancreatic cancer cells.
Target Regulation	Down regulation
Responsed Disease	Pancreatic ductal adenocarcinoma		ICD-11: 2C10.0	Disease Info
Responsed Drug	Gemcitabine		Approved	Drug Info
Pathway Response	Autophagy			hsa04140
Cell Process	Cell proliferation
Cell Process	Cell autophagy
In-vitro Model	SW1990	Pancreatic adenocarcinoma	Homo sapiens	CVCL_1723
	PANC-1	Pancreatic ductal adenocarcinoma	Homo sapiens	CVCL_0480
	HEK293T	Normal	Homo sapiens	CVCL_0063
	CFPAC-1	Cystic fibrosis	Homo sapiens	CVCL_1119
	BxPC-3	Pancreatic ductal adenocarcinoma	Homo sapiens	CVCL_0186
	AsPC-1	Pancreatic ductal adenocarcinoma	Homo sapiens	CVCL_0152
In-vivo Model	5 × 10⁶ SW1990 cells expressing NUCB1 (oeNUCB1) or control vector (oeNC) were injected subcutaneously.

YTH domain-containing family protein 2 (YTHDF2) [READER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by YTHDF2*
Cell Line	B18-hi B cell line	Mus musculus
Treatment: YTHDF2 knockout B18-hi B cells Control: Wild type B18-hi B cells		GSE189819
Regulation		logFC: 6.95E-01 p-value: 1.62E-02
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	METTL3-mediated m6A modification on Nucleobindin-1 (NUCB1) 5'UTR via the reader YTHDF2 as a mechanism for NUCB1 downregulation in PDAC. This study revealed crucial functions of NUCB1 in suppressing proliferation and enhancing the effects of gemcitabine in pancreatic cancer cells.
Target Regulation	Down regulation
Responsed Disease	Pancreatic ductal adenocarcinoma		ICD-11: 2C10.0	Disease Info
Responsed Drug	Gemcitabine		Approved	Drug Info
Pathway Response	Autophagy			hsa04140
Cell Process	Cell proliferation
Cell Process	Cell autophagy
In-vitro Model	SW1990	Pancreatic adenocarcinoma	Homo sapiens	CVCL_1723
	PANC-1	Pancreatic ductal adenocarcinoma	Homo sapiens	CVCL_0480
	HEK293T	Normal	Homo sapiens	CVCL_0063
	CFPAC-1	Cystic fibrosis	Homo sapiens	CVCL_1119
	BxPC-3	Pancreatic ductal adenocarcinoma	Homo sapiens	CVCL_0186
	AsPC-1	Pancreatic ductal adenocarcinoma	Homo sapiens	CVCL_0152
In-vivo Model	5 × 10⁶ SW1990 cells expressing NUCB1 (oeNUCB1) or control vector (oeNC) were injected subcutaneously.

Pancreatic cancer [ICD-11: 2C10]

Disease Info

In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	METTL3-mediated m6A modification on Nucleobindin-1 (NUCB1) 5'UTR via the reader YTHDF2 as a mechanism for NUCB1 downregulation in PDAC. This study revealed crucial functions of NUCB1 in suppressing proliferation and enhancing the effects of gemcitabine in pancreatic cancer cells.
Responsed Disease	Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Down regulation
Responsed Drug	Gemcitabine		Approved	Drug Info
Pathway Response	Autophagy			hsa04140
Cell Process	Cell proliferation
Cell Process	Cell autophagy
In-vitro Model	SW1990	Pancreatic adenocarcinoma	Homo sapiens	CVCL_1723
	PANC-1	Pancreatic ductal adenocarcinoma	Homo sapiens	CVCL_0480
	HEK293T	Normal	Homo sapiens	CVCL_0063
	CFPAC-1	Cystic fibrosis	Homo sapiens	CVCL_1119
	BxPC-3	Pancreatic ductal adenocarcinoma	Homo sapiens	CVCL_0186
	AsPC-1	Pancreatic ductal adenocarcinoma	Homo sapiens	CVCL_0152
In-vivo Model	5 × 10⁶ SW1990 cells expressing NUCB1 (oeNUCB1) or control vector (oeNC) were injected subcutaneously.
Experiment 2 Reporting the m6A-centered Disease Response				[1]
Response Summary	METTL3-mediated m6A modification on Nucleobindin-1 (NUCB1) 5'UTR via the reader YTHDF2 as a mechanism for NUCB1 downregulation in PDAC. This study revealed crucial functions of NUCB1 in suppressing proliferation and enhancing the effects of gemcitabine in pancreatic cancer cells.
Responsed Disease	Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0]
Target Regulator	YTH domain-containing family protein 2 (YTHDF2)		READER	Regulator Info
Target Regulation	Down regulation
Responsed Drug	Gemcitabine		Approved	Drug Info
Pathway Response	Autophagy			hsa04140
Cell Process	Cell proliferation
Cell Process	Cell autophagy
In-vitro Model	SW1990	Pancreatic adenocarcinoma	Homo sapiens	CVCL_1723
	PANC-1	Pancreatic ductal adenocarcinoma	Homo sapiens	CVCL_0480
	HEK293T	Normal	Homo sapiens	CVCL_0063
	CFPAC-1	Cystic fibrosis	Homo sapiens	CVCL_1119
	BxPC-3	Pancreatic ductal adenocarcinoma	Homo sapiens	CVCL_0186
	AsPC-1	Pancreatic ductal adenocarcinoma	Homo sapiens	CVCL_0152
In-vivo Model	5 × 10⁶ SW1990 cells expressing NUCB1 (oeNUCB1) or control vector (oeNC) were injected subcutaneously.

