General Information of the m6A Target Gene (ID: M6ATAR00441)
Target Name Ubiquitin carboxyl-terminal hydrolase 7 (USP7)
Synonyms
Deubiquitinating enzyme 7; Herpesvirus-associated ubiquitin-specific protease; Ubiquitin thioesterase 7; Ubiquitin-specific-processing protease 7; HAUSP
    Click to Show/Hide
Gene Name USP7
Chromosomal Location 16p13.2
Family peptidase C19 family
Function
Hydrolase that deubiquitinates target proteins such as FOXO4, KAT5, p53/TP53, MDM2, ERCC6, DNMT1, UHRF1, PTEN, KMT2E/MLL5 and DAXX. Together with DAXX, prevents MDM2 self-ubiquitination and enhances the E3 ligase activity of MDM2 towards p53/TP53, thereby promoting p53/TP53 ubiquitination and proteasomal degradation. Deubiquitinates p53/TP53, preventing degradation of p53/TP53, and enhances p53/TP53-dependent transcription regulation, cell growth repression and apoptosis. Deubiquitinates p53/TP53 and MDM2 and strongly stabilizes p53/TP53 even in the presence of excess MDM2, and also induces p53/TP53-dependent cell growth repression and apoptosis. Deubiquitination of FOXO4 in presence of hydrogen peroxide is not dependent on p53/TP53 and inhibits FOXO4-induced transcriptional activity. In association with DAXX, is involved in the deubiquitination and translocation of PTEN from the nucleus to the cytoplasm, both processes that are counteracted by PML. Deubiquitinates KMT2E/MLL5 preventing KMT2E/MLL5 proteasomal-mediated degradation. Involved in cell proliferation during early embryonic development. Involved in transcription-coupled nucleotide excision repair (TC-NER) in response to UV damage: recruited to DNA damage sites following interaction with KIAA1530/UVSSA and promotes deubiquitination of ERCC6, preventing UV-induced degradation of ERCC6. Involved in maintenance of DNA methylation via its interaction with UHRF1 and DNMT1: acts by mediating deubiquitination of UHRF1 and DNMT1, preventing their degradation and promoting DNA methylation by DNMT1. Deubiquitinates alkylation repair enzyme ALKBH3. OTUD4 recruits USP7 and USP9X to stabilize ALKBH3, thereby promoting the repair of alkylated DNA lesions. Acts as a chromatin regulator via its association with the Polycomb group (PcG) multiprotein PRC1-like complex; may act by deubiquitinating components of the PRC1-like complex. Able to mediate deubiquitination of histone H2B; it is however unsure whether this activity takes place in vivo. Exhibits a preference towards 'Lys-48'-linked ubiquitin chains. Increases regulatory T-cells (Treg) suppressive capacity by deubiquitinating and stabilizing the transcription factor FOXP3 which is crucial for Treg cell function. Plays a role in the maintenance of the circadian clock periodicity via deubiquitination and stabilization of the CRY1 and CRY2 proteins. Deubiquitinates REST, thereby stabilizing REST and promoting the maintenance of neural progenitor cells. Deubiquitinates SIRT7, inhibiting SIRT7 histone deacetylase activity and regulating gluconeogenesis.; (Microbial infection) Contributes to the overall stabilization and trans-activation capability of the herpesvirus 1 trans-acting transcriptional protein ICP0/VMW110 during HSV-1 infection.
    Click to Show/Hide
Gene ID 7874
Uniprot ID
UBP7_HUMAN
HGNC ID
HGNC:12630
KEGG ID
hsa:7874
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
USP7 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Browse Drug
Methyltransferase-like 3 (METTL3) [WRITER]
Representative RNA-seq result indicating the expression of this target gene regulated by METTL3
Cell Line Liver Mus musculus
Treatment: Mettl3 knockout liver
Control: Wild type liver cells
GSE198513
Regulation
logFC: -7.46E-01
p-value: 2.02E-26
More Results Click to View More RNA-seq Results
In total 2 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary METTL3 regulates the expression of Ubiquitin carboxyl-terminal hydrolase 7 (USP7) through m6A methylation and facilitate the invasion, migration and proliferation of HCC cells. Besides, the elevated METTL3 expression was related to worse overall survival.
Target Regulation Up regulation
Responsed Disease Hepatocellular carcinoma ICD-11: 2C12.02
Cell Process Cell invasion
Cell migration
Cell proliferation
In-vitro Model MHCC97-L Adult hepatocellular carcinoma Homo sapiens CVCL_4973
L-02 Endocervical adenocarcinoma Homo sapiens CVCL_6926
Huh-7 Adult hepatocellular carcinoma Homo sapiens CVCL_0336
Hep 3B2.1-7 Childhood hepatocellular carcinoma Homo sapiens CVCL_0326
HCCLM3 Adult hepatocellular carcinoma Homo sapiens CVCL_6832
In-vivo Model Male nu/nu mice between 4 and 6 weeks of age received subcutaneous injections of equivalent Hep3B cells expressing either LV-shMETTL3 or LV-USP7 within 30 min of harvesting on the right and left flanks. The tumor was weighed after approximately 4 weeks, and the volume was measured every 5 days.
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene [2]
Response Summary Ubiquitin carboxyl-terminal hydrolase 7 (USP7) was upregulated in HCC and associated with METTL3 level positively. USP7 silencing decreased proliferation, migration, and invasion rates of HCC cells. METTL3 promotes HCC to proliferate, migrate, and invade by regulating m6A methylation of USP7.
Target Regulation Up regulation
Responsed Disease Hepatocellular carcinoma ICD-11: 2C12.02
Cell Process Cell proliferate
Cell migrate
Cell invade
In-vitro Model MHCC97-L Adult hepatocellular carcinoma Homo sapiens CVCL_4973
L-02 Endocervical adenocarcinoma Homo sapiens CVCL_6926
Huh-7 Adult hepatocellular carcinoma Homo sapiens CVCL_0336
Hep 3B2.1-7 Childhood hepatocellular carcinoma Homo sapiens CVCL_0326
HCCLM3 Adult hepatocellular carcinoma Homo sapiens CVCL_6832
Fat mass and obesity-associated protein (FTO) [ERASER]
In total 2 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [3]
Response Summary The m6A demethylase FTO promotes the growth of Non-small cell lung cancer cells by increasing the expression of USP7.Genetic knockdown or pharmacological inhibition (P5091 or P22027) of Ubiquitin carboxyl-terminal hydrolase 7 (USP7) reduced the proliferation rate of lung cancer cells and decreased the capacity of colony formation of lung cancer cells in vitro, whereas lung cancer cells growth inhibition by FTO knockdown is restored by overexertion of USP7.
Target Regulation Up regulation
Responsed Disease Non-small-cell lung carcinoma ICD-11: 2C25.Y
Responsed Drug P22077 Investigative
Cell Process Ubiquitination degradation
In-vitro Model A-549 Lung adenocarcinoma Homo sapiens CVCL_0023
NCI-H522 Lung adenocarcinoma Homo sapiens CVCL_1567
HSAEC (Human small airway epithelial cells)
RERF-LC-A1 Lung squamous cell carcinoma Homo sapiens CVCL_4402
NCI-H1882 Lung small cell carcinoma Homo sapiens CVCL_1504
NCl-H466 (Human lung cancer cell line)
In-vivo Model Equal numbers of A549 cells expressing either control or shFTO were injected subcutaneously, within 30 min of harvesting, over the right and left flanks in male nu/nu mice between 4 and 6 weeks of age.
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene [3]
Response Summary The m6A demethylase FTO promotes the growth of Non-small cell lung cancer cells by increasing the expression of USP7.Genetic knockdown or pharmacological inhibition (P5091 or P22027) of Ubiquitin carboxyl-terminal hydrolase 7 (USP7) reduced the proliferation rate of lung cancer cells and decreased the capacity of colony formation of lung cancer cells in vitro, whereas lung cancer cells growth inhibition by FTO knockdown is restored by overexertion of USP7.
Target Regulation Up regulation
Responsed Disease Non-small-cell lung carcinoma ICD-11: 2C25.Y
Responsed Drug P5091 Investigative
Cell Process Ubiquitination degradation
In-vitro Model A-549 Lung adenocarcinoma Homo sapiens CVCL_0023
NCI-H522 Lung adenocarcinoma Homo sapiens CVCL_1567
HSAEC (Human small airway epithelial cells)
RERF-LC-A1 Lung squamous cell carcinoma Homo sapiens CVCL_4402
NCI-H1882 Lung small cell carcinoma Homo sapiens CVCL_1504
NCl-H466 (Human lung cancer cell line)
In-vivo Model Equal numbers of A549 cells expressing either control or shFTO were injected subcutaneously, within 30 min of harvesting, over the right and left flanks in male nu/nu mice between 4 and 6 weeks of age.
Liver cancer [ICD-11: 2C12]
In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [1]
Response Summary METTL3 regulates the expression of Ubiquitin carboxyl-terminal hydrolase 7 (USP7) through m6A methylation and facilitate the invasion, migration and proliferation of HCC cells. Besides, the elevated METTL3 expression was related to worse overall survival.
Responsed Disease Hepatocellular carcinoma [ICD-11: 2C12.02]
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
Target Regulation Up regulation
Cell Process Cell invasion
Cell migration
Cell proliferation
In-vitro Model MHCC97-L Adult hepatocellular carcinoma Homo sapiens CVCL_4973
L-02 Endocervical adenocarcinoma Homo sapiens CVCL_6926
Huh-7 Adult hepatocellular carcinoma Homo sapiens CVCL_0336
Hep 3B2.1-7 Childhood hepatocellular carcinoma Homo sapiens CVCL_0326
HCCLM3 Adult hepatocellular carcinoma Homo sapiens CVCL_6832
In-vivo Model Male nu/nu mice between 4 and 6 weeks of age received subcutaneous injections of equivalent Hep3B cells expressing either LV-shMETTL3 or LV-USP7 within 30 min of harvesting on the right and left flanks. The tumor was weighed after approximately 4 weeks, and the volume was measured every 5 days.
Experiment 2 Reporting the m6A-centered Disease Response [2]
Response Summary Ubiquitin carboxyl-terminal hydrolase 7 (USP7) was upregulated in HCC and associated with METTL3 level positively. USP7 silencing decreased proliferation, migration, and invasion rates of HCC cells. METTL3 promotes HCC to proliferate, migrate, and invade by regulating m6A methylation of USP7.
