m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00445)

Target Name	Vang-like protein 1 (VANGL1)
Synonyms	Loop-tail protein 2 homolog; LPP2; Strabismus 2; Van Gogh-like protein 1; STB2 Click to Show/Hide
Gene Name	VANGL1
Chromosomal Location	1p13.1
Family	Vang family
Gene ID	81839
Uniprot ID	VANG1_HUMAN
HGNC ID	HGNC:15512
KEGG ID	hsa:81839

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

VANGL1 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Insulin-like growth factor 2 mRNA-binding protein 2 (IGF2BP2) [READER]

Regulator Info

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	Up-regulation of Vang-like protein 1 (VANGL1) by IGF2BPs and miR-29b-3p attenuates the detrimental effect of irradiation on lung adenocarcinoma. Increased m6A level of VANGL1 and reduced miR-29b-3p took the responsibility of VANGL1 overexpression upon irradiation.
Target Regulation	Up regulation
Responsed Disease	Lung adenocarcinoma		ICD-11: 2C25.0	Disease Info
Pathway Response	Nucleotide excision repair			hsa03420
Cell Process	DNA repair
In-vitro Model	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
In-vitro Model	NCI-H1299	Lung large cell carcinoma	Homo sapiens	CVCL_0060
In-vivo Model	Two hundred milliliters of A549 cells (1 × 10⁶) were injected into the left flank of the back of each mouse.

Insulin-like growth factor 2 mRNA-binding protein 3 (IGF2BP3) [READER]

Regulator Info

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	Up-regulation of Vang-like protein 1 (VANGL1) by IGF2BPs and miR-29b-3p attenuates the detrimental effect of irradiation on lung adenocarcinoma. Increased m6A level of VANGL1 and reduced miR-29b-3p took the responsibility of VANGL1 overexpression upon irradiation.
Target Regulation	Up regulation
Responsed Disease	Lung adenocarcinoma		ICD-11: 2C25.0	Disease Info
Pathway Response	Nucleotide excision repair			hsa03420
Cell Process	DNA repair
In-vitro Model	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
In-vitro Model	NCI-H1299	Lung large cell carcinoma	Homo sapiens	CVCL_0060
In-vivo Model	Two hundred milliliters of A549 cells (1 × 10⁶) were injected into the left flank of the back of each mouse.

Lung cancer [ICD-11: 2C25]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	Up-regulation of Vang-like protein 1 (VANGL1) by IGF2BPs and miR-29b-3p attenuates the detrimental effect of irradiation on lung adenocarcinoma. Increased m6A level of VANGL1 and reduced miR-29b-3p took the responsibility of VANGL1 overexpression upon irradiation.
Responsed Disease	Lung adenocarcinoma [ICD-11: 2C25.0]
Target Regulator	Insulin-like growth factor 2 mRNA-binding protein 2 (IGF2BP2)		READER	Regulator Info
Target Regulation	Up regulation
Pathway Response	Nucleotide excision repair			hsa03420
Cell Process	DNA repair
In-vitro Model	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
In-vitro Model	NCI-H1299	Lung large cell carcinoma	Homo sapiens	CVCL_0060
In-vivo Model	Two hundred milliliters of A549 cells (1 × 10⁶) were injected into the left flank of the back of each mouse.

Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator

Histone modification

m6A Regulator: Insulin-like growth factor 2 mRNA-binding protein 2 (IGF2BP2)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03465		Crosstalk Info
Epigenetic Regulator	Histone-lysine N-methyltransferase SETD1A (SETD1A)
Regulated Target	Histone H3 lysine 4 trimethylation (H3K4me3)
Crosstalk relationship	Histone modification → m6A
Disease	Lung cancer	Disease Info

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00445)

Vang-like protein 1 (VANGL1)

Adenosine-to-Inosine editing (A-to-I)

In total 4 m6A sequence/site(s) in this target gene
mod ID: A2ISITE010060		Click to Show/Hide the Full List
mod site	chr1:115654466-115654467:+		[2]
Sequence	ATTGTGGTGTGGATGAGGGAAGCCTGGTATTGACAAGGGAA
Transcript ID List	ENST00000369510.8; ENST00000310260.7; ENST00000369509.1; ENST00000355485.7
External Link	RMBase: RNA-editing_site_8065
mod ID: A2ISITE010062		Click to Show/Hide the Full List
mod site	chr1:115686703-115686704:+		[2]
Sequence	AATCTAAAAGACCGTTTGGTAAAACTGACTCTGTAACACCC
Transcript ID List	ENST00000310260.7; ENST00000369509.1; ENST00000369510.8; ENST00000355485.7
External Link	RMBase: RNA-editing_site_8066
mod ID: A2ISITE010063		Click to Show/Hide the Full List
mod site	chr1:115686705-115686706:+		[2]
Sequence	TCTAAAAGACCGTTTGGTAAAACTGACTCTGTAACACCCAA
Transcript ID List	ENST00000369510.8; ENST00000369509.1; ENST00000310260.7; ENST00000355485.7
External Link	RMBase: RNA-editing_site_8067
mod ID: A2ISITE010064		Click to Show/Hide the Full List
mod site	chr1:115694617-115694618:+		[3]
Sequence	CAGAAATTGATTACCTTGCCACTCCAACCTACGTACTGAGT
Transcript ID List	ENST00000355485.7; ENST00000369510.8
External Link	RMBase: RNA-editing_site_8068