Gemcitabine [Approved]

Drug Info

In total 2 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response				[1]
Response Summary	METTL3-mediated m6A modification on Nucleobindin-1 (NUCB1) 5'UTR via the reader YTHDF2 as a mechanism for NUCB1 downregulation in PDAC. This study revealed crucial functions of NUCB1 in suppressing proliferation and enhancing the effects of gemcitabine in pancreatic cancer cells.
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Down regulation
Responsed Disease	Pancreatic ductal adenocarcinoma		ICD-11: 2C10.0	Disease Info
Pathway Response	Autophagy			hsa04140
Cell Process	Cell proliferation
Cell Process	Cell autophagy
In-vitro Model	SW1990	Pancreatic adenocarcinoma	Homo sapiens	CVCL_1723
	PANC-1	Pancreatic ductal adenocarcinoma	Homo sapiens	CVCL_0480
	HEK293T	Normal	Homo sapiens	CVCL_0063
	CFPAC-1	Cystic fibrosis	Homo sapiens	CVCL_1119
	BxPC-3	Pancreatic ductal adenocarcinoma	Homo sapiens	CVCL_0186
	AsPC-1	Pancreatic ductal adenocarcinoma	Homo sapiens	CVCL_0152
In-vivo Model	5 × 10⁶ SW1990 cells expressing NUCB1 (oeNUCB1) or control vector (oeNC) were injected subcutaneously.
Experiment 2 Reporting the m6A-centered Drug Response				[1]
Response Summary	METTL3-mediated m6A modification on Nucleobindin-1 (NUCB1) 5'UTR via the reader YTHDF2 as a mechanism for NUCB1 downregulation in PDAC. This study revealed crucial functions of NUCB1 in suppressing proliferation and enhancing the effects of gemcitabine in pancreatic cancer cells.
Target Regulator	YTH domain-containing family protein 2 (YTHDF2)		READER	Regulator Info
Target Regulation	Down regulation
Responsed Disease	Pancreatic ductal adenocarcinoma		ICD-11: 2C10.0	Disease Info
Pathway Response	Autophagy			hsa04140
Cell Process	Cell proliferation
Cell Process	Cell autophagy
In-vitro Model	SW1990	Pancreatic adenocarcinoma	Homo sapiens	CVCL_1723
	PANC-1	Pancreatic ductal adenocarcinoma	Homo sapiens	CVCL_0480
	HEK293T	Normal	Homo sapiens	CVCL_0063
	CFPAC-1	Cystic fibrosis	Homo sapiens	CVCL_1119
	BxPC-3	Pancreatic ductal adenocarcinoma	Homo sapiens	CVCL_0186
	AsPC-1	Pancreatic ductal adenocarcinoma	Homo sapiens	CVCL_0152
In-vivo Model	5 × 10⁶ SW1990 cells expressing NUCB1 (oeNUCB1) or control vector (oeNC) were injected subcutaneously.

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00490)

Nucleobindin-1 (NUCB1)

Adenosine-to-Inosine editing (A-to-I)

In total 2 m6A sequence/site(s) in this target gene
mod ID: A2ISITE009263		Click to Show/Hide the Full List
mod site	chr19:48907135-48907136:+		[2]
Sequence	AGGCGCCCGCCACCATGCCCAGCTAATTTTTTGTATTTTTA
Transcript ID List	ENST00000424608.1; ENST00000485798.5; ENST00000405315.9; ENST00000407032.5; ENST00000452087.5
External Link	RMBase: RNA-editing_site_71752
mod ID: A2ISITE009264		Click to Show/Hide the Full List
mod site	chr19:48914242-48914243:+		[3]
Sequence	CCTCAGCATCCCAAAGTGCTAGGATTACAGGCGTGAGTCAC
Transcript ID List	ENST00000452087.5; ENST00000405315.9; ENST00000465524.5; ENST00000407032.5; ENST00000424608.1; ENST00000485798.5
External Link	RMBase: RNA-editing_site_71753

5-methylcytidine (m5C)

In total 3 m6A sequence/site(s) in this target gene
mod ID: M5CSITE002081		Click to Show/Hide the Full List
mod site	chr19:48921146-48921147:+		[4]
Sequence	CTGATGGCCCCTGTGCCTGCCCTGCAGACAGTGGAGATGCA
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000465524.5; ENST00000469291.1; ENST00000405315.9; ENST00000492367.1; ENST00000407032.5; ENST00000485798.5
External Link	RMBase: m5C_site_25183
mod ID: M5CSITE002082		Click to Show/Hide the Full List
mod site	chr19:48921147-48921148:+		[4]
Sequence	TGATGGCCCCTGTGCCTGCCCTGCAGACAGTGGAGATGCAC
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000492367.1; ENST00000407032.5; ENST00000469291.1; ENST00000405315.9; ENST00000465524.5; ENST00000485798.5
External Link	RMBase: m5C_site_25184
mod ID: M5CSITE002083		Click to Show/Hide the Full List
mod site	chr19:48922458-48922459:+
Sequence	AGCCCTCAGGATTCCTGATGCTCCAAGGCGACTGATGGGCG
Cell/Tissue List	liver
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000485798.5; ENST00000492367.1; ENST00000407032.5; ENST00000405315.9
External Link	RMBase: m5C_site_25185

N6-methyladenosine (m6A)