Responsed Disease Hepatocellular carcinoma [ICD-11: 2C12.02]
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
Target Regulation Up regulation
Cell Process Cell proliferate
Cell migrate
Cell invade
In-vitro Model MHCC97-L Adult hepatocellular carcinoma Homo sapiens CVCL_4973
L-02 Endocervical adenocarcinoma Homo sapiens CVCL_6926
Huh-7 Adult hepatocellular carcinoma Homo sapiens CVCL_0336
Hep 3B2.1-7 Childhood hepatocellular carcinoma Homo sapiens CVCL_0326
HCCLM3 Adult hepatocellular carcinoma Homo sapiens CVCL_6832
Lung cancer [ICD-11: 2C25]
In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [3]
Response Summary The m6A demethylase FTO promotes the growth of Non-small cell lung cancer cells by increasing the expression of USP7.Genetic knockdown or pharmacological inhibition (P5091 or P22027) of Ubiquitin carboxyl-terminal hydrolase 7 (USP7) reduced the proliferation rate of lung cancer cells and decreased the capacity of colony formation of lung cancer cells in vitro, whereas lung cancer cells growth inhibition by FTO knockdown is restored by overexertion of USP7.
Responsed Disease Non-small-cell lung carcinoma [ICD-11: 2C25.Y]
Target Regulator Fat mass and obesity-associated protein (FTO) ERASER
Target Regulation Up regulation
Responsed Drug P22077 Investigative
Cell Process Ubiquitination degradation
In-vitro Model A-549 Lung adenocarcinoma Homo sapiens CVCL_0023
NCI-H522 Lung adenocarcinoma Homo sapiens CVCL_1567
HSAEC (Human small airway epithelial cells)
RERF-LC-A1 Lung squamous cell carcinoma Homo sapiens CVCL_4402
NCI-H1882 Lung small cell carcinoma Homo sapiens CVCL_1504
NCl-H466 (Human lung cancer cell line)
In-vivo Model Equal numbers of A549 cells expressing either control or shFTO were injected subcutaneously, within 30 min of harvesting, over the right and left flanks in male nu/nu mice between 4 and 6 weeks of age.
Experiment 2 Reporting the m6A-centered Disease Response [3]
Response Summary The m6A demethylase FTO promotes the growth of Non-small cell lung cancer cells by increasing the expression of USP7.Genetic knockdown or pharmacological inhibition (P5091 or P22027) of Ubiquitin carboxyl-terminal hydrolase 7 (USP7) reduced the proliferation rate of lung cancer cells and decreased the capacity of colony formation of lung cancer cells in vitro, whereas lung cancer cells growth inhibition by FTO knockdown is restored by overexertion of USP7.
Responsed Disease Non-small-cell lung carcinoma [ICD-11: 2C25.Y]
Target Regulator Fat mass and obesity-associated protein (FTO) ERASER
Target Regulation Up regulation
Responsed Drug P5091 Investigative
Cell Process Ubiquitination degradation
In-vitro Model A-549 Lung adenocarcinoma Homo sapiens CVCL_0023
NCI-H522 Lung adenocarcinoma Homo sapiens CVCL_1567
HSAEC (Human small airway epithelial cells)
RERF-LC-A1 Lung squamous cell carcinoma Homo sapiens CVCL_4402
NCI-H1882 Lung small cell carcinoma Homo sapiens CVCL_1504
NCl-H466 (Human lung cancer cell line)
In-vivo Model Equal numbers of A549 cells expressing either control or shFTO were injected subcutaneously, within 30 min of harvesting, over the right and left flanks in male nu/nu mice between 4 and 6 weeks of age.
P22077 [Investigative]
In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response [3]
Response Summary The m6A demethylase FTO promotes the growth of Non-small cell lung cancer cells by increasing the expression of USP7.Genetic knockdown or pharmacological inhibition (P5091 or P22027) of Ubiquitin carboxyl-terminal hydrolase 7 (USP7) reduced the proliferation rate of lung cancer cells and decreased the capacity of colony formation of lung cancer cells in vitro, whereas lung cancer cells growth inhibition by FTO knockdown is restored by overexertion of USP7.
Target Regulator Fat mass and obesity-associated protein (FTO) ERASER
Target Regulation Up regulation
Responsed Disease Non-small-cell lung carcinoma ICD-11: 2C25.Y
Cell Process Ubiquitination degradation
In-vitro Model A-549 Lung adenocarcinoma Homo sapiens CVCL_0023
NCI-H522 Lung adenocarcinoma Homo sapiens CVCL_1567
HSAEC (Human small airway epithelial cells)
RERF-LC-A1 Lung squamous cell carcinoma Homo sapiens CVCL_4402
NCI-H1882 Lung small cell carcinoma Homo sapiens CVCL_1504
NCl-H466 (Human lung cancer cell line)
In-vivo Model Equal numbers of A549 cells expressing either control or shFTO were injected subcutaneously, within 30 min of harvesting, over the right and left flanks in male nu/nu mice between 4 and 6 weeks of age.
P5091 [Investigative]
In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response [3]
Response Summary The m6A demethylase FTO promotes the growth of Non-small cell lung cancer cells by increasing the expression of USP7.Genetic knockdown or pharmacological inhibition (P5091 or P22027) of Ubiquitin carboxyl-terminal hydrolase 7 (USP7) reduced the proliferation rate of lung cancer cells and decreased the capacity of colony formation of lung cancer cells in vitro, whereas lung cancer cells growth inhibition by FTO knockdown is restored by overexertion of USP7.
Target Regulator Fat mass and obesity-associated protein (FTO) ERASER
Target Regulation Up regulation
Responsed Disease Non-small-cell lung carcinoma ICD-11: 2C25.Y
Cell Process Ubiquitination degradation
In-vitro Model A-549 Lung adenocarcinoma Homo sapiens CVCL_0023
NCI-H522 Lung adenocarcinoma Homo sapiens CVCL_1567
HSAEC (Human small airway epithelial cells)
RERF-LC-A1 Lung squamous cell carcinoma Homo sapiens CVCL_4402
NCI-H1882 Lung small cell carcinoma Homo sapiens CVCL_1504
NCl-H466 (Human lung cancer cell line)
In-vivo Model Equal numbers of A549 cells expressing either control or shFTO were injected subcutaneously, within 30 min of harvesting, over the right and left flanks in male nu/nu mice between 4 and 6 weeks of age.
Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator
Non-coding RNA
m6A Regulator: Fat mass and obesity-associated protein (FTO)
In total 4 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05235
Epigenetic Regulator hsa-miR-607
Regulated Target FTO alpha-ketoglutarate dependent dioxygenase (FTO)
Crosstalk relationship ncRNA → m6A
Disease Non-small cell lung cancer
Drug P5091
Crosstalk ID: M6ACROT05236
Epigenetic Regulator hsa-miR-607
Regulated Target FTO alpha-ketoglutarate dependent dioxygenase (FTO)
Crosstalk relationship ncRNA → m6A
Disease Non-small cell lung cancer
Crosstalk ID: M6ACROT05249
Epigenetic Regulator hsa_circ_0072309 (Circ_LIFR)
Regulated Target hsa-miR-607
Crosstalk relationship ncRNA → m6A
Disease Non-small cell lung cancer
Drug P5091
Crosstalk ID: M6ACROT05250
Epigenetic Regulator hsa_circ_0072309 (Circ_LIFR)
Regulated Target hsa-miR-607
Crosstalk relationship ncRNA → m6A
Disease Non-small cell lung cancer
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00441)
Ubiquitin carboxyl-terminal hydrolase 7 (USP7)
Adenosine-to-Inosine editing (A-to-I)
In total 1 m6A sequence/site(s) in this target gene
mod ID: A2ISITE007105 Click to Show/Hide the Full List
mod site chr16:8912389-8912390:- [4]
Sequence TCATGCAGTCTCAGCTCACTACAACCTTTGTCTCCTGGGTT
Transcript ID List ENST00000344836.9; ENST00000381886.8; ENST00000542333.5; ENST00000565455.5; ENST00000563961.5; ENST00000563085.5
External Link RMBase: RNA-editing_site_47794
N1-methyladenosine (m1A)
In total 1 m6A sequence/site(s) in this target gene
mod ID: M1ASITE000040 Click to Show/Hide the Full List
mod site chr16:8963400-8963401:- [5]
Sequence CGACGACGCGCGGGAGGAGGAGGAGGAGGCCGCCCCGCCGC
Cell/Tissue List HEK293T
Seq Type List m1A-MAP-seq
Transcript ID List ENST00000569230.5; ENST00000344836.9; ENST00000563961.5
External Link RMBase: m1A_site_363
5-methylcytidine (m5C)
In total 13 m6A sequence/site(s) in this target gene
mod ID: M5CSITE000604 Click to Show/Hide the Full List
mod site chr16:8963454-8963455:- [6]
Sequence CGTCTCCCTGCCGCCGCCGCCGCCCGCCGCGGGCCGCCCCG
Seq Type List Bisulfite-seq
Transcript ID List ENST00000569230.5; ENST00000344836.9
External Link RMBase: m5C_site_15327
mod ID: M5CSITE000605 Click to Show/Hide the Full List
mod site chr16:8963455-8963456:- [6]
Sequence GCGTCTCCCTGCCGCCGCCGCCGCCCGCCGCGGGCCGCCCC
Seq Type List Bisulfite-seq
Transcript ID List ENST00000569230.5; ENST00000344836.9
External Link RMBase: m5C_site_15328
mod ID: M5CSITE000606 Click to Show/Hide the Full List
mod site chr16:8963457-8963458:- [6]
Sequence GCGCGTCTCCCTGCCGCCGCCGCCGCCCGCCGCGGGCCGCC
Seq Type List Bisulfite-seq
Transcript ID List ENST00000344836.9; ENST00000569230.5
