m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00430)
Target Name Thioredoxin (TXN/SASP)
Gene Name TXN
Chromosomal Location 9q31.3
Family thioredoxin family
Function
Participates in various redox reactions through the reversible oxidation of its active center dithiol to a disulfide and catalyzes dithiol-disulfide exchange reactions. Plays a role in the reversible S-nitrosylation of cysteine residues in target proteins, and thereby contributes to the response to intracellular nitric oxide. Nitrosylates the active site Cys of CASP3 in response to nitric oxide (NO), and thereby inhibits caspase-3 activity. Induces the FOS/JUN AP-1 DNA-binding activity in ionizing radiation (IR) cells through its oxidation/reduction status and stimulates AP-1 transcriptional activity; ADF augments the expression of the interleukin-2 receptor TAC (IL2R/P55).
    Click to Show/Hide
Gene ID 7295
Uniprot ID
THIO_HUMAN
HGNC ID
HGNC:12435
KEGG ID
hsa:7295
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
TXN can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Methyltransferase-like 3 (METTL3) [WRITER]
 Regulator Info 
Representative RNA-seq result indicating the expression of this target gene regulated by METTL3
Cell Line HeLa cell line Homo sapiens
Treatment: METTL3 knockdown HeLa cells
Control: HeLa cells
 GSE70061
Regulation
logFC: -7.32E-01
p-value: 1.61E-02
More Results Click to View More RNA-seq Results
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary In osteoarthritis METTL3-mediated m6A modification decreased the expression of Thioredoxin (TXN/SASP), an E-1 enzyme crucial for the formation of autophagosomes, by attenuating its RNA stability. Silencing METTL3 enhanced autophagic flux and inhibited SASP expression in OA-FLS.
Target Regulation Up regulation
Responsed Disease Osteoarthritis ICD-11: FA05
 Disease Info 
Pathway Response Autophagy hsa04140
Cell Process Cellular senescence
Cell autophagy
In-vitro Model C-28/I2 Normal Homo sapiens CVCL_0187
FLS (Rat fibroblast synovial cell line)
In-vivo Model Mice were anaesthetized with isoflurane supplied in a mouse anaesthesia apparatus, followed with joint surgery on the right joint by sectioning the medial meniscotibial ligament.
Osteoarthritis [ICD-11: FA05]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [1]
Response Summary In osteoarthritis METTL3-mediated m6A modification decreased the expression of Thioredoxin (TXN/SASP), an E-1 enzyme crucial for the formation of autophagosomes, by attenuating its RNA stability. Silencing METTL3 enhanced autophagic flux and inhibited SASP expression in OA-FLS.
Responsed Disease Osteoarthritis [ICD-11: FA05]
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
 Regulator Info 
Target Regulation Up regulation
Pathway Response Autophagy hsa04140
Cell Process Cellular senescence
Cell autophagy
In-vitro Model C-28/I2 Normal Homo sapiens CVCL_0187
FLS (Rat fibroblast synovial cell line)
In-vivo Model Mice were anaesthetized with isoflurane supplied in a mouse anaesthesia apparatus, followed with joint surgery on the right joint by sectioning the medial meniscotibial ligament.
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00430)
Thioredoxin (TXN/SASP)
Adenosine-to-Inosine editing (A-to-I)
In total 2 m6A sequence/site(s) in this target gene
mod ID: A2ISITE003231 Click to Show/Hide the Full List
mod site chr9:110245867-110245868:- [3]
Sequence TTCTCCGTGTTAGCCAGGCTAGTCTCGAACTCCTGACCTCA
Transcript ID List ENST00000374517.6; ENST00000374515.9
External Link RMBase: RNA-editing_site_136933
mod ID: A2ISITE003232 Click to Show/Hide the Full List
mod site chr9:110246028-110246029:- [4]
Sequence TCTGTCGCCCAGGCTGGAATACAGTGGCATGATCTCAGCTC
Transcript ID List ENST00000374517.6; ENST00000374515.9
External Link RMBase: RNA-editing_site_136934
2'-O-Methylation (2'-O-Me)