In total 58 m6A sequence/site(s) in this target gene
mod ID: M6ASITE041900		Click to Show/Hide the Full List
mod site	chr19:48900435-48900436:+		[5]
Sequence	GGGGGCCAGAGGGCTGGAAAACTGGGTCCCGGAGGAGGATG
Motif Score	2.627720238
Cell/Tissue List	HeLa; HepG2; HEK293T; H1A; H1B; MM6; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000411700.5; ENST00000407032.5; ENST00000405315.9; ENST00000443560.1; ENST00000452087.5; ENST00000485798.5
External Link	RMBase: m6A_site_447793
mod ID: M6ASITE041901		Click to Show/Hide the Full List
mod site	chr19:48900501-48900502:+		[5]
Sequence	TGGGAAAAGAGGAGGCTGGGACCCTGGACTCTTGGGTCTGG
Motif Score	3.622404762
Cell/Tissue List	HeLa; HepG2; HEK293A-TOA; endometrial; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000443560.1; ENST00000411700.5; ENST00000407032.5; ENST00000485798.5; ENST00000452087.5; ENST00000405315.9
External Link	RMBase: m6A_site_447794
mod ID: M6ASITE041902		Click to Show/Hide the Full List
mod site	chr19:48900508-48900509:+		[5]
Sequence	AGAGGAGGCTGGGACCCTGGACTCTTGGGTCTGGGGGAGGA
Motif Score	4.065041667
Cell/Tissue List	HeLa; HepG2; HEK293A-TOA; endometrial; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000405315.9; ENST00000452087.5; ENST00000411700.5; ENST00000407032.5; ENST00000443560.1; ENST00000485798.5
External Link	RMBase: m6A_site_447795
mod ID: M6ASITE041903		Click to Show/Hide the Full List
mod site	chr19:48900584-48900585:+		[5]
Sequence	GGAGCGTGTTGGGAGCCAGGACCCCTGGGTCTGAGGGCCCA
Motif Score	3.622404762
Cell/Tissue List	HeLa; HepG2; peripheral-blood; iSLK; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000407032.5; ENST00000451312.5; ENST00000452087.5; ENST00000485798.5; ENST00000443560.1; ENST00000405315.9; ENST00000411700.5
External Link	RMBase: m6A_site_447796
mod ID: M6ASITE041904		Click to Show/Hide the Full List
mod site	chr19:48900606-48900607:+		[5]
Sequence	CCCTGGGTCTGAGGGCCCAGACTCCTGTGTCGGAGGAAGGG
Motif Score	3.319380952
Cell/Tissue List	HeLa; HepG2; peripheral-blood; iSLK; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000452087.5; ENST00000451312.5; ENST00000485798.5; ENST00000407032.5; ENST00000443560.1; ENST00000405315.9; ENST00000411700.5
External Link	RMBase: m6A_site_447797
mod ID: M6ASITE041905		Click to Show/Hide the Full List
mod site	chr19:48900714-48900715:+		[5]
Sequence	GGGCGGCGCTGGGGGCCCGAACTCCTGGTTCCAGGGGAGGA
Motif Score	3.373380952
Cell/Tissue List	HeLa; HepG2; iSLK
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000411700.5; ENST00000407032.5; ENST00000443560.1; ENST00000405315.9; ENST00000485798.5; ENST00000452087.5; ENST00000451312.5
External Link	RMBase: m6A_site_447798
mod ID: M6ASITE041906		Click to Show/Hide the Full List
mod site	chr19:48900746-48900747:+		[5]
Sequence	AGGGGAGGAAGAGGCTTGGGACAGACATTATGCATTATCCA
Motif Score	3.643047619
Cell/Tissue List	HeLa; HepG2; H1B; A549; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293T; iSLK; MSC; TIME; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000411700.5; ENST00000452087.5; ENST00000407032.5; ENST00000405315.9; ENST00000451312.5; ENST00000485798.5; ENST00000443560.1
External Link	RMBase: m6A_site_447799
mod ID: M6ASITE041907		Click to Show/Hide the Full List
mod site	chr19:48900785-48900786:+		[5]
Sequence	CAGCCCTCCATCCCCCACAGACCACACTGCCATGCCTCCCT
Motif Score	2.876744048
Cell/Tissue List	HeLa; HepG2; H1A; H1B; A549; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293T; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000411700.5; ENST00000452087.5; ENST00000443560.1; ENST00000451312.5; ENST00000485798.5; ENST00000405315.9; ENST00000407032.5
External Link	RMBase: m6A_site_447800
mod ID: M6ASITE041908		Click to Show/Hide the Full List
mod site	chr19:48900788-48900789:+		[6]
Sequence	CCCTCCATCCCCCACAGACCACACTGCCATGCCTCCCTCTG
Motif Score	2.053113095
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000452087.5; ENST00000405315.9; ENST00000407032.5; ENST00000485798.5; ENST00000451312.5; ENST00000443560.1; ENST00000411700.5
External Link	RMBase: m6A_site_447801
mod ID: M6ASITE041909		Click to Show/Hide the Full List
mod site	chr19:48900820-48900821:+		[5]
Sequence	CTCCCTCTGGGCCCCGAGGAACCCTCCTTCTGTTGCCGCTG
Motif Score	2.930744048
Cell/Tissue List	HeLa; HepG2; H1A; A549; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293T; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000424608.1; ENST00000452087.5; ENST00000443560.1; ENST00000411700.5; ENST00000485798.5; ENST00000451312.5; ENST00000407032.5; ENST00000405315.9
External Link	RMBase: m6A_site_447802
mod ID: M6ASITE041910		Click to Show/Hide the Full List
mod site	chr19:48900899-48900900:+		[6]
Sequence	CCTGGAGCGAGGGGCGCCCAACAAGGAGGAGACCCCTGCGA
Motif Score	2.173910714
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000452087.5; ENST00000451312.5; ENST00000424608.1; ENST00000407032.5; ENST00000405315.9; ENST00000485798.5; ENST00000411700.5; ENST00000443560.1
External Link	RMBase: m6A_site_447803
mod ID: M6ASITE041911		Click to Show/Hide the Full List
mod site	chr19:48900910-48900911:+		[5]