External Link RMBase: m5C_site_15329
mod ID: M5CSITE000607 Click to Show/Hide the Full List
mod site chr16:8963458-8963459:- [6]
Sequence TGCGCGTCTCCCTGCCGCCGCCGCCGCCCGCCGCGGGCCGC
Seq Type List Bisulfite-seq
Transcript ID List ENST00000569230.5; ENST00000344836.9
External Link RMBase: m5C_site_15330
mod ID: M5CSITE000608 Click to Show/Hide the Full List
mod site chr16:8963460-8963461:- [6]
Sequence CGTGCGCGTCTCCCTGCCGCCGCCGCCGCCCGCCGCGGGCC
Seq Type List Bisulfite-seq
Transcript ID List ENST00000344836.9; ENST00000569230.5
External Link RMBase: m5C_site_15331
mod ID: M5CSITE000609 Click to Show/Hide the Full List
mod site chr16:8963461-8963462:- [6]
Sequence ACGTGCGCGTCTCCCTGCCGCCGCCGCCGCCCGCCGCGGGC
Seq Type List Bisulfite-seq
Transcript ID List ENST00000569230.5; ENST00000344836.9
External Link RMBase: m5C_site_15332
mod ID: M5CSITE000610 Click to Show/Hide the Full List
mod site chr16:8963566-8963567:- [6]
Sequence CGCGGCGGCGGCGGCGGCGGCCGCAGCGAGCGACGAGGCCG
Seq Type List Bisulfite-seq
Transcript ID List ENST00000344836.9; ENST00000569230.5
External Link RMBase: m5C_site_15333
mod ID: M5CSITE000611 Click to Show/Hide the Full List
mod site chr16:8963569-8963570:- [6]
Sequence CCCCGCGGCGGCGGCGGCGGCGGCCGCAGCGAGCGACGAGG
Seq Type List Bisulfite-seq
Transcript ID List ENST00000569230.5; ENST00000344836.9
External Link RMBase: m5C_site_15334
mod ID: M5CSITE000612 Click to Show/Hide the Full List
mod site chr16:8963572-8963573:- [6]
Sequence GGGCCCCGCGGCGGCGGCGGCGGCGGCCGCAGCGAGCGACG
Seq Type List Bisulfite-seq
Transcript ID List ENST00000569230.5; ENST00000344836.9
External Link RMBase: m5C_site_15335
mod ID: M5CSITE000613 Click to Show/Hide the Full List
mod site chr16:8963575-8963576:- [6]
Sequence GGCGGGCCCCGCGGCGGCGGCGGCGGCGGCCGCAGCGAGCG
Seq Type List Bisulfite-seq
Transcript ID List ENST00000569230.5; ENST00000344836.9
External Link RMBase: m5C_site_15336
mod ID: M5CSITE000614 Click to Show/Hide the Full List
mod site chr16:8963578-8963579:- [6]
Sequence GGAGGCGGGCCCCGCGGCGGCGGCGGCGGCGGCCGCAGCGA
Seq Type List Bisulfite-seq
Transcript ID List ENST00000569230.5; ENST00000344836.9
External Link RMBase: m5C_site_15337
mod ID: M5CSITE000615 Click to Show/Hide the Full List
mod site chr16:8963581-8963582:- [6]
Sequence GCGGGAGGCGGGCCCCGCGGCGGCGGCGGCGGCGGCCGCAG
Seq Type List Bisulfite-seq
Transcript ID List ENST00000569230.5; ENST00000344836.9
External Link RMBase: m5C_site_15338
mod ID: M5CSITE000616 Click to Show/Hide the Full List
mod site chr16:8963584-8963585:- [6]
Sequence GCGGCGGGAGGCGGGCCCCGCGGCGGCGGCGGCGGCGGCCG
Seq Type List Bisulfite-seq
Transcript ID List ENST00000569230.5; ENST00000344836.9
External Link RMBase: m5C_site_15339
N6-methyladenosine (m6A)
In total 122 m6A sequence/site(s) in this target gene
mod ID: M6ASITE025952 Click to Show/Hide the Full List
mod site chr16:8892426-8892427:- [7]
Sequence TTGCCTTCCAGCTCCGTGGCACGGTTTCCTGGTCTTTGGGC
Motif Score 2.80452381
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000344836.9
External Link RMBase: m6A_site_307385
mod ID: M6ASITE025953 Click to Show/Hide the Full List
mod site chr16:8892904-8892905:- [7]
Sequence TAAAATAGAATCAGCAAATCACTCTTATTTTTCATCCTTTT
Motif Score 2.469291667
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000563961.5; ENST00000344836.9
External Link RMBase: m6A_site_307386
mod ID: M6ASITE025954 Click to Show/Hide the Full List
mod site chr16:8893082-8893083:- [7]
Sequence TATTTAATGAATGAACATGTACAATTTGCCACTGGGAGGAG
Motif Score 2.856142857
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000344836.9; ENST00000563961.5
External Link RMBase: m6A_site_307387
mod ID: M6ASITE025955 Click to Show/Hide the Full List
mod site chr16:8893088-8893089:- [8]
Sequence ATTGTATATTTAATGAATGAACATGTACAATTTGCCACTGG
Motif Score 2.951386905
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000344836.9; ENST00000563961.5
External Link RMBase: m6A_site_307388
mod ID: M6ASITE025956 Click to Show/Hide the Full List
mod site chr16:8893204-8893205:- [8]
Sequence TCGTTAAAGTGGAACAGACGACAAGAAAGCCTTTTAGCAAG
Motif Score 2.865571429
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000563961.5; ENST00000344836.9
External Link RMBase: m6A_site_307389
mod ID: M6ASITE025957 Click to Show/Hide the Full List
mod site chr16:8893207-8893208:- [7]
Sequence ATTTCGTTAAAGTGGAACAGACGACAAGAAAGCCTTTTAGC
Motif Score 2.871321429
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000563961.5; ENST00000344836.9
External Link RMBase: m6A_site_307390
mod ID: M6ASITE025958 Click to Show/Hide the Full List
mod site chr16:8893211-8893212:- [9]
Sequence TAGAATTTCGTTAAAGTGGAACAGACGACAAGAAAGCCTTT
Motif Score 2.951386905
Cell/Tissue List HEK293T; HeLa; GM12878; Huh7; iSLK
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000344836.9; ENST00000563961.5
External Link RMBase: m6A_site_307391
mod ID: M6ASITE025959 Click to Show/Hide the Full List
mod site chr16:8893273-8893274:- [7]
Sequence TCTGCTGCCTTGGCAGACTTACGATCTCAACAGTTCATACG
Motif Score 2.046785714
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000563961.5; ENST00000344836.9
External Link RMBase: m6A_site_307392
mod ID: M6ASITE025960 Click to Show/Hide the Full List
mod site chr16:8893277-8893278:- [10]
Sequence TTACTCTGCTGCCTTGGCAGACTTACGATCTCAACAGTTCA
Motif Score 3.319380952
Cell/Tissue List HeLa; CD34; HEK293T; U2OS; hESCs; fibroblasts; A549; GM12878; Huh7; HEK293A-TOA; iSLK; TREX
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000563961.5; ENST00000344836.9
External Link RMBase: m6A_site_307393
mod ID: M6ASITE025961 Click to Show/Hide the Full List
mod site chr16:8893320-8893321:- [11]
Sequence GTCTTTTTATTAAATCAAGAACATTGTTAAATTCAATTAAG
Motif Score 2.951386905
Cell/Tissue List CD34; HEK293T; brain; HeLa; hESC-HEK293T; U2OS; hESCs; fibroblasts; A549; GM12878; Huh7; HEK293A-TOA; iSLK; TREX
Seq Type List m6A-seq; MeRIP-seq; m6A-REF-seq; MAZTER-seq
Transcript ID List ENST00000563961.5; ENST00000344836.9
External Link RMBase: m6A_site_307394
mod ID: M6ASITE025962 Click to Show/Hide the Full List
mod site chr16:8893351-8893352:- [8]
Sequence ACTGAATACAGTCCGGACAGACATTGTGGGGGTCTTTTTAT
Motif Score 2.897386905
Cell/Tissue List hESC-HEK293T; U2OS
Seq Type List MAZTER-seq; MeRIP-seq
Transcript ID List ENST00000344836.9; ENST00000563961.5
External Link RMBase: m6A_site_307395
mod ID: M6ASITE025963 Click to Show/Hide the Full List
mod site chr16:8893355-8893356:- [11]
Sequence ATGCACTGAATACAGTCCGGACAGACATTGTGGGGGTCTTT
Motif Score 3.643047619
Cell/Tissue List CD34; HEK293T; HeLa; A549; hESC-HEK293T; U2OS; hESCs; fibroblasts; GM12878; HEK293A-TOA; iSLK; TREX
Seq Type List m6A-seq; MeRIP-seq; MAZTER-seq
Transcript ID List ENST00000344836.9; ENST00000563961.5
External Link RMBase: m6A_site_307396
mod ID: M6ASITE025964 Click to Show/Hide the Full List
mod site chr16:8893364-8893365:- [12]
Sequence GCAAAGTGGATGCACTGAATACAGTCCGGACAGACATTGTG
Motif Score 2.110482143
Cell/Tissue List brain
Seq Type List m6A-REF-seq
Transcript ID List ENST00000344836.9; ENST00000563961.5
External Link RMBase: m6A_site_307397
mod ID: M6ASITE025965 Click to Show/Hide the Full List
mod site chr16:8893426-8893427:- [10]
Sequence GCCTGGGGGCTTTTTAATAAACTTGTCTCACCTCGTCAGCC
Motif Score 2.627720238
Cell/Tissue List HeLa; CD34; HEK293T; U2OS; hESCs; A549; GM12878; Huh7; HEK293A-TOA
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000563961.5; ENST00000344836.9
External Link RMBase: m6A_site_307398
mod ID: M6ASITE025966 Click to Show/Hide the Full List
mod site chr16:8893520-8893521:- [8]
Sequence AAGGCAAAACAGAGAAACTCACAACCTAATAAATAGCGCTC
Motif Score 2.047297619
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000344836.9; ENST00000563961.5
External Link RMBase: m6A_site_307399
mod ID: M6ASITE025967 Click to Show/Hide the Full List
mod site chr16:8893524-8893525:- [13]
Sequence TGTTAAGGCAAAACAGAGAAACTCACAACCTAATAAATAGC
Motif Score 2.627720238
Cell/Tissue List HEK293T; HeLa; Huh7
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000344836.9; ENST00000563961.5
External Link RMBase: m6A_site_307400
mod ID: M6ASITE025968 Click to Show/Hide the Full List
mod site chr16:8893532-8893533:- [12]
Sequence TGTGCATCTGTTAAGGCAAAACAGAGAAACTCACAACCTAA
Motif Score 2.20572619
Cell/Tissue List HEK293T; brain; HeLa; Huh7
Seq Type List MeRIP-seq; m6A-REF-seq; m6A-seq
Transcript ID List ENST00000344836.9; ENST00000563961.5
External Link RMBase: m6A_site_307401
mod ID: M6ASITE025969 Click to Show/Hide the Full List
mod site chr16:8893936-8893937:- [10]