5-methylcytidine (m5C)

In total 1 m6A sequence/site(s) in this target gene
mod ID: M5CSITE002978		Click to Show/Hide the Full List
mod site	chr1:115651403-115651404:+
Sequence	TCCTTCCTCAAGCGCAAGCCCTCCATTGCTATGGATACCGA
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000310260.7; ENST00000369509.1; ENST00000369510.8; ENST00000355485.7
External Link	RMBase: m5C_site_3155

N6-methyladenosine (m6A)

In total 69 m6A sequence/site(s) in this target gene
mod ID: M6ASITE044200		Click to Show/Hide the Full List
mod site	chr1:115642050-115642051:+		[4]
Sequence	CGGGGCCGCTGTGAGCCGAGACCGCGGGCCGCGGAGCTCGG
Motif Score	2.876744048
Cell/Tissue List	A549; HEK293T; MSC; iSLK; TIME
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000369510.8; rmsk_238012; ENST00000355485.7
External Link	RMBase: m6A_site_47032
mod ID: M6ASITE044201		Click to Show/Hide the Full List
mod site	chr1:115651372-115651373:+		[5]
Sequence	TTTTCTACCTCTAAGGAGAAACAGTACCTGCTCCTTCCTCA
Motif Score	2.20572619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000310260.7; ENST00000355485.7; ENST00000369510.8
External Link	RMBase: m6A_site_47033
mod ID: M6ASITE044202		Click to Show/Hide the Full List
mod site	chr1:115651478-115651479:+		[5]
Sequence	CATTCGAAAAAATCTCACAGACAAGGGTATGTAAGTTGTTC
Motif Score	2.897386905
Cell/Tissue List	HeLa; HepG2
Seq Type List	m6A-seq
Transcript ID List	ENST00000355485.7; ENST00000369510.8; ENST00000310260.7; ENST00000369509.1
External Link	RMBase: m6A_site_47034
mod ID: M6ASITE044209		Click to Show/Hide the Full List
mod site	chr1:115659647-115659648:+		[5]
Sequence	TGTTGTTTTTCAGGGAAAGAACTAGAGAGAGACACAAGTCA
Motif Score	3.373380952
Cell/Tissue List	HeLa; HepG2
Seq Type List	m6A-seq
Transcript ID List	ENST00000355485.7; ENST00000369509.1; ENST00000310260.7; ENST00000369510.8
External Link	RMBase: m6A_site_47035
mod ID: M6ASITE044220		Click to Show/Hide the Full List
mod site	chr1:115659658-115659659:+		[5]
Sequence	AGGGAAAGAACTAGAGAGAGACACAAGTCACCCCGGAATAA
Motif Score	2.897386905
Cell/Tissue List	HeLa; HepG2; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000310260.7; ENST00000369510.8; ENST00000369509.1; ENST00000355485.7
External Link	RMBase: m6A_site_47036
mod ID: M6ASITE044231		Click to Show/Hide the Full List
mod site	chr1:115659758-115659759:+		[5]
Sequence	TGGGAAATGATTCTACTCGGACAGAGGAAGTTCAGGTAAGG
Motif Score	3.643047619
Cell/Tissue List	HeLa; HepG2; HEK293T; U2OS; H1A; H1B; hESCs; fibroblasts; A549; Huh7; Jurkat; CD4T; peripheral-blood; HEK293A-TOA; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000355485.7; ENST00000369509.1; ENST00000310260.7; ENST00000369510.8
External Link	RMBase: m6A_site_47037
mod ID: M6ASITE044242		Click to Show/Hide the Full List
mod site	chr1:115663678-115663679:+		[5]
Sequence	AGGATGACAACTGGGGAGAGACCACCACGGCCATCACAGGC
Motif Score	2.876744048
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hESCs; fibroblasts; Huh7; Jurkat; CD4T; peripheral-blood; HEK293A-TOA; iSLK; TIME; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000310260.7; ENST00000355485.7; ENST00000369509.1; ENST00000369510.8
External Link	RMBase: m6A_site_47038
mod ID: M6ASITE044253		Click to Show/Hide the Full List
mod site	chr1:115663727-115663728:+		[5]
Sequence	GCACAGCATATCCCAAGAGGACATTGCCAGGATCAGCAAGG
Motif Score	3.643047619
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; hESC-HEK293T; U2OS; H1A; H1B; hESCs; fibroblasts; GM12878; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq; MAZTER-seq; m6A-CLIP/IP
Transcript ID List	ENST00000310260.7; ENST00000369510.8; ENST00000355485.7; ENST00000369509.1
External Link	RMBase: m6A_site_47039
mod ID: M6ASITE044264		Click to Show/Hide the Full List
mod site	chr1:115663748-115663749:+		[5]
Sequence	CATTGCCAGGATCAGCAAGGACATGGAGGACAGCGTGGGGC
Motif Score	3.643047619
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hESCs; fibroblasts; GM12878; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000310260.7; ENST00000355485.7; ENST00000369510.8; ENST00000369509.1
External Link	RMBase: m6A_site_47040
mod ID: M6ASITE044275		Click to Show/Hide the Full List
mod site	chr1:115663757-115663758:+		[5]
Sequence	GATCAGCAAGGACATGGAGGACAGCGTGGGGCTGGATTGCA
Motif Score	3.643047619