Sequence	GGGCGCCCAACAAGGAGGAGACCCCTGCGACTGAGAGTCCC
Motif Score	2.876744048
Cell/Tissue List	HeLa; HepG2; H1A; LCLs; A549; MM6; CD4T; peripheral-blood; GSC-11; HEK293T; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000407032.5; ENST00000452087.5; ENST00000443560.1; ENST00000451312.5; ENST00000424608.1; ENST00000411700.5; ENST00000405315.9; ENST00000485798.5
External Link	RMBase: m6A_site_447804
mod ID: M6ASITE041912		Click to Show/Hide the Full List
mod site	chr19:48900991-48900992:+		[5]
Sequence	TGGTACTACAGCTCCTGCAGACCCCGGTGCCCGTAGGGCGG
Motif Score	2.876744048
Cell/Tissue List	HeLa; HepG2; A549; MM6; CD4T; peripheral-blood; GSC-11; HEK293T; MSC; TIME; iSLK; TREX; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000424608.1; ENST00000452087.5; ENST00000443560.1; ENST00000407032.5; ENST00000451312.5; ENST00000411700.5; ENST00000485798.5; ENST00000405315.9
External Link	RMBase: m6A_site_447805
mod ID: M6ASITE041913		Click to Show/Hide the Full List
mod site	chr19:48901099-48901100:+		[5]
Sequence	GGGGTTTGACTTGGTGAAAAACTGGAGGTCCCTGACTCTGA
Motif Score	2.627720238
Cell/Tissue List	HeLa; A549; MM6; peripheral-blood; endometrial; NB4
Seq Type List	m6A-seq
Transcript ID List	ENST00000485798.5; ENST00000443560.1; ENST00000451312.5; ENST00000405315.9; ENST00000424608.1; ENST00000452087.5; ENST00000407032.5; ENST00000411700.5
External Link	RMBase: m6A_site_447806
mod ID: M6ASITE041914		Click to Show/Hide the Full List
mod site	chr19:48904446-48904447:+		[5]
Sequence	GCAGGCTGCCAATGCGGAGGACATCAAGGTGCGGCTGGGGG
Motif Score	3.643047619
Cell/Tissue List	HeLa; HepG2; hESC-HEK293T; A549; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MAZTER-seq; MeRIP-seq
Transcript ID List	ENST00000452087.5; ENST00000485798.5; ENST00000405315.9; ENST00000411700.5; ENST00000424608.1; ENST00000407032.5; ENST00000443560.1; ENST00000451312.5
External Link	RMBase: m6A_site_447807
mod ID: M6ASITE041915		Click to Show/Hide the Full List
mod site	chr19:48905777-48905778:+		[5]
Sequence	GAAGCTGAGCCGAGAGCTGGACTTTGTCAGCCACCACGTCC
Motif Score	4.065041667
Cell/Tissue List	HeLa; HepG2; A549; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293T; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000405315.9; ENST00000485798.5; ENST00000424608.1; ENST00000452087.5; ENST00000407032.5; ENST00000451312.5; ENST00000443560.1; ENST00000411700.5
External Link	RMBase: m6A_site_447808
mod ID: M6ASITE041916		Click to Show/Hide the Full List
mod site	chr19:48905823-48905824:+		[7]
Sequence	AAGCTGGATGAGCTCAAGCGACAGGAGGTGTCACGGCTGCG
Motif Score	2.865571429
Cell/Tissue List	kidney
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000407032.5; ENST00000424608.1; ENST00000451312.5; ENST00000485798.5; ENST00000443560.1; ENST00000411700.5; ENST00000452087.5; ENST00000405315.9
External Link	RMBase: m6A_site_447809
mod ID: M6ASITE041917		Click to Show/Hide the Full List
mod site	chr19:48911179-48911180:+		[5]
Sequence	GATCATCTGAATCTCCTGAAACAGTTTGAACACCTGGACCC
Motif Score	2.20572619
Cell/Tissue List	HeLa; CD34; HepG2; MT4; A549; MM6; Huh7; CD4T; peripheral-blood; GSC-11; HEK293T; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000407032.5; ENST00000424608.1; ENST00000452087.5; ENST00000405315.9; ENST00000485798.5
External Link	RMBase: m6A_site_447810
mod ID: M6ASITE041918		Click to Show/Hide the Full List
mod site	chr19:48911188-48911189:+		[5]
Sequence	AATCTCCTGAAACAGTTTGAACACCTGGACCCTCAGAACCA
Motif Score	2.951386905
Cell/Tissue List	HeLa; CD34; HepG2; MT4; A549; MM6; Huh7; CD4T; peripheral-blood; GSC-11; HEK293T; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000485798.5; ENST00000405315.9; ENST00000452087.5; ENST00000407032.5; ENST00000424608.1
External Link	RMBase: m6A_site_447811
mod ID: M6ASITE041919		Click to Show/Hide the Full List
mod site	chr19:48911196-48911197:+		[5]
Sequence	GAAACAGTTTGAACACCTGGACCCTCAGAACCAGCATACAT
Motif Score	3.622404762
Cell/Tissue List	HeLa; CD34; HepG2; MT4; A549; MM6; Huh7; CD4T; peripheral-blood; GSC-11; HEK293T; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000405315.9; ENST00000424608.1; ENST00000407032.5; ENST00000485798.5; ENST00000452087.5
External Link	RMBase: m6A_site_447812
mod ID: M6ASITE041920		Click to Show/Hide the Full List
mod site	chr19:48911205-48911206:+		[5]
Sequence	TGAACACCTGGACCCTCAGAACCAGCATACATTCGAGGCCC
Motif Score	2.930744048
Cell/Tissue List	HeLa; CD34; HepG2; MT4; A549; MM6; Huh7; CD4T; peripheral-blood; GSC-11; HEK293T; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000485798.5; ENST00000407032.5; ENST00000452087.5; ENST00000424608.1; ENST00000405315.9
External Link	RMBase: m6A_site_447813
mod ID: M6ASITE041921		Click to Show/Hide the Full List
mod site	chr19:48911213-48911214:+		[6]
Sequence	TGGACCCTCAGAACCAGCATACATTCGAGGCCCGCGACCTG
Motif Score	2.110482143
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000407032.5; ENST00000405315.9; ENST00000485798.5; ENST00000424608.1; ENST00000452087.5
External Link	RMBase: m6A_site_447814
mod ID: M6ASITE041922		Click to Show/Hide the Full List