Sequence TGGCCCCTTAACAGCCTAGAACTTTGGTGCACGTGCCCTCT
Motif Score 3.373380952
Cell/Tissue List HeLa; CD34; HEK293T; A549; HepG2; H1A; H1B; hNPCs; hESCs; fibroblasts; LCLs; H1299; iSLK; MSC; TIME; TREX; endometrial; AML
Seq Type List m6A-seq; MeRIP-seq; m6A-CLIP/IP; miCLIP
Transcript ID List ENST00000563961.5; ENST00000344836.9; ENST00000381886.8
External Link RMBase: m6A_site_307402
mod ID: M6ASITE025970 Click to Show/Hide the Full List
mod site chr16:8894028-8894029:- [7]
Sequence AAAGAGGAGTCGCTACACTTACCTTGAAAAGGCCATTAAAA
Motif Score 2.052208333
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000563961.5; ENST00000381886.8; ENST00000565455.5; ENST00000344836.9
External Link RMBase: m6A_site_307403
mod ID: M6ASITE025971 Click to Show/Hide the Full List
mod site chr16:8894034-8894035:- [8]
Sequence AGCCCCAAAGAGGAGTCGCTACACTTACCTTGAAAAGGCCA
Motif Score 2.078666667
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000381886.8; ENST00000344836.9; ENST00000563961.5; ENST00000565455.5
External Link RMBase: m6A_site_307404
mod ID: M6ASITE025972 Click to Show/Hide the Full List
mod site chr16:8894058-8894059:- [8]
Sequence GCTAGGGCTCGACCACTTCAACAAAGCCCCAAAGAGGAGTC
Motif Score 2.173910714
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000563961.5; ENST00000565455.5; ENST00000381886.8; ENST00000344836.9
External Link RMBase: m6A_site_307405
mod ID: M6ASITE025973 Click to Show/Hide the Full List
mod site chr16:8894556-8894557:- [12]
Sequence AATTTGAAAGACTTTGAGCCACAGCCCGGTAAGGGTTCTCC
Motif Score 2.053113095
Cell/Tissue List liver
Seq Type List m6A-REF-seq
Transcript ID List ENST00000565455.5; ENST00000381886.8; ENST00000563961.5; ENST00000344836.9
External Link RMBase: m6A_site_307406
mod ID: M6ASITE025974 Click to Show/Hide the Full List
mod site chr16:8894566-8894567:- [10]
Sequence GTATGAAGTAAATTTGAAAGACTTTGAGCCACAGCCCGGTA
Motif Score 3.319380952
Cell/Tissue List HeLa; CD34; HEK293T; HepG2; LCLs; Huh7
Seq Type List m6A-seq; DART-seq; MeRIP-seq
Transcript ID List ENST00000565455.5; ENST00000381886.8; ENST00000344836.9; ENST00000563961.5
External Link RMBase: m6A_site_307407
mod ID: M6ASITE025975 Click to Show/Hide the Full List
mod site chr16:8894602-8894603:- [8]
Sequence AATGATGGGCCGACACCAGTACATAAATGAAGACGAGTATG
Motif Score 2.856142857
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000565455.5; ENST00000381886.8; ENST00000344836.9; ENST00000563961.5
External Link RMBase: m6A_site_307408
mod ID: M6ASITE025976 Click to Show/Hide the Full List
mod site chr16:8894610-8894611:- [8]
Sequence GCAATTGTAATGATGGGCCGACACCAGTACATAAATGAAGA
Motif Score 2.865571429
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000344836.9; ENST00000563961.5; ENST00000565455.5; ENST00000381886.8
External Link RMBase: m6A_site_307409
mod ID: M6ASITE025977 Click to Show/Hide the Full List
mod site chr16:8894808-8894809:- [10]
Sequence GCGAATCCAGAGCCTGCTGGACATCCAGGAGAAGGAGTTTG
Motif Score 3.643047619
Cell/Tissue List HeLa; CD34; hESC-HEK293T; Huh7; endometrial
Seq Type List m6A-seq; MAZTER-seq; MeRIP-seq
Transcript ID List ENST00000381886.8; ENST00000563961.5; ENST00000565455.5; ENST00000344836.9
External Link RMBase: m6A_site_307410
mod ID: M6ASITE025978 Click to Show/Hide the Full List
mod site chr16:8895036-8895037:- [8]
Sequence ATCCCGTTTTTGCTGAGGATACACCAGGTATGCTGTTGTGG
Motif Score 2.110482143
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000565455.5; ENST00000381886.8; ENST00000563961.5; ENST00000344836.9
External Link RMBase: m6A_site_307411
mod ID: M6ASITE025979 Click to Show/Hide the Full List
mod site chr16:8895082-8895083:- [8]
Sequence TGTCACAGTGGCGCATTTCCACAAAGAGGTCTTCGGAACGT
Motif Score 2.053113095
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000563961.5; ENST00000567113.5; ENST00000563085.5; ENST00000381886.8; ENST00000344836.9; ENST00000565455.5
External Link RMBase: m6A_site_307412
mod ID: M6ASITE025980 Click to Show/Hide the Full List
mod site chr16:8895121-8895122:- [10]
Sequence TTTGGACCAGGTGGACATAGACAAAGAGAATGAGATGCTTG
Motif Score 2.897386905
Cell/Tissue List HeLa; CD34; HepG2; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000381886.8; ENST00000567113.5; ENST00000563085.5; ENST00000565455.5; ENST00000565883.1; ENST00000563961.5; ENST00000344836.9
External Link RMBase: m6A_site_307413
mod ID: M6ASITE025981 Click to Show/Hide the Full List
mod site chr16:8895127-8895128:- [10]
Sequence AATCCCTTTGGACCAGGTGGACATAGACAAAGAGAATGAGA
Motif Score 3.643047619
Cell/Tissue List HeLa; CD34; hESC-HEK293T; HepG2; Huh7
Seq Type List m6A-seq; MAZTER-seq; MeRIP-seq
Transcript ID List ENST00000563085.5; ENST00000567113.5; ENST00000344836.9; ENST00000381886.8; ENST00000565455.5; ENST00000565883.1; ENST00000563961.5
External Link RMBase: m6A_site_307414
mod ID: M6ASITE025982 Click to Show/Hide the Full List
mod site chr16:8895136-8895137:- [10]
Sequence TCCCCAGGAAATCCCTTTGGACCAGGTGGACATAGACAAAG
Motif Score 3.622404762
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000565883.1; ENST00000563085.5; ENST00000563961.5; ENST00000344836.9; ENST00000567113.5; ENST00000565455.5; ENST00000381886.8
External Link RMBase: m6A_site_307415
mod ID: M6ASITE025983 Click to Show/Hide the Full List
mod site chr16:8895689-8895690:- [10]
Sequence GGTGTTCATCAAGAAGATGAACTATTAGAATGTTTATCTCC
Motif Score 3.373380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000344836.9; ENST00000563961.5; ENST00000565455.5; ENST00000565883.1; ENST00000381886.8; ENST00000563085.5; ENST00000567113.5
External Link RMBase: m6A_site_307416
mod ID: M6ASITE025984 Click to Show/Hide the Full List
mod site chr16:8895720-8895721:- [7]
Sequence GCTGCTAGAAATTGTAAGCTACAAAATCATTGGTGTTCATC
Motif Score 2.078666667
Cell/Tissue List HEK293T; hESC-HEK293T
Seq Type List DART-seq; MAZTER-seq
Transcript ID List ENST00000563085.5; ENST00000381886.8; ENST00000565455.5; ENST00000563961.5; ENST00000344836.9; ENST00000565883.1; ENST00000567113.5
External Link RMBase: m6A_site_307417
mod ID: M6ASITE025985 Click to Show/Hide the Full List
mod site chr16:8897003-8897004:- [10]
Sequence GGGGAGAAAGCATCAGGGAAACTTAGGCAAGTATTTCTTGA
Motif Score 2.627720238
Cell/Tissue List HeLa; HEK293T; fibroblasts
Seq Type List m6A-seq; DART-seq
Transcript ID List ENST00000567113.5; ENST00000565455.5; ENST00000344836.9; ENST00000381886.8; ENST00000563085.5; ENST00000565883.1; ENST00000563961.5
External Link RMBase: m6A_site_307418
mod ID: M6ASITE025986 Click to Show/Hide the Full List
mod site chr16:8897058-8897059:- [10]
Sequence CAAGCATGGGTGTGTCCGGGACCTGTTAGAAGAATGTAAAA
Motif Score 3.622404762
Cell/Tissue List HeLa; CD34; fibroblasts
Seq Type List m6A-seq
Transcript ID List ENST00000565883.1; ENST00000563961.5; ENST00000567113.5; ENST00000381886.8; ENST00000344836.9; ENST00000565455.5; ENST00000563085.5
External Link RMBase: m6A_site_307419
mod ID: M6ASITE025987 Click to Show/Hide the Full List
mod site chr16:8897079-8897080:- [10]
Sequence GGAAATAACACTATATCCAGACAAGCATGGGTGTGTCCGGG
Motif Score 2.897386905
Cell/Tissue List HeLa; CD34; hESC-HEK293T; fibroblasts
Seq Type List m6A-seq; MAZTER-seq
Transcript ID List ENST00000562615.1; ENST00000563961.5; ENST00000565455.5; ENST00000565883.1; ENST00000563085.5; ENST00000567113.5; ENST00000344836.9; ENST00000381886.8
External Link RMBase: m6A_site_307420
mod ID: M6ASITE025988 Click to Show/Hide the Full List
mod site chr16:8897147-8897148:- [10]
Sequence CTCTTCCTTTGTGGTAGCAGACCTTTTATGCTTTCTTGAAA
Motif Score 2.876744048
Cell/Tissue List HeLa; CD34
Seq Type List m6A-seq
Transcript ID List ENST00000562615.1; ENST00000565455.5; ENST00000567113.5; ENST00000563085.5; ENST00000381886.8; ENST00000344836.9; ENST00000563961.5; ENST00000565883.1
External Link RMBase: m6A_site_307421
mod ID: M6ASITE025989 Click to Show/Hide the Full List
mod site chr16:8897188-8897189:- [10]
Sequence CCAGCTGGGGACAGTTGAGAACAATGATGCAACTTTCTCCT
Motif Score 2.951386905
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000344836.9; ENST00000565455.5; ENST00000381886.8; ENST00000563961.5; ENST00000563085.5; ENST00000565883.1; ENST00000567113.5; ENST00000562615.1
External Link RMBase: m6A_site_307422
mod ID: M6ASITE025990 Click to Show/Hide the Full List
mod site chr16:8897198-8897199:- [10]
Sequence AACATGGGGGCCAGCTGGGGACAGTTGAGAACAATGATGCA
Motif Score 3.643047619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000562615.1; ENST00000565455.5; ENST00000567113.5; ENST00000344836.9; ENST00000563961.5; ENST00000563085.5; ENST00000381886.8; ENST00000565883.1
External Link RMBase: m6A_site_307423