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; hESC-HEK293T; U2OS; H1A; H1B; hESCs; fibroblasts; GM12878; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq; MAZTER-seq
Transcript ID List	ENST00000355485.7; ENST00000369510.8; ENST00000310260.7; ENST00000369509.1
External Link	RMBase: m6A_site_47041
mod ID: M6ASITE044286		Click to Show/Hide the Full List
mod site	chr1:115663779-115663780:+		[6]
Sequence	AGCGTGGGGCTGGATTGCAAACGCTACCTGGGCCTCACCGT
Motif Score	2.179660714
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000310260.7; ENST00000369509.1; ENST00000355485.7; ENST00000369510.8
External Link	RMBase: m6A_site_47042
mod ID: M6ASITE044297		Click to Show/Hide the Full List
mod site	chr1:115663815-115663816:+		[5]
Sequence	ACCGTCGCCTCTTTTCTTGGACTTCTAGTTTTCCTCACCCC
Motif Score	4.065041667
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hESCs; fibroblasts; GM12878; H1299; Huh7; Jurkat; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000355485.7; ENST00000369509.1; ENST00000310260.7; ENST00000369510.8
External Link	RMBase: m6A_site_47043
mod ID: M6ASITE044308		Click to Show/Hide the Full List
mod site	chr1:115663932-115663933:+		[5]
Sequence	TTTATCTCCATGGCATTCAAACTCCTCATTCTGCTCATAGG
Motif Score	2.627720238
Cell/Tissue List	HeLa; HEK293T; A549; HepG2; U2OS; GM12878; HEK293A-TOA; iSLK; MSC; TIME; TREX; AML
Seq Type List	m6A-seq; MeRIP-seq; DART-seq; miCLIP
Transcript ID List	ENST00000369510.8; ENST00000310260.7; ENST00000355485.7; ENST00000369509.1
External Link	RMBase: m6A_site_47044
mod ID: M6ASITE044319		Click to Show/Hide the Full List
mod site	chr1:115663954-115663955:+		[5]
Sequence	TCCTCATTCTGCTCATAGGGACCTGGGCACTTTTTTTCCGC
Motif Score	3.622404762
Cell/Tissue List	HeLa; HEK293T; A549; HepG2; U2OS; GM12878; HEK293A-TOA; iSLK; MSC; TIME; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000355485.7; ENST00000310260.7; ENST00000369510.8; ENST00000369509.1
External Link	RMBase: m6A_site_47045
mod ID: M6ASITE044330		Click to Show/Hide the Full List
mod site	chr1:115663988-115663989:+		[6]
Sequence	TTTCCGCAAGCGGAGAGCTGACATGCCACGGGTGTTTGTGT
Motif Score	2.859755952
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000355485.7; ENST00000369510.8; ENST00000369509.1; ENST00000310260.7
External Link	RMBase: m6A_site_47046
mod ID: M6ASITE044341		Click to Show/Hide the Full List
mod site	chr1:115664066-115664067:+		[6]
Sequence	GGTTTCCTATTGGCTTTTTTACGGGGTCCGCATTTTGGACT
Motif Score	2.046785714
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000355485.7; ENST00000369509.1; ENST00000310260.7; ENST00000369510.8
External Link	RMBase: m6A_site_47047
mod ID: M6ASITE044352		Click to Show/Hide the Full List
mod site	chr1:115664084-115664085:+		[5]
Sequence	TTACGGGGTCCGCATTTTGGACTCTCGGGACCGGAATTACC
Motif Score	4.065041667
Cell/Tissue List	HeLa; iSLK; MSC; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000369510.8; ENST00000369509.1; ENST00000310260.7; ENST00000355485.7
External Link	RMBase: m6A_site_47048
mod ID: M6ASITE044361		Click to Show/Hide the Full List
mod site	chr1:115664093-115664094:+		[5]
Sequence	CCGCATTTTGGACTCTCGGGACCGGAATTACCAGGGCATTG
Motif Score	3.622404762
Cell/Tissue List	HeLa; A549; iSLK; MSC; TREX
Seq Type List	m6A-seq; m6A-CLIP/IP; MeRIP-seq
Transcript ID List	ENST00000310260.7; ENST00000355485.7; ENST00000369510.8; ENST00000369509.1
External Link	RMBase: m6A_site_47049
mod ID: M6ASITE044362		Click to Show/Hide the Full List
mod site	chr1:115671121-115671122:+		[5]
Sequence	TTGCGCCCGGAGCCCAGAGGACTCACAGGAAAAGGAGCTGG
Motif Score	4.065041667
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000310260.7; ENST00000369510.8; ENST00000369509.1; ENST00000478369.5; ENST00000355485.7
External Link	RMBase: m6A_site_47050
mod ID: M6ASITE044363		Click to Show/Hide the Full List
mod site	chr1:115682485-115682486:+		[7]
Sequence	TATGGCCGGGCTGAAAGTCTACAATGTAGATGGTATGTGCC
Motif Score	2.078666667
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000355485.7; ENST00000478369.5; ENST00000369509.1; ENST00000474344.1; ENST00000369510.8; ENST00000310260.7
External Link	RMBase: m6A_site_47051
mod ID: M6ASITE044364		Click to Show/Hide the Full List
mod site	chr1:115683952-115683953:+		[7]
Sequence	TTTCCCCAAAGGCCCCAGTAACAATGCCACTGGCCAGTCCC