In total 1 m6A sequence/site(s) in this target gene
mod ID: 2OMSITE000512 Click to Show/Hide the Full List
mod site chr9:110256445-110256446:- [5]
Sequence TACAGCCGCTCGTCAGACTCCAGCAGCCAAGATGGTGAAGC
Cell/Tissue List HEK293
Seq Type List Nm-seq
Transcript ID List ENST00000374517.6; ENST00000374515.9
External Link RMBase: Nm_site_6682
5-methylcytidine (m5C)
In total 9 m6A sequence/site(s) in this target gene
mod ID: M5CSITE004413 Click to Show/Hide the Full List
mod site chr9:110250871-110250872:- [6]
Sequence TTAAATTTTCCAGTCCCTCTCTGAAAAGTATTCCAACGTGA
Seq Type List Bisulfite-seq
Transcript ID List ENST00000374515.9; ENST00000374517.6
External Link RMBase: m5C_site_43259
mod ID: M5CSITE004414 Click to Show/Hide the Full List
mod site chr9:110252756-110252757:-
Sequence AGCTACTCAGGAGGCTGAGGCAAGAGAATCACTTGAACCCC
Cell/Tissue List T24
Seq Type List Bisulfite-seq
Transcript ID List rmsk_2845566; ENST00000374517.6; ENST00000374515.9
External Link RMBase: m5C_site_43260
mod ID: M5CSITE004415 Click to Show/Hide the Full List
mod site chr9:110252762-110252763:-
Sequence AATCCCAGCTACTCAGGAGGCTGAGGCAAGAGAATCACTTG
Cell/Tissue List T24
Seq Type List Bisulfite-seq
Transcript ID List ENST00000374515.9; rmsk_2845566; ENST00000374517.6
External Link RMBase: m5C_site_43261
mod ID: M5CSITE004416 Click to Show/Hide the Full List
mod site chr9:110252769-110252770:-
Sequence GGCTTGTAATCCCAGCTACTCAGGAGGCTGAGGCAAGAGAA
Cell/Tissue List T24
Seq Type List Bisulfite-seq
Transcript ID List ENST00000374517.6; ENST00000374515.9; rmsk_2845566
External Link RMBase: m5C_site_43262
mod ID: M5CSITE004417 Click to Show/Hide the Full List
mod site chr9:110252771-110252772:-
Sequence GAGGCTTGTAATCCCAGCTACTCAGGAGGCTGAGGCAAGAG
Cell/Tissue List T24
Seq Type List Bisulfite-seq
Transcript ID List ENST00000374517.6; rmsk_2845566; ENST00000374515.9
External Link RMBase: m5C_site_43263
mod ID: M5CSITE004418 Click to Show/Hide the Full List
mod site chr9:110252774-110252775:-
Sequence GCAGAGGCTTGTAATCCCAGCTACTCAGGAGGCTGAGGCAA
Cell/Tissue List T24
Seq Type List Bisulfite-seq
Transcript ID List ENST00000374515.9; rmsk_2845566; ENST00000374517.6
External Link RMBase: m5C_site_43264
mod ID: M5CSITE004419 Click to Show/Hide the Full List
mod site chr9:110252777-110252778:-
Sequence GTGGCAGAGGCTTGTAATCCCAGCTACTCAGGAGGCTGAGG
Cell/Tissue List T24
Seq Type List Bisulfite-seq
Transcript ID List rmsk_2845566; ENST00000374517.6; ENST00000374515.9
External Link RMBase: m5C_site_43265
mod ID: M5CSITE004420 Click to Show/Hide the Full List
mod site chr9:110252778-110252779:-
Sequence GGTGGCAGAGGCTTGTAATCCCAGCTACTCAGGAGGCTGAG
Cell/Tissue List T24
Seq Type List Bisulfite-seq
Transcript ID List ENST00000374515.9; ENST00000374517.6; rmsk_2845566
External Link RMBase: m5C_site_43266
mod ID: M5CSITE004421 Click to Show/Hide the Full List
mod site chr9:110252779-110252780:-
Sequence TGGTGGCAGAGGCTTGTAATCCCAGCTACTCAGGAGGCTGA
Cell/Tissue List T24
Seq Type List Bisulfite-seq
Transcript ID List rmsk_2845566; ENST00000374517.6; ENST00000374515.9
External Link RMBase: m5C_site_43267
N6-methyladenosine (m6A)
In total 15 m6A sequence/site(s) in this target gene
mod ID: M6ASITE089013 Click to Show/Hide the Full List
mod site chr9:110244015-110244016:- [7]
Sequence TAATGCTAACACTTTTTAAAACCGTCTCATGTCTGAATAGC
Motif Score 2.185083333
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000374515.9; ENST00000374517.6
External Link RMBase: m6A_site_833064
mod ID: M6ASITE089014 Click to Show/Hide the Full List
mod site chr9:110244039-110244040:- [7]
Sequence GCCATCTGCGTGACAATAAAACATTAATGCTAACACTTTTT
Motif Score 2.20572619
Cell/Tissue List HeLa; HEK293T; hESC-HEK293T
Seq Type List m6A-seq; DART-seq; MAZTER-seq
Transcript ID List ENST00000487892.1; ENST00000374515.9; ENST00000374517.6
External Link RMBase: m6A_site_833065