mod ID: M6ASITE025991 Click to Show/Hide the Full List
mod site chr16:8897217-8897218:- [10]
Sequence GGGTGGGAATGAGAGCAAGAACATGGGGGCCAGCTGGGGAC
Motif Score 2.951386905
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000563961.5; ENST00000565455.5; ENST00000567113.5; ENST00000562615.1; ENST00000563085.5; ENST00000381886.8; ENST00000344836.9; ENST00000565883.1
External Link RMBase: m6A_site_307424
mod ID: M6ASITE025992 Click to Show/Hide the Full List
mod site chr16:8898378-8898379:- [10]
Sequence TTTTAAATGTATATGGTTAAACAGCCAATTTAGGGAAGAGG
Motif Score 2.20572619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000563961.5; ENST00000381886.8; ENST00000563085.5; ENST00000344836.9; ENST00000565883.1; ENST00000562615.1; ENST00000565455.5
External Link RMBase: m6A_site_307425
mod ID: M6ASITE025993 Click to Show/Hide the Full List
mod site chr16:8898408-8898409:- [10]
Sequence GAAAATCACAGACTTTGAGAACAGGCGAAGTTTTAAATGTA
Motif Score 2.951386905
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000344836.9; ENST00000563085.5; ENST00000563961.5; ENST00000565455.5; ENST00000381886.8; ENST00000565883.1; ENST00000562615.1
External Link RMBase: m6A_site_307426
mod ID: M6ASITE025994 Click to Show/Hide the Full List
mod site chr16:8898417-8898418:- [10]
Sequence GCTTAAGATGAAAATCACAGACTTTGAGAACAGGCGAAGTT
Motif Score 3.319380952
Cell/Tissue List HeLa; HEK293T
Seq Type List m6A-seq; DART-seq
Transcript ID List ENST00000381886.8; ENST00000562615.1; ENST00000563961.5; ENST00000344836.9; ENST00000565455.5; ENST00000565883.1; ENST00000563085.5
External Link RMBase: m6A_site_307427
mod ID: M6ASITE025995 Click to Show/Hide the Full List
mod site chr16:8898545-8898546:- [11]
Sequence AAGCCTAGACAACCTAAGAAACTTTACTATCAGCAGGTATG
Motif Score 2.627720238
Cell/Tissue List CD34
Seq Type List m6A-seq
Transcript ID List ENST00000565455.5; ENST00000563085.5; ENST00000562615.1; ENST00000344836.9; ENST00000381886.8; ENST00000563961.5
External Link RMBase: m6A_site_307428
mod ID: M6ASITE025996 Click to Show/Hide the Full List
mod site chr16:8898557-8898558:- [11]
Sequence CTACAGTTCTTCAAGCCTAGACAACCTAAGAAACTTTACTA
Motif Score 2.897386905
Cell/Tissue List CD34; HEK293T; hESC-HEK293T
Seq Type List m6A-seq; DART-seq; MAZTER-seq
Transcript ID List ENST00000562615.1; ENST00000344836.9; ENST00000381886.8; ENST00000563085.5; ENST00000563961.5; ENST00000565455.5
External Link RMBase: m6A_site_307429
mod ID: M6ASITE025997 Click to Show/Hide the Full List
mod site chr16:8898575-8898576:- [7]
Sequence GGTACTTTAAGAGATCTTCTACAGTTCTTCAAGCCTAGACA
Motif Score 2.078666667
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000563085.5; ENST00000381886.8; ENST00000565455.5; ENST00000562615.1; ENST00000344836.9; ENST00000563961.5
External Link RMBase: m6A_site_307430
mod ID: M6ASITE025998 Click to Show/Hide the Full List
mod site chr16:8898608-8898609:- [11]
Sequence GGCCCAGGTAATCCTCTTAGACATAATTATGAAGGTACTTT
Motif Score 2.897386905
Cell/Tissue List CD34; hESC-HEK293T
Seq Type List m6A-seq; MAZTER-seq
Transcript ID List ENST00000565455.5; ENST00000563043.1; ENST00000563085.5; ENST00000563961.5; ENST00000344836.9; ENST00000562615.1; ENST00000381886.8
External Link RMBase: m6A_site_307431
mod ID: M6ASITE025999 Click to Show/Hide the Full List
mod site chr16:8898674-8898675:- [11]
Sequence ATTTGTTTTTAGGCAAATAAACAAGTCATTTATTTATATGC
Motif Score 2.20572619
Cell/Tissue List CD34
Seq Type List m6A-seq
Transcript ID List ENST00000563043.1; ENST00000562615.1; ENST00000381886.8; ENST00000563961.5; ENST00000563085.5; ENST00000565455.5; ENST00000344836.9
External Link RMBase: m6A_site_307432
mod ID: M6ASITE026000 Click to Show/Hide the Full List
mod site chr16:8899159-8899160:- [8]
Sequence GACAGTTGCACAGAGGCTCAACACAGATCCAATGTTGCTGC
Motif Score 2.173910714
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000563961.5; ENST00000562051.1; ENST00000344836.9; ENST00000565455.5; ENST00000563085.5; ENST00000381886.8; ENST00000563043.1
External Link RMBase: m6A_site_307433
mod ID: M6ASITE026001 Click to Show/Hide the Full List
mod site chr16:8899178-8899179:- [12]
Sequence CTGTGTCTTAGGTTGCAAAGACAGTTGCACAGAGGCTCAAC
Motif Score 2.897386905
Cell/Tissue List brain; HEK293T
Seq Type List m6A-REF-seq; DART-seq
Transcript ID List ENST00000562051.1; ENST00000565455.5; ENST00000344836.9; ENST00000381886.8; ENST00000563043.1; ENST00000563961.5; ENST00000563085.5; ENST00000567692.1
External Link RMBase: m6A_site_307434
mod ID: M6ASITE026002 Click to Show/Hide the Full List
mod site chr16:8899662-8899663:- [10]
Sequence ATGTCATTTTCTGTGATAAAACAATCCCTAATGATCCTGGA
Motif Score 2.20572619
Cell/Tissue List HeLa; hESC-HEK293T
Seq Type List m6A-seq; MAZTER-seq
Transcript ID List ENST00000563085.5; ENST00000567692.1; ENST00000565455.5; ENST00000569448.1; ENST00000344836.9; ENST00000566131.1; ENST00000381886.8; ENST00000563043.1; ENST00000562051.1; ENST00000563961.5
External Link RMBase: m6A_site_307435
mod ID: M6ASITE026003 Click to Show/Hide the Full List
mod site chr16:8899736-8899737:- [12]
Sequence GGATGACCCTGAAAATGATAACAGTGAATTACCCACCGCAA
Motif Score 2.168095238
Cell/Tissue List kidney
Seq Type List m6A-REF-seq
Transcript ID List ENST00000569448.1; ENST00000565455.5; ENST00000563961.5; ENST00000567692.1; ENST00000562051.1; ENST00000381886.8; ENST00000566131.1; ENST00000563043.1; ENST00000344836.9; ENST00000563085.5
External Link RMBase: m6A_site_307436
mod ID: M6ASITE026004 Click to Show/Hide the Full List
mod site chr16:8899774-8899775:- [10]
Sequence GACTTTGATTCAGACTGCAAACTTTCTCCCTCCACCAGGGA
Motif Score 2.627720238
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000344836.9; ENST00000563043.1; ENST00000563961.5; ENST00000566131.1; ENST00000569448.1; ENST00000562051.1; ENST00000567692.1; ENST00000381886.8; ENST00000565455.5; ENST00000563085.5
External Link RMBase: m6A_site_307437
mod ID: M6ASITE026005 Click to Show/Hide the Full List
mod site chr16:8899781-8899782:- [10]
Sequence TGCCATGGACTTTGATTCAGACTGCAAACTTTCTCCCTCCA
Motif Score 3.319380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000567692.1; ENST00000562051.1; ENST00000563961.5; ENST00000563085.5; ENST00000344836.9; ENST00000563043.1; ENST00000565455.5; ENST00000566131.1; ENST00000569448.1; ENST00000381886.8
External Link RMBase: m6A_site_307438
mod ID: M6ASITE026006 Click to Show/Hide the Full List
mod site chr16:8899793-8899794:- [10]
Sequence CCAGCTACCCCCTGCCATGGACTTTGATTCAGACTGCAAAC
Motif Score 4.065041667
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000563085.5; ENST00000344836.9; ENST00000563961.5; ENST00000566131.1; ENST00000565455.5; ENST00000562051.1; ENST00000567692.1; ENST00000563043.1; ENST00000381886.8; ENST00000569448.1
External Link RMBase: m6A_site_307439
mod ID: M6ASITE026007 Click to Show/Hide the Full List
mod site chr16:8900547-8900548:- [8]
Sequence TGATGAACTAATGGATGGTGACATCATAGTATTTCAGAAGT
Motif Score 2.859755952
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000344836.9; ENST00000567692.1; ENST00000565455.5; ENST00000563961.5; ENST00000566131.1; ENST00000569448.1; ENST00000381886.8; ENST00000563043.1; ENST00000563085.5
External Link RMBase: m6A_site_307440
mod ID: M6ASITE026008 Click to Show/Hide the Full List
mod site chr16:8900561-8900562:- [10]
Sequence CTTGATAAAGCCCTTGATGAACTAATGGATGGTGACATCAT
Motif Score 3.373380952
Cell/Tissue List HeLa; HEK293T
Seq Type List m6A-seq; DART-seq
Transcript ID List ENST00000565455.5; ENST00000569448.1; ENST00000563043.1; ENST00000567692.1; ENST00000381886.8; ENST00000563085.5; ENST00000566131.1; ENST00000344836.9; ENST00000563961.5
External Link RMBase: m6A_site_307441
mod ID: M6ASITE026009 Click to Show/Hide the Full List
mod site chr16:8900595-8900596:- [10]
Sequence TTTAACAGAGAGAATTCAGGACTATGACGTGTCTCTTGATA
Motif Score 4.065041667
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000563961.5; ENST00000563043.1; ENST00000344836.9; ENST00000565455.5; ENST00000381886.8; ENST00000569448.1; ENST00000567692.1; ENST00000566131.1; ENST00000563085.5
External Link RMBase: m6A_site_307442
mod ID: M6ASITE026010 Click to Show/Hide the Full List
mod site chr16:8900621-8900622:- [10]
Sequence CTTTCACTGTAGGAAGTTAAACCGAATTTAACAGAGAGAAT
Motif Score 2.185083333
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000566131.1; ENST00000381886.8; ENST00000563961.5; ENST00000563043.1; ENST00000565455.5; ENST00000567692.1; ENST00000344836.9; ENST00000569448.1; ENST00000563085.5
External Link RMBase: m6A_site_307443
mod ID: M6ASITE026011 Click to Show/Hide the Full List