Motif Score	2.168095238
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000369510.8; ENST00000369509.1; ENST00000355485.7; ENST00000478369.5; ENST00000310260.7; ENST00000474344.1
External Link	RMBase: m6A_site_47052
mod ID: M6ASITE044365		Click to Show/Hide the Full List
mod site	chr1:115684006-115684007:+		[5]
Sequence	TGCAGCTGCTCGGCGCAGGGACTCAAGCCACAACGAGTTGT
Motif Score	4.065041667
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000369510.8; ENST00000355485.7; ENST00000474344.1; ENST00000369509.1; ENST00000478369.5; ENST00000310260.7
External Link	RMBase: m6A_site_47053
mod ID: M6ASITE044366		Click to Show/Hide the Full List
mod site	chr1:115684015-115684016:+		[7]
Sequence	TCGGCGCAGGGACTCAAGCCACAACGAGTTGTATTATGAAG
Motif Score	2.053113095
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000355485.7; ENST00000310260.7; ENST00000369510.8; ENST00000369509.1; ENST00000478369.5; ENST00000474344.1
External Link	RMBase: m6A_site_47054
mod ID: M6ASITE044367		Click to Show/Hide the Full List
mod site	chr1:115684043-115684044:+		[5]
Sequence	TTGTATTATGAAGAGGCCGAACATGAACGGCGAGTAAAGAA
Motif Score	2.951386905
Cell/Tissue List	HeLa; hESC-HEK293T
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000369509.1; ENST00000355485.7; ENST00000369510.8; ENST00000478369.5; ENST00000474344.1; ENST00000310260.7
External Link	RMBase: m6A_site_47055
mod ID: M6ASITE044368		Click to Show/Hide the Full List
mod site	chr1:115684049-115684050:+		[6]
Sequence	TATGAAGAGGCCGAACATGAACGGCGAGTAAAGAAGCGGAA
Motif Score	2.925321429
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000310260.7; ENST00000478369.5; ENST00000369509.1; ENST00000369510.8; ENST00000355485.7; ENST00000474344.1
External Link	RMBase: m6A_site_47056
mod ID: M6ASITE044369		Click to Show/Hide the Full List
mod site	chr1:115685324-115685325:+		[7]
Sequence	AGTGGAAGAGGCCTTCATCCACATTCAGCGTCTCCAGGCTG
Motif Score	2.053113095
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000369509.1; ENST00000369510.8; ENST00000355485.7; ENST00000310260.7
External Link	RMBase: m6A_site_47057
mod ID: M6ASITE044370		Click to Show/Hide the Full List
mod site	chr1:115685378-115685379:+		[5]
Sequence	AGCCCCAGGGGAGGTGATGGACCCTAGGGAGGCCGCCCAGG
Motif Score	3.622404762
Cell/Tissue List	HeLa; U2OS; Jurkat; peripheral-blood; iSLK; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000369509.1; ENST00000355485.7; ENST00000369510.8; ENST00000310260.7
External Link	RMBase: m6A_site_47058
mod ID: M6ASITE044371		Click to Show/Hide the Full List
mod site	chr1:115685459-115685460:+		[5]
Sequence	GCGCATCACCCGGCAGCAGAACTACCACAGCATGGAGAGCA
Motif Score	3.373380952
Cell/Tissue List	HeLa; HEK293T; HepG2; U2OS; GM12878; Huh7; Jurkat; peripheral-blood; HEK293A-TOA; iSLK; TREX; MSC; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000369510.8; ENST00000310260.7; ENST00000355485.7; ENST00000369509.1
External Link	RMBase: m6A_site_47059
mod ID: M6ASITE044372		Click to Show/Hide the Full List
mod site	chr1:115685518-115685519:+		[6]
Sequence	TCTGCATCACCAACGGCATGACCCCCAAGGTGCGCTGCTCC
Motif Score	2.839113095
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000310260.7; ENST00000355485.7; ENST00000369509.1; ENST00000369510.8
External Link	RMBase: m6A_site_47060
mod ID: M6ASITE044373		Click to Show/Hide the Full List
mod site	chr1:115691164-115691165:+		[7]
Sequence	GGGCCCCACCCTGCAATATGACAAGGACCGCTGGCTCTCTA
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000310260.7; ENST00000355485.7; ENST00000369509.1; ENST00000369510.8
External Link	RMBase: m6A_site_47061
mod ID: M6ASITE044374		Click to Show/Hide the Full List
mod site	chr1:115691170-115691171:+		[5]
Sequence	CACCCTGCAATATGACAAGGACCGCTGGCTCTCTACACAGT
Motif Score	3.622404762
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; H1B; hESCs; fibroblasts; GM12878; Jurkat; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000310260.7; ENST00000369510.8; ENST00000369509.1; ENST00000355485.7
External Link	RMBase: m6A_site_47062
mod ID: M6ASITE044375		Click to Show/Hide the Full List
mod site	chr1:115691184-115691185:+		[7]
Sequence	ACAAGGACCGCTGGCTCTCTACACAGTGGAGGCTTGTCAGT
Motif Score	2.078666667
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000355485.7; ENST00000369510.8; ENST00000310260.7; ENST00000369509.1