mod site	chr19:48913020-48913021:+		[5]
Sequence	CTTTCCCCAGGCCACCCGGGACCTTGCCCAGTACGACGCAG
Motif Score	3.622404762
Cell/Tissue List	HeLa; CD34; HepG2; U2OS; MT4; A549; MM6; Huh7; CD4T; peripheral-blood; GSC-11; HEK293T; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000407032.5; ENST00000465524.5; ENST00000452087.5; ENST00000485798.5; ENST00000405315.9; ENST00000424608.1
External Link	RMBase: m6A_site_447815
mod ID: M6ASITE041923		Click to Show/Hide the Full List
mod site	chr19:48913081-48913082:+		[5]
Sequence	CGCTACGAGATGCTTAAGGAACACGAGAGACGGCGTTATCT
Motif Score	2.951386905
Cell/Tissue List	HeLa; CD34; HepG2; hESC-HEK293T; U2OS; hNPCs; A549; MT4; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MAZTER-seq; MeRIP-seq
Transcript ID List	ENST00000465524.5; ENST00000452087.5; ENST00000424608.1; ENST00000407032.5; ENST00000405315.9; ENST00000485798.5
External Link	RMBase: m6A_site_447816
mod ID: M6ASITE041924		Click to Show/Hide the Full List
mod site	chr19:48913517-48913518:+		[5]
Sequence	GTGTGGGAGGAGCTGGATGGACTGGACCCCAACAGGTTTAA
Motif Score	4.065041667
Cell/Tissue List	HeLa; CD34; HepG2; A549; HEK293T; U2OS; H1A; H1B; hNPCs; fibroblasts; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; MSC; TREX; iSLK; TIME; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000465524.5; ENST00000424608.1; ENST00000407032.5; ENST00000485798.5; ENST00000405315.9; ENST00000452087.5
External Link	RMBase: m6A_site_447817
mod ID: M6ASITE041925		Click to Show/Hide the Full List
mod site	chr19:48913522-48913523:+		[5]
Sequence	GGAGGAGCTGGATGGACTGGACCCCAACAGGTTTAACCCCA
Motif Score	3.622404762
Cell/Tissue List	HeLa; CD34; HepG2; A549; HEK293T; U2OS; H1A; H1B; hNPCs; fibroblasts; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; MSC; TREX; iSLK; TIME; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000405315.9; ENST00000452087.5; ENST00000485798.5; ENST00000465524.5; ENST00000424608.1; ENST00000407032.5
External Link	RMBase: m6A_site_447818
mod ID: M6ASITE041926		Click to Show/Hide the Full List
mod site	chr19:48913545-48913546:+		[5]
Sequence	CCAACAGGTTTAACCCCAAGACCTTCTTCATACTGCATGGT
Motif Score	2.876744048
Cell/Tissue List	HeLa; CD34; HepG2; A549; HEK293T; U2OS; H1A; H1B; fibroblasts; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; MSC; TREX; iSLK; TIME; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000465524.5; ENST00000424608.1; ENST00000407032.5; ENST00000405315.9; ENST00000452087.5; ENST00000485798.5
External Link	RMBase: m6A_site_447819
mod ID: M6ASITE041927		Click to Show/Hide the Full List
mod site	chr19:48918496-48918497:+		[5]
Sequence	ACCCAAGCATGTTTCCTCGAACCCTCCCTTTGATCTATTCC
Motif Score	2.930744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000405315.9; ENST00000452087.5; ENST00000465524.5; ENST00000460125.1; ENST00000407032.5; ENST00000424608.1; ENST00000485798.5
External Link	RMBase: m6A_site_447820
mod ID: M6ASITE041928		Click to Show/Hide the Full List
mod site	chr19:48918887-48918888:+		[5]
Sequence	TGGATGGGAGCTCAGTGAAAACTACAACTCCCATCAGCCCC
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000460125.1; ENST00000407032.5; ENST00000469291.1; ENST00000424608.1; ENST00000405315.9; ENST00000465524.5; ENST00000485798.5
External Link	RMBase: m6A_site_447824
mod ID: M6ASITE041929		Click to Show/Hide the Full List
mod site	chr19:48918991-48918992:+		[5]
Sequence	CGGGAATGAGCTCGCTGGGGACCTCTCAATGCTGTCTGCCT
Motif Score	3.622404762
Cell/Tissue List	HeLa; HepG2; U2OS; hNPCs; fibroblasts; A549; MT4; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; MSC; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000469291.1; ENST00000405315.9; ENST00000407032.5; ENST00000485798.5; ENST00000465524.5; ENST00000424608.1; ENST00000460125.1
External Link	RMBase: m6A_site_447825
mod ID: M6ASITE041930		Click to Show/Hide the Full List
mod site	chr19:48919066-48919067:+		[6]
Sequence	CCCAAAGAATGAGGAGGACGACATGCGGGAGATGGAGGAGG
Motif Score	2.865571429
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000485798.5; ENST00000465524.5; ENST00000469291.1; ENST00000460125.1; ENST00000407032.5; ENST00000424608.1; ENST00000492367.1; ENST00000405315.9
External Link	RMBase: m6A_site_447826
mod ID: M6ASITE041931		Click to Show/Hide the Full List
mod site	chr19:48919197-48919198:+		[5]
Sequence	TTATCTGGCTCCCCAGGTGGACACCAACCAGGACCGCCTCG
Motif Score	3.643047619
Cell/Tissue List	HeLa; CD34; HepG2; hESC-HEK293T; U2OS; LCLs; MT4; A549; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; MSC; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MAZTER-seq; MeRIP-seq
Transcript ID List	ENST00000465524.5; ENST00000485798.5; ENST00000405315.9; ENST00000424608.1; ENST00000469291.1; ENST00000407032.5; ENST00000492367.1
External Link	RMBase: m6A_site_447827
mod ID: M6ASITE041932		Click to Show/Hide the Full List
mod site	chr19:48919209-48919210:+		[5]
Sequence	CCAGGTGGACACCAACCAGGACCGCCTCGTGACCCTGGAGG
Motif Score	3.622404762