mod site chr16:8900669-8900670:- [10]
Sequence CTGGCCATATTAAACGTTAGACAAACTTGCAGTGTAACAAT
Motif Score 2.897386905
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000569448.1; ENST00000344836.9; ENST00000563961.5; ENST00000381886.8; ENST00000566131.1; ENST00000563085.5; ENST00000565455.5; ENST00000567692.1; ENST00000563043.1
External Link RMBase: m6A_site_307444
mod ID: M6ASITE026012 Click to Show/Hide the Full List
mod site chr16:8900694-8900695:- [10]
Sequence AATACTTAAGTACATGGAAGACTATCTGGCCATATTAAACG
Motif Score 3.319380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000569448.1; ENST00000344836.9; ENST00000563085.5; ENST00000565455.5; ENST00000563043.1; ENST00000566131.1; ENST00000567692.1; ENST00000381886.8; ENST00000563961.5
External Link RMBase: m6A_site_307445
mod ID: M6ASITE026013 Click to Show/Hide the Full List
mod site chr16:8901164-8901165:- [8]
Sequence GAATTACTGTGGGCATATCTACACACCAATATCCTGTAAAA
Motif Score 2.078666667
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000381886.8; ENST00000563043.1; ENST00000565455.5; ENST00000344836.9; ENST00000569448.1; ENST00000563961.5; ENST00000567692.1; ENST00000563085.5
External Link RMBase: m6A_site_307446
mod ID: M6ASITE026014 Click to Show/Hide the Full List
mod site chr16:8901179-8901180:- [7]
Sequence CAAAACGCGGAGCTTGAATTACTGTGGGCATATCTACACAC
Motif Score 2.494845238
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000563085.5; ENST00000563043.1; ENST00000569448.1; ENST00000344836.9; ENST00000567692.1; ENST00000565455.5; ENST00000381886.8; ENST00000563961.5
External Link RMBase: m6A_site_307447
mod ID: M6ASITE026015 Click to Show/Hide the Full List
mod site chr16:8901945-8901946:- [10]
Sequence ATTCCACAAAAGCTCACTAGACTTCCTGATGAAGTCAAATA
Motif Score 3.319380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000570256.5; ENST00000563085.5; ENST00000565455.5; ENST00000563961.5; ENST00000381886.8; ENST00000344836.9
External Link RMBase: m6A_site_307448
mod ID: M6ASITE026016 Click to Show/Hide the Full List
mod site chr16:8902347-8902348:- [14]
Sequence AATAGCGTATCTGGTTTGGAACCGTGCAGAAGGCGTTAGTC
Motif Score 2.930744048
Cell/Tissue List Huh7
Seq Type List MeRIP-seq
Transcript ID List ENST00000570256.5; ENST00000567329.1; ENST00000563085.5; ENST00000563961.5; ENST00000565455.5; ENST00000542333.5; ENST00000381886.8; ENST00000344836.9
External Link RMBase: m6A_site_307449
mod ID: M6ASITE026017 Click to Show/Hide the Full List
mod site chr16:8902382-8902383:- [8]
Sequence ATGAAGCCGACGGCAATAAAACAGTAAATATTGTTAATAGC
Motif Score 2.20572619
Cell/Tissue List hESC-HEK293T; MT4; Huh7
Seq Type List MAZTER-seq; MeRIP-seq
Transcript ID List ENST00000563961.5; ENST00000563085.5; ENST00000542333.5; ENST00000570256.5; ENST00000381886.8; ENST00000344836.9; ENST00000567329.1; ENST00000565455.5
External Link RMBase: m6A_site_307450
mod ID: M6ASITE026018 Click to Show/Hide the Full List
mod site chr16:8902393-8902394:- [7]
Sequence AATGTTAGATAATGAAGCCGACGGCAATAAAACAGTAAATA
Motif Score 2.839505952
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000565455.5; ENST00000567329.1; ENST00000344836.9; ENST00000542333.5; ENST00000563961.5; ENST00000563085.5; ENST00000381886.8; ENST00000570256.5
External Link RMBase: m6A_site_307451
mod ID: M6ASITE026019 Click to Show/Hide the Full List
mod site chr16:8902427-8902428:- [8]
Sequence TGCAAGCAAGGAGTAATGGAACAAAACGACCAGCAATGTTA
Motif Score 2.951386905
Cell/Tissue List hESC-HEK293T; MT4; Huh7
Seq Type List MAZTER-seq; MeRIP-seq
Transcript ID List ENST00000570256.5; ENST00000565455.5; ENST00000563961.5; ENST00000381886.8; ENST00000542333.5; ENST00000563085.5; ENST00000344836.9; ENST00000567329.1
External Link RMBase: m6A_site_307452
mod ID: M6ASITE026020 Click to Show/Hide the Full List
mod site chr16:8902473-8902474:- [8]
Sequence TATTTTTTTCAGGGATTTCCACAAGATCAAATTCGATTGTG
Motif Score 2.053113095
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000567329.1; ENST00000344836.9; ENST00000542333.5; ENST00000563961.5; ENST00000563085.5; ENST00000381886.8; ENST00000565455.5; ENST00000570256.5
External Link RMBase: m6A_site_307453
mod ID: M6ASITE026021 Click to Show/Hide the Full List
mod site chr16:8903272-8903273:- [10]
Sequence TTGTTCAGAGCCTCTCTCAGACCATGGTGCGTACCGGTCCC
Motif Score 2.876744048
Cell/Tissue List HeLa; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000563085.5; ENST00000567329.1; ENST00000570256.5; ENST00000565455.5; ENST00000542333.5; ENST00000344836.9; ENST00000563961.5; ENST00000381886.8
External Link RMBase: m6A_site_307454
mod ID: M6ASITE026022 Click to Show/Hide the Full List
mod site chr16:8903310-8903311:- [10]
Sequence TGTGTTCAAAGTATTGAAGAACTCCTCGCTTGCTGAGTTTG
Motif Score 3.373380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000567329.1; ENST00000344836.9; ENST00000381886.8; ENST00000563961.5; ENST00000542333.5; ENST00000570256.5; ENST00000563085.5; ENST00000565455.5
External Link RMBase: m6A_site_307455
mod ID: M6ASITE026023 Click to Show/Hide the Full List
mod site chr16:8903334-8903335:- [8]
Sequence CGATGAAGAAAAAGTGAAATACACTGTGTTCAAAGTATTGA
Motif Score 2.110482143
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000381886.8; ENST00000565455.5; ENST00000570256.5; ENST00000567329.1; ENST00000563085.5; ENST00000542333.5; ENST00000344836.9; ENST00000563961.5
External Link RMBase: m6A_site_307456
mod ID: M6ASITE026024 Click to Show/Hide the Full List
mod site chr16:8903355-8903356:- [7]
Sequence CCACCAAGGGAATGACATGTACGATGAAGAAAAAGTGAAAT
Motif Score 2.830077381
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000381886.8; ENST00000567329.1; ENST00000565455.5; ENST00000570256.5; ENST00000563085.5; ENST00000344836.9; ENST00000563961.5; ENST00000542333.5
External Link RMBase: m6A_site_307457
mod ID: M6ASITE026025 Click to Show/Hide the Full List
mod site chr16:8903361-8903362:- [8]
Sequence TTGTGGCCACCAAGGGAATGACATGTACGATGAAGAAAAAG
Motif Score 2.859755952
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000570256.5; ENST00000344836.9; ENST00000563961.5; ENST00000542333.5; ENST00000381886.8; ENST00000565455.5; ENST00000567329.1; ENST00000563085.5
External Link RMBase: m6A_site_307458
mod ID: M6ASITE026026 Click to Show/Hide the Full List
mod site chr16:8903388-8903389:- [10]
Sequence TTTTCAGATAGTCGCAGAGGACCAGTTTTGTGGCCACCAAG
Motif Score 3.622404762
Cell/Tissue List HeLa; hNPCs; HEK293T; fibroblasts
Seq Type List m6A-seq
Transcript ID List ENST00000565455.5; ENST00000563085.5; ENST00000567329.1; ENST00000563961.5; ENST00000344836.9; ENST00000381886.8; ENST00000570256.5; ENST00000542333.5
External Link RMBase: m6A_site_307459
mod ID: M6ASITE026027 Click to Show/Hide the Full List
mod site chr16:8904506-8904507:- [8]
Sequence CAGCAGTTGGTGGAGCGATTACAAGAAGAGAAAAGGATCGA
Motif Score 2.07285119
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000542333.5; ENST00000570256.5; ENST00000563085.5; ENST00000565455.5; ENST00000344836.9; ENST00000381886.8; ENST00000567329.1; ENST00000563961.5
External Link RMBase: m6A_site_307460
mod ID: M6ASITE026028 Click to Show/Hide the Full List
mod site chr16:8905190-8905191:- [10]
Sequence GTCTACATCAGGGAATCAAAACTGAGTGAGTAGTGTTCACT
Motif Score 2.627720238
Cell/Tissue List HeLa; CD34
Seq Type List m6A-seq
Transcript ID List ENST00000542333.5; ENST00000565455.5; ENST00000344836.9; ENST00000381886.8; ENST00000563961.5; ENST00000563085.5
External Link RMBase: m6A_site_307461
mod ID: M6ASITE026029 Click to Show/Hide the Full List
mod site chr16:8905228-8905229:- [7]
Sequence ACCTGTCTGTTCGACACTGCACTAATGCTTACATGTTAGTC
Motif Score 3.252583333
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000565455.5; ENST00000344836.9; ENST00000563961.5; ENST00000381886.8; ENST00000563085.5; ENST00000542333.5
External Link RMBase: m6A_site_307462
mod ID: M6ASITE026030 Click to Show/Hide the Full List
mod site chr16:8905272-8905273:- [8]
Sequence TAAAGAGGAAGCAATTGAGCACAATTATGGGGGTCACGATG
Motif Score 2.830589286
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000542333.5; ENST00000563961.5; ENST00000344836.9; ENST00000565455.5; ENST00000381886.8; ENST00000563085.5
External Link RMBase: m6A_site_307463
mod ID: M6ASITE026031 Click to Show/Hide the Full List
mod site chr16:8905294-8905295:- [7]
Sequence ACGACGTGGTGTCAAGGTGTACTAAAGAGGAAGCAATTGAG
Motif Score 3.278136905
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000381886.8; ENST00000563085.5; ENST00000565455.5; ENST00000563961.5; ENST00000542333.5; ENST00000344836.9
External Link RMBase: m6A_site_307464