External Link	RMBase: m6A_site_47063
mod ID: M6ASITE044376		Click to Show/Hide the Full List
mod site	chr1:115691263-115691264:+		[5]
Sequence	GTTCGTCCTTAAGTGCTTGGACTTCAGCCTCGTAGTCAATG
Motif Score	4.065041667
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; Huh7; Jurkat; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000369510.8; ENST00000369509.1; ENST00000310260.7; ENST00000355485.7
External Link	RMBase: m6A_site_47064
mod ID: M6ASITE044377		Click to Show/Hide the Full List
mod site	chr1:115691326-115691327:+		[5]
Sequence	ACTCTCTGAAGAGTTCATAGACCCCAAATCTCACAAATTTG
Motif Score	2.876744048
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; H1B; hNPCs; hESCs; fibroblasts; GM12878; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000369509.1; ENST00000310260.7; ENST00000369510.8; ENST00000355485.7
External Link	RMBase: m6A_site_47065
mod ID: M6ASITE044378		Click to Show/Hide the Full List
mod site	chr1:115691338-115691339:+		[7]
Sequence	GTTCATAGACCCCAAATCTCACAAATTTGTCCTTCGCTTAC
Motif Score	2.047297619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000355485.7; ENST00000369509.1; ENST00000310260.7; ENST00000369510.8
External Link	RMBase: m6A_site_47066
mod ID: M6ASITE044379		Click to Show/Hide the Full List
mod site	chr1:115691367-115691368:+		[5]
Sequence	TCCTTCGCTTACAGTCTGAGACATCCGTTTAAAAGTTCTAT
Motif Score	2.897386905
Cell/Tissue List	HeLa; HEK293T; A549; HepG2; U2OS; hNPCs; hESCs; fibroblasts; GM12878; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000369509.1; ENST00000310260.7; ENST00000355485.7; ENST00000369510.8
External Link	RMBase: m6A_site_47067
mod ID: M6ASITE044380		Click to Show/Hide the Full List
mod site	chr1:115691489-115691490:+		[5]
Sequence	CTTCTTCATTGCTGACTGAAACTGGCAGATGATTGACCAGT
Motif Score	2.627720238
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hESCs; fibroblasts; GM12878; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000369509.1; ENST00000310260.7; ENST00000355485.7; ENST00000369510.8
External Link	RMBase: m6A_site_47068
mod ID: M6ASITE044381		Click to Show/Hide the Full List
mod site	chr1:115691580-115691581:+		[7]
Sequence	CTGAAAAAGAGTGACTGATGACATCTGACTTTTGTCGATGG
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T; A549
Seq Type List	MAZTER-seq; m6A-CLIP/IP
Transcript ID List	ENST00000355485.7; ENST00000369509.1; ENST00000369510.8; ENST00000310260.7
External Link	RMBase: m6A_site_47069
mod ID: M6ASITE044382		Click to Show/Hide the Full List
mod site	chr1:115691587-115691588:+		[8]
Sequence	AGAGTGACTGATGACATCTGACTTTTGTCGATGGGACTTCT
Motif Score	3.28175
Cell/Tissue List	A549
Seq Type List	m6A-CLIP/IP
Transcript ID List	ENST00000310260.7; ENST00000369509.1; ENST00000369510.8; ENST00000355485.7
External Link	RMBase: m6A_site_47070
mod ID: M6ASITE044383		Click to Show/Hide the Full List
mod site	chr1:115691602-115691603:+		[5]
Sequence	ATCTGACTTTTGTCGATGGGACTTCTCAAGAAGCCATTCCT
Motif Score	4.065041667
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; Huh7; Jurkat; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List	ENST00000369510.8; ENST00000310260.7; ENST00000355485.7; ENST00000369509.1
External Link	RMBase: m6A_site_47071
mod ID: M6ASITE044384		Click to Show/Hide the Full List
mod site	chr1:115691646-115691647:+		[5]
Sequence	AGCTTCTGTTACAGCTGTAAACCAAAGTGGAGCTGGTGCTT
Motif Score	2.185083333
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; Huh7; Jurkat; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000355485.7; ENST00000369509.1; ENST00000310260.7; ENST00000369510.8
External Link	RMBase: m6A_site_47072
mod ID: M6ASITE044385		Click to Show/Hide the Full List
mod site	chr1:115691684-115691685:+		[7]
Sequence	CTTCTTGGGAGCCTCGCCTTACAACTAATTCCTGCCTTTCG
Motif Score	2.07285119
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000369510.8; ENST00000369509.1; ENST00000355485.7; ENST00000310260.7
External Link	RMBase: m6A_site_47073
mod ID: M6ASITE044386		Click to Show/Hide the Full List
mod site	chr1:115691749-115691750:+		[5]
Sequence	TCTGGTCAGCCCACTTGTAGACTTCCAGGGGACACATCTTT
Motif Score	3.319380952
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; H1B; hNPCs; hESCs; fibroblasts; GM12878; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000369509.1; ENST00000355485.7; ENST00000369510.8; ENST00000310260.7