Cell/Tissue List	HeLa; CD34; HepG2; U2OS; LCLs; MT4; A549; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293T; MSC; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000485798.5; ENST00000424608.1; ENST00000407032.5; ENST00000465524.5; ENST00000469291.1; ENST00000492367.1; ENST00000405315.9
External Link	RMBase: m6A_site_447828
mod ID: M6ASITE041933		Click to Show/Hide the Full List
mod site	chr19:48919266-48919267:+		[5]
Sequence	TCAGAGGAAGGAGTTTGGGGACACCGGGGAGGGCTGGGAGG
Motif Score	3.643047619
Cell/Tissue List	HeLa; HepG2; hESC-HEK293T; U2OS; LCLs; MT4; A549; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; TREX; MSC; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MAZTER-seq; MeRIP-seq
Transcript ID List	ENST00000407032.5; ENST00000485798.5; ENST00000492367.1; ENST00000405315.9; ENST00000465524.5; ENST00000469291.1
External Link	RMBase: m6A_site_447829
mod ID: M6ASITE041934		Click to Show/Hide the Full List
mod site	chr19:48921175-48921176:+		[6]
Sequence	AGTGGAGATGCACCCTGCCTACACCGAGGAAGAGCTGAGGC
Motif Score	2.078666667
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000465524.5; ENST00000405315.9; ENST00000485798.5; ENST00000492367.1; ENST00000469291.1; ENST00000407032.5
External Link	RMBase: m6A_site_447830
mod ID: M6ASITE041935		Click to Show/Hide the Full List
mod site	chr19:48921264-48921265:+		[5]
Sequence	CCCAGCGCCTCAGCCAGGAGACAGAGGCTCTAGGGCGGTCC
Motif Score	2.897386905
Cell/Tissue List	HeLa; CD34; HepG2; U2OS; LCLs; MT4; A549; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293T; MSC; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000465524.5; ENST00000407032.5; ENST00000485798.5; ENST00000492367.1; ENST00000405315.9
External Link	RMBase: m6A_site_447831
mod ID: M6ASITE041936		Click to Show/Hide the Full List
mod site	chr19:48921836-48921837:+		[6]
Sequence	CCTCCCACAGGCTGTGCTGCACATGGAGCAGCGGAAGCAGC
Motif Score	2.830589286
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000407032.5; ENST00000405315.9; ENST00000485798.5; ENST00000492367.1; ENST00000465524.5
External Link	RMBase: m6A_site_447832
mod ID: M6ASITE041937		Click to Show/Hide the Full List
mod site	chr19:48921878-48921879:+		[6]
Sequence	GCAGCAGCAGCAGCAAGGCCACAAGGCCCCGGCTGCCCACC
Motif Score	2.053113095
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000492367.1; ENST00000485798.5; ENST00000407032.5; ENST00000405315.9
External Link	RMBase: m6A_site_447833
mod ID: M6ASITE041938		Click to Show/Hide the Full List
mod site	chr19:48921926-48921927:+		[5]
Sequence	GCAGCTCAAGTTCCACCCAGACACAGGTGCTGGCCCTAGTC
Motif Score	2.897386905
Cell/Tissue List	HeLa; HepG2; hESC-HEK293T; MT4; A549; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; TREX; MSC; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MAZTER-seq; MeRIP-seq
Transcript ID List	ENST00000405315.9; ENST00000485798.5; ENST00000407032.5; ENST00000492367.1
External Link	RMBase: m6A_site_447834
mod ID: M6ASITE041939		Click to Show/Hide the Full List
mod site	chr19:48922362-48922363:+		[5]
Sequence	CGGTGACCAGAAGGAGGTGGACACTTCAGAAAAGAAACTTC
Motif Score	3.643047619
Cell/Tissue List	HeLa; HepG2; hESC-HEK293T; A549; MM6; peripheral-blood; TREX; MSC; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MAZTER-seq; MeRIP-seq
Transcript ID List	ENST00000485798.5; ENST00000405315.9; ENST00000492367.1; ENST00000407032.5
External Link	RMBase: m6A_site_447835
mod ID: M6ASITE041940		Click to Show/Hide the Full List
mod site	chr19:48922378-48922379:+		[5]
Sequence	GTGGACACTTCAGAAAAGAAACTTCTCGAGCGGCTCCCTGA
Motif Score	2.627720238
Cell/Tissue List	HeLa; HepG2; A549; MM6; peripheral-blood; HEK293T; TREX; MSC; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000405315.9; ENST00000485798.5; ENST00000492367.1; ENST00000407032.5
External Link	RMBase: m6A_site_447836
mod ID: M6ASITE041941		Click to Show/Hide the Full List
mod site	chr19:48922433-48922434:+		[5]
Sequence	AGCATCTGTGATCCTCCGGGACCCCAGCCCTCAGGATTCCT
Motif Score	3.622404762
Cell/Tissue List	HeLa; HepG2; A549; MM6; peripheral-blood; HEK293T; TREX; MSC; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000407032.5; ENST00000485798.5; ENST00000405315.9; ENST00000492367.1
External Link	RMBase: m6A_site_447837
mod ID: M6ASITE041942		Click to Show/Hide the Full List
mod site	chr19:48922493-48922494:+		[7]
Sequence	TGGGCGCTGGATGAAGTGGCACAGTCAGCTTCCCTGGGGGC
Motif Score	2.830589286
Cell/Tissue List	brain; HEK293; HEK293T
Seq Type List	m6A-REF-seq; DART-seq
Transcript ID List	ENST00000407032.5; ENST00000492367.1; ENST00000485798.5; ENST00000405315.9
External Link	RMBase: m6A_site_447838
mod ID: M6ASITE041943		Click to Show/Hide the Full List
mod site	chr19:48922818-48922819:+		[8]
Sequence	CATCCTGTATGCCCACAGCTACTGGAATCCCCGCTGCTGCT
Motif Score	2.500660714
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000407032.5; ENST00000492367.1; ENST00000485798.5; ENST00000405315.9
External Link	RMBase: m6A_site_447839
mod ID: M6ASITE041944		Click to Show/Hide the Full List
mod site	chr19:48922889-48922890:+		[5]
Sequence	GCATGGGGTGGTCCCTCAAGACCTTCCCCTACCTTTTGTGG
Motif Score	2.876744048