mod ID: M6ASITE026032 Click to Show/Hide the Full List
mod site chr16:8906444-8906445:- [10]
Sequence ACATTATGTGGTTTATCTAAACCCCAAAGGGGATGGCAAAG
Motif Score 2.185083333
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000344836.9; ENST00000381886.8; ENST00000542333.5; ENST00000563085.5; ENST00000563961.5; ENST00000565455.5
External Link RMBase: m6A_site_307465
mod ID: M6ASITE026033 Click to Show/Hide the Full List
mod site chr16:8906464-8906465:- [10]
Sequence AGTGGAGATAATCATGGTGGACATTATGTGGTTTATCTAAA
Motif Score 3.643047619
Cell/Tissue List HeLa; hESC-HEK293T
Seq Type List m6A-seq; MAZTER-seq
Transcript ID List ENST00000563085.5; ENST00000542333.5; ENST00000565455.5; ENST00000563961.5; ENST00000344836.9; ENST00000381886.8
External Link RMBase: m6A_site_307466
mod ID: M6ASITE026034 Click to Show/Hide the Full List
mod site chr16:8906522-8906523:- [10]
Sequence GCAAAAAACAGATCCTAAGGACCCTGCAAATTATATTCTTC
Motif Score 3.622404762
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000381886.8; ENST00000344836.9; ENST00000563085.5; ENST00000542333.5; ENST00000565455.5; ENST00000563961.5
External Link RMBase: m6A_site_307467
mod ID: M6ASITE026035 Click to Show/Hide the Full List
mod site chr16:8906535-8906536:- [10]
Sequence TTGATGAATTTTTGCAAAAAACAGATCCTAAGGACCCTGCA
Motif Score 2.20572619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000565455.5; ENST00000563085.5; ENST00000542333.5; ENST00000563961.5; ENST00000344836.9; ENST00000381886.8
External Link RMBase: m6A_site_307468
mod ID: M6ASITE026036 Click to Show/Hide the Full List
mod site chr16:8908364-8908365:- [10]
Sequence TATGTATGACCCTCAGACGGACCAAAATATCAAGATCAATG
Motif Score 3.622404762
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000563085.5; ENST00000563961.5; ENST00000344836.9; ENST00000565455.5; ENST00000542333.5; ENST00000381886.8
External Link RMBase: m6A_site_307469
mod ID: M6ASITE026037 Click to Show/Hide the Full List
mod site chr16:8908399-8908400:- [8]
Sequence TTGCCACCAGTGTTACATCTACAACTGATGAGATTTATGTA
Motif Score 2.078666667
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000565455.5; ENST00000563085.5; ENST00000381886.8; ENST00000563961.5; ENST00000542333.5; ENST00000344836.9
External Link RMBase: m6A_site_307470
mod ID: M6ASITE026038 Click to Show/Hide the Full List
mod site chr16:8910756-8910757:- [10]
Sequence AATAAATACGACGCTGGGGAACATGGCTTACAGGTAAATTG
Motif Score 2.951386905
Cell/Tissue List HeLa; HEK293T; fibroblasts
Seq Type List m6A-seq; DART-seq
Transcript ID List ENST00000563085.5; ENST00000381886.8; ENST00000344836.9; ENST00000542333.5; ENST00000565455.5; ENST00000563961.5
External Link RMBase: m6A_site_307471
mod ID: M6ASITE026039 Click to Show/Hide the Full List
mod site chr16:8910778-8910779:- [10]
Sequence AGTAGAACAGCTCGATGGGGACAATAAATACGACGCTGGGG
Motif Score 3.643047619
Cell/Tissue List HeLa; fibroblasts
Seq Type List m6A-seq
Transcript ID List ENST00000381886.8; ENST00000565455.5; ENST00000563961.5; ENST00000563085.5; ENST00000344836.9; ENST00000542333.5
External Link RMBase: m6A_site_307472
mod ID: M6ASITE026040 Click to Show/Hide the Full List
mod site chr16:8910792-8910793:- [10]
Sequence GTGGATTATGTGGCAGTAGAACAGCTCGATGGGGACAATAA
Motif Score 2.951386905
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000542333.5; ENST00000565455.5; ENST00000344836.9; ENST00000563961.5; ENST00000563085.5; ENST00000381886.8
External Link RMBase: m6A_site_307473
mod ID: M6ASITE026041 Click to Show/Hide the Full List
mod site chr16:8915318-8915319:- [10]
Sequence TATCCAGTGTAAAGAAGTAGACTATCGGTCTGATAGAAGAG
Motif Score 3.319380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000565455.5; ENST00000542333.5; ENST00000381886.8; ENST00000563961.5; ENST00000563085.5; ENST00000344836.9
External Link RMBase: m6A_site_307474
mod ID: M6ASITE026042 Click to Show/Hide the Full List
mod site chr16:8916528-8916529:- [8]
Sequence ACTTTAGATAGCTTCATGCAACATGATGTTCAGGAGCTTTG
Motif Score 2.173910714
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000563961.5; ENST00000565455.5; ENST00000344836.9; ENST00000542333.5; ENST00000381886.8; ENST00000563085.5
External Link RMBase: m6A_site_307475
mod ID: M6ASITE026043 Click to Show/Hide the Full List
mod site chr16:8916548-8916549:- [10]
Sequence TTATCTTTGAAAGGTGGGAAACTTTAGATAGCTTCATGCAA
Motif Score 2.627720238
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000542333.5; ENST00000381886.8; ENST00000563961.5; ENST00000344836.9; ENST00000565455.5; ENST00000563085.5
External Link RMBase: m6A_site_307476
mod ID: M6ASITE026044 Click to Show/Hide the Full List
mod site chr16:8917038-8917039:- [8]
Sequence CTGTAGGAACAAAAAAGTTAACAAAGTCATTTGGGTATGTA
Motif Score 2.168095238
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000565455.5; ENST00000344836.9; ENST00000381886.8; ENST00000542333.5; ENST00000563085.5; ENST00000563961.5
External Link RMBase: m6A_site_307477
mod ID: M6ASITE026045 Click to Show/Hide the Full List
mod site chr16:8917050-8917051:- [10]
Sequence ATAGTGATAAACCTGTAGGAACAAAAAAGTTAACAAAGTCA
Motif Score 2.951386905
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000565455.5; ENST00000563085.5; ENST00000344836.9; ENST00000542333.5; ENST00000563961.5; ENST00000381886.8
External Link RMBase: m6A_site_307478
mod ID: M6ASITE026046 Click to Show/Hide the Full List
mod site chr16:8917060-8917061:- [10]
Sequence GAATTACAGCATAGTGATAAACCTGTAGGAACAAAAAAGTT
Motif Score 2.185083333
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000563085.5; ENST00000381886.8; ENST00000344836.9; ENST00000565455.5; ENST00000542333.5; ENST00000563961.5
External Link RMBase: m6A_site_307479
mod ID: M6ASITE026047 Click to Show/Hide the Full List
mod site chr16:8917096-8917097:- [8]
Sequence AAAAGCGTCCCTTTAGCATTACAAAGAGTGTTCTATGAATT
Motif Score 2.07285119
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000565455.5; ENST00000563961.5; ENST00000542333.5; ENST00000563085.5; ENST00000381886.8; ENST00000344836.9
External Link RMBase: m6A_site_307480
mod ID: M6ASITE026048 Click to Show/Hide the Full List
mod site chr16:8917148-8917149:- [8]
Sequence TTAATTGTTTCAGGCTGTGTACATGATGCCAACCGAGGGGG
Motif Score 2.856142857
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000344836.9; ENST00000565455.5; ENST00000381886.8; ENST00000563085.5; ENST00000563961.5; ENST00000542333.5
External Link RMBase: m6A_site_307481
mod ID: M6ASITE026049 Click to Show/Hide the Full List
mod site chr16:8919073-8919074:- [10]
Sequence GGGAGCGACTTGTTACATGAACAGCCTGCTACAGACGTTAT
Motif Score 2.951386905
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000344836.9; ENST00000563961.5; ENST00000381886.8; ENST00000565455.5; ENST00000563085.5; ENST00000542333.5
External Link RMBase: m6A_site_307482
mod ID: M6ASITE026050 Click to Show/Hide the Full List
mod site chr16:8919079-8919080:- [8]
Sequence GAATCAGGGAGCGACTTGTTACATGAACAGCCTGCTACAGA
Motif Score 2.07285119
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000563085.5; ENST00000381886.8; ENST00000565455.5; ENST00000563961.5; ENST00000542333.5; ENST00000344836.9
External Link RMBase: m6A_site_307483
mod ID: M6ASITE026051 Click to Show/Hide the Full List
mod site chr16:8919086-8919087:- [7]
Sequence GCTTAAAGAATCAGGGAGCGACTTGTTACATGAACAGCCTG
Motif Score 3.287565476
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000563961.5; ENST00000381886.8; ENST00000344836.9; ENST00000542333.5; ENST00000563085.5; ENST00000565455.5
External Link RMBase: m6A_site_307484
mod ID: M6ASITE026052 Click to Show/Hide the Full List
mod site chr16:8919121-8919122:- [8]
Sequence CAGGTGGGATTCAAAGAAGCACACAGGCTACGTCGGCTTAA
Motif Score 2.830589286
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000381886.8; ENST00000563085.5; ENST00000542333.5; ENST00000344836.9; ENST00000565455.5; ENST00000563961.5
External Link RMBase: m6A_site_307485
mod ID: M6ASITE026053 Click to Show/Hide the Full List
mod site chr16:8920384-8920385:- [12]
Sequence GTTACCTTTGAAGTCTTTGTACAGGCGGATGCTCCCCATGG
Motif Score 2.856142857
Cell/Tissue List liver
Seq Type List m6A-REF-seq
Transcript ID List ENST00000565455.5; ENST00000344836.9; ENST00000563085.5; ENST00000381886.8; ENST00000563961.5; ENST00000542333.5
External Link RMBase: m6A_site_307486
mod ID: M6ASITE026054 Click to Show/Hide the Full List
mod site chr16:8920409-8920410:- [8]
Sequence GAAAGGATTTATAGATGATGACAAAGTTACCTTTGAAGTCT
Motif Score 2.859755952
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000563085.5; ENST00000565455.5; ENST00000381886.8; ENST00000563961.5; ENST00000542333.5; ENST00000344836.9; ENST00000566004.5