External Link	RMBase: m6A_site_47074
mod ID: M6ASITE044390		Click to Show/Hide the Full List
mod site	chr1:115691760-115691761:+		[9]
Sequence	CACTTGTAGACTTCCAGGGGACACATCTTTATTCTGTTTCA
Motif Score	3.643047619
Cell/Tissue List	HEK293T; HeLa; A549; hESC-HEK293T; HepG2; U2OS; hNPCs; hESCs; fibroblasts; GM12878; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A
Seq Type List	MeRIP-seq; MAZTER-seq; m6A-seq
Transcript ID List	ENST00000355485.7; ENST00000369510.8; ENST00000369509.1; ENST00000310260.7
External Link	RMBase: m6A_site_47075
mod ID: M6ASITE044401		Click to Show/Hide the Full List
mod site	chr1:115691785-115691786:+		[9]
Sequence	TCTTTATTCTGTTTCAGGAAACCAGTCACGACACGTCCACA
Motif Score	2.185083333
Cell/Tissue List	HEK293T; HeLa; A549; HepG2; U2OS; hESCs; fibroblasts; GM12878; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000310260.7; ENST00000355485.7; ENST00000369509.1; ENST00000369510.8
External Link	RMBase: m6A_site_47076
mod ID: M6ASITE044412		Click to Show/Hide the Full List
mod site	chr1:115691837-115691838:+		[7]
Sequence	GTATGTTAATGTCCAGTATCACATCACCCATGAAAGTCGTG
Motif Score	2.047297619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000355485.7; ENST00000369510.8; ENST00000310260.7; ENST00000369509.1
External Link	RMBase: m6A_site_47077
mod ID: M6ASITE044418		Click to Show/Hide the Full List
mod site	chr1:115691924-115691925:+		[7]
Sequence	AGGTTCTTCAGAGAAAGATCACAACAAAAAATGTACACTGT
Motif Score	2.047297619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000369510.8; ENST00000355485.7
External Link	RMBase: m6A_site_47078
mod ID: M6ASITE044419		Click to Show/Hide the Full List
mod site	chr1:115691994-115691995:+		[5]
Sequence	GTTTTTTTCCCAAAGAGAAAACCTACCTGCCCTGTTTCTGA
Motif Score	2.185083333
Cell/Tissue List	HeLa; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000355485.7; ENST00000369510.8
External Link	RMBase: m6A_site_47079
mod ID: M6ASITE044420		Click to Show/Hide the Full List
mod site	chr1:115692312-115692313:+		[7]
Sequence	ACACCAACCAGGGGAGACTAACACTGTGACTCTGGGATTGG
Motif Score	2.168095238
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000355485.7; ENST00000369510.8
External Link	RMBase: m6A_site_47080
mod ID: M6ASITE044421		Click to Show/Hide the Full List
mod site	chr1:115692413-115692414:+		[10]
Sequence	AAGCTGCCCTGCCAAAGGAGACCAAACCATGCCAACCACGC
Motif Score	2.876744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000369510.8; ENST00000355485.7
External Link	RMBase: m6A_site_47081
mod ID: M6ASITE044422		Click to Show/Hide the Full List
mod site	chr1:115692418-115692419:+		[10]
Sequence	GCCCTGCCAAAGGAGACCAAACCATGCCAACCACGCTGGCA
Motif Score	2.185083333
Cell/Tissue List	HEK293T; HeLa
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000369510.8; ENST00000355485.7
External Link	RMBase: m6A_site_47082
mod ID: M6ASITE044423		Click to Show/Hide the Full List
mod site	chr1:115692509-115692510:+		[10]
Sequence	CATCGCCTCTGCCACTTAGGACCAGGAAAGAGGCTGGTTTT
Motif Score	3.622404762
Cell/Tissue List	HEK293T; HeLa
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000369510.8; ENST00000355485.7
External Link	RMBase: m6A_site_47083
mod ID: M6ASITE044424		Click to Show/Hide the Full List
mod site	chr1:115692574-115692575:+		[7]
Sequence	AGTGGGGAGAAGGAAAATGGACACTCTACAGAGTTTGGGGA
Motif Score	3.643047619
Cell/Tissue List	HEK293T; hESC-HEK293T; HeLa; fibroblasts; A549
Seq Type List	MeRIP-seq; MAZTER-seq; m6A-seq; m6A-CLIP/IP
Transcript ID List	ENST00000355485.7; ENST00000369510.8
External Link	RMBase: m6A_site_47084
mod ID: M6ASITE044425		Click to Show/Hide the Full List
mod site	chr1:115692652-115692653:+		[5]
Sequence	ATCTGTGGTCTGTCTGTTAAACACAGCTGATTTCAGTGGGC
Motif Score	2.20572619
Cell/Tissue List	HeLa; HEK293A-TOA
Seq Type List	m6A-seq
Transcript ID List	ENST00000369510.8; ENST00000355485.7
External Link	RMBase: m6A_site_47085
mod ID: M6ASITE044426		Click to Show/Hide the Full List
mod site	chr1:115692697-115692698:+		[5]
Sequence	CCCTGGCCCTGGGGGAGCAGACACTGACTGGGTTGTGGGCA
Motif Score	2.897386905
Cell/Tissue List	HeLa; H1A; H1B; HEK293A-TOA
Seq Type List	m6A-seq
Transcript ID List	ENST00000355485.7; ENST00000369510.8