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; LCLs; H1299; MM6; Huh7; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List	ENST00000405315.9; ENST00000485798.5; ENST00000407032.5; ENST00000492367.1
External Link	RMBase: m6A_site_447840
mod ID: M6ASITE041945		Click to Show/Hide the Full List
mod site	chr19:48922911-48922912:+		[5]
Sequence	CTTCCCCTACCTTTTGTGGAACCAGTGATGCCTCAAAGACA
Motif Score	2.930744048
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; LCLs; H1299; MM6; Huh7; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000407032.5; ENST00000405315.9; ENST00000485798.5; ENST00000492367.1
External Link	RMBase: m6A_site_447841
mod ID: M6ASITE041946		Click to Show/Hide the Full List
mod site	chr19:48922929-48922930:+		[5]
Sequence	GAACCAGTGATGCCTCAAAGACAGTGTCCCCTCCACAGCTG
Motif Score	2.897386905
Cell/Tissue List	HeLa; HepG2; HEK293T; brain; kidney; A549; hESC-HEK293T; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4; AML
Seq Type List	m6A-seq; MeRIP-seq; m6A-REF-seq; MAZTER-seq; miCLIP
Transcript ID List	ENST00000492367.1; ENST00000407032.5; ENST00000405315.9; ENST00000485798.5
External Link	RMBase: m6A_site_447842
mod ID: M6ASITE041947		Click to Show/Hide the Full List
mod site	chr19:48922987-48922988:+		[5]
Sequence	ATCCTCAGTATAGCCGGTGAACCCTGATACCAGGAGCCTGG
Motif Score	2.930744048
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; MT4; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000407032.5; ENST00000492367.1; ENST00000405315.9
External Link	RMBase: m6A_site_447843
mod ID: M6ASITE041948		Click to Show/Hide the Full List
mod site	chr19:48923018-48923019:+		[5]
Sequence	AGGAGCCTGGGCCTCCCTGAACCCCTGGCTTCCAGCCATCT
Motif Score	2.930744048
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; MT4; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000492367.1; ENST00000405315.9; ENST00000407032.5
External Link	RMBase: m6A_site_447844
mod ID: M6ASITE041949		Click to Show/Hide the Full List
mod site	chr19:48923059-48923060:+		[5]
Sequence	CATCGCCAGCCTCCTCCTGGACCTCTTGGCCCCCAGCCCCT
Motif Score	3.622404762
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; MT4; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000407032.5; ENST00000492367.1; ENST00000405315.9
External Link	RMBase: m6A_site_447845
mod ID: M6ASITE041950		Click to Show/Hide the Full List
mod site	chr19:48923085-48923086:+		[6]
Sequence	TGGCCCCCAGCCCCTTCCCCACACAGCCCCAGAAGGGTCCC
Motif Score	2.053113095
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000492367.1; ENST00000405315.9; ENST00000407032.5
External Link	RMBase: m6A_site_447846
mod ID: M6ASITE041951		Click to Show/Hide the Full List
mod site	chr19:48923126-48923127:+		[5]
Sequence	AGAGCTGACCCCACTCCAGGACCTAGGCCCAGCCCCTCAGC
Motif Score	3.622404762
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hESCs; fibroblasts; GM12878; LCLs; MT4; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000407032.5; ENST00000492367.1; ENST00000405315.9
External Link	RMBase: m6A_site_447847
mod ID: M6ASITE041952		Click to Show/Hide the Full List
mod site	chr19:48923167-48923168:+		[5]
Sequence	CTCATCTGGAGCCCCTGAAGACCAGTCCCACCCACCTTTCT
Motif Score	2.876744048
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hESCs; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000492367.1; ENST00000405315.9; ENST00000407032.5
External Link	RMBase: m6A_site_447848
mod ID: M6ASITE041953		Click to Show/Hide the Full List
mod site	chr19:48923199-48923200:+		[6]
Sequence	CACCTTTCTGGCCTCATCTGACACTGCTCCGCATCCTGCTG
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000405315.9; ENST00000492367.1; ENST00000407032.5
External Link	RMBase: m6A_site_447849
mod ID: M6ASITE041954		Click to Show/Hide the Full List
mod site	chr19:48923254-48923255:+		[6]
Sequence	TGTTCCGGTTCCATCCAAATACACTTTCTGGAACAAATGCA
Motif Score	2.110482143
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000407032.5; ENST00000405315.9; ENST00000492367.1
External Link	RMBase: m6A_site_447850
mod ID: M6ASITE041955		Click to Show/Hide the Full List
mod site	chr19:48923266-48923267:+		[5]
Sequence	ATCCAAATACACTTTCTGGAACAAATGCATGGCTCCATGCC
Motif Score	2.951386905
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hESCs; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000492367.1; ENST00000407032.5; ENST00000405315.9
External Link	RMBase: m6A_site_447851
mod ID: M6ASITE041956		Click to Show/Hide the Full List
mod site	chr19:48923298-48923299:+		[5]
Sequence	CTCCATGCCTGTGTATCTGGACTGGTCCCTCCAAAACGCTA
Motif Score	4.065041667
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hESCs; LCLs; H1299; MM6; Huh7; Jurkat; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000405315.9
External Link	RMBase: m6A_site_447852
mod ID: M6ASITE041957		Click to Show/Hide the Full List
mod site	chr19:48923355-48923356:+		[5]
Sequence	CGGAGTCCTCATCTTTGAAGACTGGATTCAAGCATCACTTC
Motif Score	3.319380952
Cell/Tissue List	HeLa; HEK293T; A549; HepG2; H1B; hESCs; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000405315.9
External Link	RMBase: m6A_site_447853