External Link RMBase: m6A_site_307487
mod ID: M6ASITE026055 Click to Show/Hide the Full List
mod site chr16:8921250-8921251:- [12]
Sequence AGTGCTGAAGATAATAAATTACAGAGATGATGAAAAGTCGT
Motif Score 2.07285119
Cell/Tissue List HEK293; kidney
Seq Type List m6A-REF-seq
Transcript ID List ENST00000563085.5; ENST00000569230.5; ENST00000381886.8; ENST00000564117.1; ENST00000566273.5; ENST00000344836.9; ENST00000542333.5; ENST00000566004.5; ENST00000563961.5; ENST00000565455.5
External Link RMBase: m6A_site_307488
mod ID: M6ASITE026056 Click to Show/Hide the Full List
mod site chr16:8921276-8921277:- [8]
Sequence AGGTCATGGTCTTGCCATGCACAAGCAGTGCTGAAGATAAT
Motif Score 2.830589286
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000344836.9; ENST00000542333.5; ENST00000381886.8; ENST00000569230.5; ENST00000566004.5; ENST00000563085.5; ENST00000563961.5; ENST00000566273.5; ENST00000564117.1; ENST00000565455.5
External Link RMBase: m6A_site_307489
mod ID: M6ASITE026057 Click to Show/Hide the Full List
mod site chr16:8923267-8923268:- [8]
Sequence CGCTTTTATCCAGACAGACCACACCAAAAAAGCGTAGGATT
Motif Score 2.053113095
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000381886.8; ENST00000566004.5; ENST00000542333.5; ENST00000569230.5; ENST00000564117.1; ENST00000563961.5; ENST00000563085.5; ENST00000565455.5; ENST00000566273.5; ENST00000344836.9
External Link RMBase: m6A_site_307490
mod ID: M6ASITE026058 Click to Show/Hide the Full List
mod site chr16:8923274-8923275:- [10]
Sequence GATGCCACGCTTTTATCCAGACAGACCACACCAAAAAAGCG
Motif Score 2.897386905
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000566273.5; ENST00000381886.8; ENST00000565455.5; ENST00000563961.5; ENST00000566004.5; ENST00000344836.9; ENST00000564117.1; ENST00000542333.5; ENST00000569230.5; ENST00000563085.5
External Link RMBase: m6A_site_307491
mod ID: M6ASITE026059 Click to Show/Hide the Full List
mod site chr16:8923357-8923358:- [10]
Sequence ACTGTGGAGCGCTTCAGCAGACTGAGTGAGTCGGTCCTTAG
Motif Score 3.319380952
Cell/Tissue List HeLa; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000566273.5; ENST00000381886.8; ENST00000344836.9; ENST00000563085.5; ENST00000542333.5; ENST00000564117.1; ENST00000563961.5; ENST00000566224.1; ENST00000566004.5; ENST00000569230.5; ENST00000565455.5
External Link RMBase: m6A_site_307492
mod ID: M6ASITE026060 Click to Show/Hide the Full List
mod site chr16:8923412-8923413:- [8]
Sequence ATGATGTGTTTTTTTTGCAGACACCAGTTGGCGCTCCGAGG
Motif Score 2.897386905
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000564117.1; ENST00000381886.8; ENST00000542333.5; ENST00000566224.1; ENST00000569230.5; ENST00000566273.5; ENST00000565455.5; ENST00000563085.5; ENST00000566004.5; ENST00000344836.9; ENST00000563961.5
External Link RMBase: m6A_site_307493
mod ID: M6ASITE026061 Click to Show/Hide the Full List
mod site chr16:8929442-8929443:- [10]
Sequence AAGTTCAGCCTCCATGAGAAACTGCAGCCGTAGTTGAGAGT
Motif Score 2.627720238
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000563961.5; ENST00000566273.5; ENST00000344836.9; ENST00000566004.5; ENST00000566224.1; ENST00000569230.5; ENST00000381886.8; ENST00000565455.5; ENST00000563085.5; ENST00000542333.5; ENST00000564117.1
External Link RMBase: m6A_site_307494
mod ID: M6ASITE026062 Click to Show/Hide the Full List
mod site chr16:8929474-8929475:- [10]
Sequence CCAGAAGGACTGCTGTTCAGACCTCCTGCCAAAAGTTCAGC
Motif Score 2.876744048
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000565455.5; ENST00000563085.5; ENST00000381886.8; ENST00000566224.1; ENST00000542333.5; ENST00000566273.5; ENST00000564117.1; ENST00000344836.9; ENST00000563961.5; ENST00000569230.5; ENST00000566004.5
External Link RMBase: m6A_site_307495
mod ID: M6ASITE026063 Click to Show/Hide the Full List
mod site chr16:8929486-8929487:- [10]
Sequence CGGGCTGCACCACCAGAAGGACTGCTGTTCAGACCTCCTGC
Motif Score 4.065041667
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000564117.1; ENST00000563961.5; ENST00000542333.5; ENST00000566273.5; ENST00000381886.8; ENST00000563085.5; ENST00000569230.5; ENST00000565455.5; ENST00000566224.1; ENST00000566004.5; ENST00000344836.9
External Link RMBase: m6A_site_307496
mod ID: M6ASITE026064 Click to Show/Hide the Full List
mod site chr16:8929517-8929518:- [10]
Sequence TAACGGGGCAGTTGAAAGAAACCATCAGTCACGGGCTGCAC
Motif Score 2.185083333
Cell/Tissue List HeLa; MT4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000381886.8; ENST00000564117.1; ENST00000542333.5; ENST00000566004.5; ENST00000344836.9; ENST00000566273.5; ENST00000566224.1; ENST00000563085.5; ENST00000563961.5; ENST00000565455.5; ENST00000569230.5
External Link RMBase: m6A_site_307497
mod ID: M6ASITE026065 Click to Show/Hide the Full List
mod site chr16:8930303-8930304:- [10]
Sequence ACACAACACCGCGGAGGAGGACATGGAGGATGGTAAGTGCC
Motif Score 3.643047619
Cell/Tissue List HeLa; MT4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000566004.5; ENST00000566273.5; ENST00000569230.5; ENST00000565455.5; ENST00000563085.5; ENST00000381886.8; ENST00000563961.5; ENST00000542333.5; ENST00000566224.1; ENST00000564117.1; ENST00000344836.9
External Link RMBase: m6A_site_307498
mod ID: M6ASITE026066 Click to Show/Hide the Full List
mod site chr16:8930323-8930324:- [10]
Sequence AATGTGGCCCTGAGTGATGGACACAACACCGCGGAGGAGGA
Motif Score 3.643047619
Cell/Tissue List HeLa; CD34; hESC-HEK293T; MT4
Seq Type List m6A-seq; MAZTER-seq; MeRIP-seq
Transcript ID List ENST00000542333.5; ENST00000563961.5; ENST00000381886.8; ENST00000566273.5; ENST00000569230.5; ENST00000344836.9; ENST00000566004.5; ENST00000564117.1; ENST00000566224.1; ENST00000565455.5; ENST00000563085.5
External Link RMBase: m6A_site_307499
mod ID: M6ASITE026067 Click to Show/Hide the Full List
mod site chr16:8930360-8930361:- [10]
Sequence CCCACCAAGAATTACTCAGAACCCTGTGATCAATGGGAATG
Motif Score 2.930744048
Cell/Tissue List HeLa; CD34; MT4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000569230.5; ENST00000566224.1; ENST00000563961.5; ENST00000542333.5; ENST00000566004.5; ENST00000381886.8; ENST00000564117.1; ENST00000565455.5; ENST00000344836.9; ENST00000566273.5; ENST00000563085.5
External Link RMBase: m6A_site_307500
mod ID: M6ASITE026068 Click to Show/Hide the Full List
mod site chr16:8935683-8935684:- [10]
Sequence AGCAATCACCAATAATGGAGACTGTCTTCTATTTCTGAGTG
Motif Score 3.319380952
Cell/Tissue List HeLa; CD34; MT4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000564117.1; ENST00000566224.1; ENST00000563961.5; ENST00000381886.8; ENST00000344836.9; ENST00000565455.5; ENST00000566004.5; ENST00000569230.5; ENST00000566273.5; ENST00000563085.5; ENST00000542333.5
External Link RMBase: m6A_site_307501
mod ID: M6ASITE026069 Click to Show/Hide the Full List
mod site chr16:8935747-8935748:- [10]
Sequence GCCTACTTGGTGTTTCAAAAACATATTTTCTGCCTTTTCAT
Motif Score 2.20572619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000563961.5; ENST00000564117.1; ENST00000344836.9; ENST00000563085.5; ENST00000569230.5; ENST00000542333.5; ENST00000566273.5; ENST00000381886.8; ENST00000566004.5; ENST00000566224.1; ENST00000565455.5
External Link RMBase: m6A_site_307502
mod ID: M6ASITE026070 Click to Show/Hide the Full List
mod site chr16:8963220-8963221:- [11]
Sequence GCAGTTGAGCGAGCCCGAGGACATGGAGATGGAAGGTGAGG
Motif Score 3.643047619
Cell/Tissue List CD34; hESC-HEK293T; MT4
Seq Type List m6A-seq; MAZTER-seq; MeRIP-seq
Transcript ID List ENST00000344836.9; ENST00000563961.5; ENST00000569230.5
External Link RMBase: m6A_site_307503
mod ID: M6ASITE026071 Click to Show/Hide the Full List
mod site chr16:8963280-8963281:- [11]
Sequence CCAGGCCGCGGCCGACATGAACCACCAGCAGCAGCAGCAGC
Motif Score 2.930744048
Cell/Tissue List CD34; MT4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000344836.9; ENST00000569230.5; ENST00000563961.5
External Link RMBase: m6A_site_307504
mod ID: M6ASITE026072 Click to Show/Hide the Full List
mod site chr16:8963286-8963287:- [8]
Sequence CGAGGCCCAGGCCGCGGCCGACATGAACCACCAGCAGCAGC
Motif Score 2.865571429
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000569230.5; ENST00000563961.5; ENST00000344836.9
External Link RMBase: m6A_site_307505
mod ID: M6ASITE026073 Click to Show/Hide the Full List
mod site chr16:8963904-8963905:- [15]
Sequence CGGCCCCCCATGCGGATGTGACATTTCACGCCGCCGCCATT
Motif Score 2.859755952
Cell/Tissue List CD8T
Seq Type List m6A-CLIP/IP
Transcript ID List ENST00000344836.9; ENST00000569230.5
External Link RMBase: m6A_site_307506