External Link	RMBase: m6A_site_47086
mod ID: M6ASITE044427		Click to Show/Hide the Full List
mod site	chr1:115692776-115692777:+		[5]
Sequence	CCTTCAGGAGCCCCATCCGGACCTCTTGCACTGGGCTGCCT
Motif Score	3.622404762
Cell/Tissue List	HeLa; H1A; H1B; iSLK
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000369510.8; ENST00000355485.7
External Link	RMBase: m6A_site_47087
mod ID: M6ASITE044428		Click to Show/Hide the Full List
mod site	chr1:115692830-115692831:+		[11]
Sequence	CCTTCCTGTATCTGCAACAAACCTTTTAAAAGTGTTCACTC
Motif Score	2.185083333
Cell/Tissue List	H1B; iSLK
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000355485.7; ENST00000369510.8
External Link	RMBase: m6A_site_47088
mod ID: M6ASITE044429		Click to Show/Hide the Full List
mod site	chr1:115693027-115693028:+		[7]
Sequence	TGGCTTTGGATCTTTGTAATACACCTGTACCTGAAAAAGTA
Motif Score	2.110482143
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000369510.8; ENST00000355485.7
External Link	RMBase: m6A_site_47089
mod ID: M6ASITE044430		Click to Show/Hide the Full List
mod site	chr1:115693086-115693087:+		[7]
Sequence	CTAGCCTTCAGCTTGAAAAGACATGCTGGAGAAGAAGGAAG
Motif Score	2.897386905
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000355485.7; ENST00000369510.8
External Link	RMBase: m6A_site_47090
mod ID: M6ASITE044431		Click to Show/Hide the Full List
mod site	chr1:115693174-115693175:+		[7]
Sequence	TGTGTTTCTGTTTATAAAAAACACATACCATGGAACCATGG
Motif Score	2.20572619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000355485.7; ENST00000369510.8
External Link	RMBase: m6A_site_47091
mod ID: M6ASITE044432		Click to Show/Hide the Full List
mod site	chr1:115693176-115693177:+		[6]
Sequence	TGTTTCTGTTTATAAAAAACACATACCATGGAACCATGGTG
Motif Score	2.084928571
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000355485.7; ENST00000369510.8
External Link	RMBase: m6A_site_47092
mod ID: M6ASITE044433		Click to Show/Hide the Full List
mod site	chr1:115693579-115693580:+		[7]
Sequence	TTTGCATAGGAGAATGTTAGACATTCAGAAATTACTGTTTC
Motif Score	2.897386905
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000369510.8; ENST00000355485.7
External Link	RMBase: m6A_site_47093
mod ID: M6ASITE044434		Click to Show/Hide the Full List
mod site	chr1:115693991-115693992:+		[5]
Sequence	AGAGCATTGAGTGTTAAAGAACTTAATGAGGAGTCTATATC
Motif Score	3.373380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000369510.8; ENST00000355485.7
External Link	RMBase: m6A_site_47094
mod ID: M6ASITE044439		Click to Show/Hide the Full List
mod site	chr1:115694803-115694804:+		[7]
Sequence	TGTATTACCAGACGGATAGCACATTTATATGTCAGACATCT
Motif Score	2.830589286
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000355485.7; ENST00000369510.8
External Link	RMBase: m6A_site_47095
mod ID: M6ASITE044450		Click to Show/Hide the Full List
mod site	chr1:115695017-115695018:+		[7]
Sequence	TTTATTCCTTTCCCTCACTGACACTGGCTTCTCCCGCTAGA
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000369510.8; ENST00000355485.7
External Link	RMBase: m6A_site_47096
mod ID: M6ASITE044461		Click to Show/Hide the Full List
mod site	chr1:115695053-115695054:+		[12]
Sequence	CTAGAGTAAATGGCTTTAGCACAGCACTGTCTTCTGGGGAG
Motif Score	2.830589286
Cell/Tissue List	kidney
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000369510.8; ENST00000355485.7
External Link	RMBase: m6A_site_47097
mod ID: M6ASITE044472		Click to Show/Hide the Full List
mod site	chr1:115695223-115695224:+		[6]
Sequence	ACTAGATATTTCTTAAGGTAACTTAAAAATTGGGCTTTATT
Motif Score	2.590089286
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000355485.7; ENST00000369510.8
External Link	RMBase: m6A_site_47098
mod ID: M6ASITE044483		Click to Show/Hide the Full List
mod site	chr1:115695522-115695523:+		[7]
Sequence	AGCGAAATGAGATAGTTTAGACACTGTTGAAATAACTGCAT
Motif Score	2.897386905
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000369510.8; ENST00000355485.7
External Link	RMBase: m6A_site_47099
mod ID: M6ASITE044494		Click to Show/Hide the Full List
mod site	chr1:115695587-115695588:+		[7]
Sequence	AGAAAATTCAGTTTTGGATCACATTTTGACAAAACATGTTT
Motif Score	2.047297619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000369510.8; ENST00000355485.7
External Link	RMBase: m6A_site_47100