Pseudouridine (Pseudo)

In total 1 m6A sequence/site(s) in this target gene
mod ID: PSESITE000131		Click to Show/Hide the Full List
mod site	chr19:48922685-48922686:+		[9]
Sequence	TGAGGTGCTCAGTGATCGGCTTAACTTAGAGAAGCCCGCCC
Transcript ID List	ENST00000407032.5; ENST00000485798.5; ENST00000405315.9; ENST00000492367.1
External Link	RMBase: Pseudo_site_2520

Ref 1	NUCB1 Suppresses Growth and Shows Additive Effects With Gemcitabine in Pancreatic Ductal Adenocarcinoma via the Unfolded Protein Response. Front Cell Dev Biol. 2021 Mar 29;9:641836. doi: 10.3389/fcell.2021.641836. eCollection 2021.
Ref 2	RADAR: a rigorously annotated database of A-to-I RNA editing. Nucleic Acids Res. 2014 Jan;42(Database issue):D109-13. doi: 10.1093/nar/gkt996. Epub 2013 Oct 25.
Ref 3	Comprehensive analysis of RNA-Seq data reveals extensive RNA editing in a human transcriptome. Nat Biotechnol. 2012 Feb 12;30(3):253-60. doi: 10.1038/nbt.2122.
Ref 4	5-methylcytosine promotes mRNA export - NSUN2 as the methyltransferase and ALYREF as an m(5)C reader. Cell Res. 2017 May;27(5):606-625. doi: 10.1038/cr.2017.55. Epub 2017 Apr 18.
Ref 5	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 6	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.
Ref 7	Single-base mapping of m(6)A by an antibody-independent method. Sci Adv. 2019 Jul 3;5(7):eaax0250. doi: 10.1126/sciadv.aax0250. eCollection 2019 Jul.
Ref 8	DART-seq: an antibody-free method for global m(6)A detection. Nat Methods. 2019 Dec;16(12):1275-1280. doi: 10.1038/s41592-019-0570-0. Epub 2019 Sep 23.
Ref 9	Transcriptome-wide mapping reveals widespread dynamic-regulated pseudouridylation of ncRNA and mRNA. Cell. 2014 Sep 25;159(1):148-162. doi: 10.1016/j.cell.2014.08.028. Epub 2014 Sep 11.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map