Pseudouridine (Pseudo)

In total 1 m6A sequence/site(s) in this target gene
mod ID: PSESITE000146		Click to Show/Hide the Full List
mod site	chr1:115682409-115682410:+		[13]
Sequence	TAGAAAATTACTACAAAGATTTCACCATCTATAACCCAAAC
Transcript ID List	ENST00000355485.7; ENST00000474344.1; ENST00000369509.1; ENST00000369510.8; ENST00000478369.5; ENST00000310260.7
External Link	RMBase: Pseudo_site_277

Ref 1	Up-regulation of VANGL1 by IGF2BPs and miR-29b-3p attenuates the detrimental effect of irradiation on lung adenocarcinoma. J Exp Clin Cancer Res. 2020 Nov 23;39(1):256. doi: 10.1186/s13046-020-01772-y.
Ref 2	RADAR: a rigorously annotated database of A-to-I RNA editing. Nucleic Acids Res. 2014 Jan;42(Database issue):D109-13. doi: 10.1093/nar/gkt996. Epub 2013 Oct 25.
Ref 3	Accurate identification of A-to-I RNA editing in human by transcriptome sequencing. Genome Res. 2012 Jan;22(1):142-50. doi: 10.1101/gr.124107.111. Epub 2011 Sep 29.
Ref 4	Perturbation of m6A writers reveals two distinct classes of mRNA methylation at internal and 5' sites. Cell Rep. 2014 Jul 10;8(1):284-96. doi: 10.1016/j.celrep.2014.05.048. Epub 2014 Jun 26.
Ref 5	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 6	DART-seq: an antibody-free method for global m(6)A detection. Nat Methods. 2019 Dec;16(12):1275-1280. doi: 10.1038/s41592-019-0570-0. Epub 2019 Sep 23.
Ref 7	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.
Ref 8	A majority of m6A residues are in the last exons, allowing the potential for 3' UTR regulation. Genes Dev. 2015 Oct 1;29(19):2037-53. doi: 10.1101/gad.269415.115. Epub 2015 Sep 24.
Ref 9	Viral N(6)-methyladenosine upregulates replication and pathogenesis of human respiratory syncytial virus. Nat Commun. 2019 Oct 9;10(1):4595. doi: 10.1038/s41467-019-12504-y.
Ref 10	N6-methyladenosine-dependent regulation of messenger RNA stability. Nature. 2014 Jan 2;505(7481):117-20. doi: 10.1038/nature12730. Epub 2013 Nov 27.
Ref 11	m(6)A RNA modification controls cell fate transition in mammalian embryonic stem cells. Cell Stem Cell. 2014 Dec 4;15(6):707-19. doi: 10.1016/j.stem.2014.09.019. Epub 2014 Oct 16.
Ref 12	Single-base mapping of m(6)A by an antibody-independent method. Sci Adv. 2019 Jul 3;5(7):eaax0250. doi: 10.1126/sciadv.aax0250. eCollection 2019 Jul.
Ref 13	Chemical pulldown reveals dynamic pseudouridylation of the mammalian transcriptome. Nat Chem Biol. 2015 Aug;11(8):592-7. doi: 10.1038/nchembio.1836. Epub 2015 Jun 15.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map