mod ID: M6ASITE089015 Click to Show/Hide the Full List
mod site chr9:110244047-110244048:- [8]
Sequence ACCCAGTTGCCATCTGCGTGACAATAAAACATTAATGCTAA
Motif Score 2.859755952
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000374515.9; ENST00000374517.6; ENST00000487892.1
External Link RMBase: m6A_site_833066
mod ID: M6ASITE089016 Click to Show/Hide the Full List
mod site chr9:110244067-110244068:- [7]
Sequence TATAAAATATGAAGACATAAACCCAGTTGCCATCTGCGTGA
Motif Score 2.185083333
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000487892.1; ENST00000374515.9; ENST00000374517.6
External Link RMBase: m6A_site_833067
mod ID: M6ASITE089017 Click to Show/Hide the Full List
mod site chr9:110244073-110244074:- [7]
Sequence CAAAAATATAAAATATGAAGACATAAACCCAGTTGCCATCT
Motif Score 2.897386905
Cell/Tissue List HeLa; HEK293T
Seq Type List m6A-seq; DART-seq
Transcript ID List ENST00000374515.9; ENST00000487892.1; ENST00000374517.6
External Link RMBase: m6A_site_833068
mod ID: M6ASITE089018 Click to Show/Hide the Full List
mod site chr9:110244094-110244095:- [8]
Sequence ACTTGTAATTTTTTTAATTTACAAAAATATAAAATATGAAG
Motif Score 2.07285119
Cell/Tissue List HEK293T; hESC-HEK293T
Seq Type List DART-seq; MAZTER-seq
Transcript ID List ENST00000374517.6; ENST00000374515.9; ENST00000487892.1
External Link RMBase: m6A_site_833069
mod ID: M6ASITE089019 Click to Show/Hide the Full List
mod site chr9:110244114-110244115:- [7]
Sequence CCAGCCATTGGCTATTTAAAACTTGTAATTTTTTTAATTTA
Motif Score 2.627720238
Cell/Tissue List HeLa; HEK293T
Seq Type List m6A-seq; DART-seq
Transcript ID List ENST00000374517.6; ENST00000487892.1; ENST00000374515.9
External Link RMBase: m6A_site_833070
mod ID: M6ASITE089020 Click to Show/Hide the Full List
mod site chr9:110244135-110244136:- [8]
Sequence TCATGTTTTCTGAAAATATAACCAGCCATTGGCTATTTAAA
Motif Score 2.147452381
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000374515.9; ENST00000487892.1; ENST00000374517.6
External Link RMBase: m6A_site_833071
mod ID: M6ASITE089021 Click to Show/Hide the Full List
mod site chr9:110244783-110244784:- [7]
Sequence TTCCAGTTTTTTAAGAAGGGACAAAAGGTACGTACATCTGA
Motif Score 3.643047619
Cell/Tissue List HeLa; hESC-HEK293T; MT4
Seq Type List m6A-seq; MAZTER-seq; MeRIP-seq
Transcript ID List ENST00000487892.1; ENST00000374515.9; ENST00000374517.6
External Link RMBase: m6A_site_833072
mod ID: M6ASITE089022 Click to Show/Hide the Full List
mod site chr9:110244806-110244807:- [9]
Sequence GTGAAGTCAAATGCATGCCAACATTCCAGTTTTTTAAGAAG
Motif Score 2.173910714
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000374515.9; ENST00000487892.1; ENST00000374517.6
External Link RMBase: m6A_site_833073
mod ID: M6ASITE089023 Click to Show/Hide the Full List
mod site chr9:110245094-110245095:- [7]
Sequence TGATGCTAGTAACATTCTGAACATTCTGCCTGTTAATGTGC
Motif Score 2.951386905
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000374515.9; ENST00000487892.1; ENST00000374517.6
External Link RMBase: m6A_site_833074
mod ID: M6ASITE089024 Click to Show/Hide the Full List
mod site chr9:110250826-110250827:- [8]
Sequence CCTTGAAGTAGATGTGGATGACTGTCAGGTATGTAGCTGGA
Motif Score 3.28175
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000374517.6; ENST00000374515.9
External Link RMBase: m6A_site_833075
mod ID: M6ASITE089025 Click to Show/Hide the Full List
mod site chr9:110251409-110251410:- [8]
Sequence TGATAAACTTGTAGTAGTTGACTTCTCAGCCACGTGGTGTG
Motif Score 3.28175
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000374517.6; ENST00000374515.9
External Link RMBase: m6A_site_833076
mod ID: M6ASITE089026 Click to Show/Hide the Full List
mod site chr9:110251423-110251424:- [7]
Sequence TTGGACGCTGCAGGTGATAAACTTGTAGTAGTTGACTTCTC
Motif Score 2.627720238
Cell/Tissue List HeLa; HepG2; Jurkat; peripheral-blood; GSC-11; HEK293T; TIME; iSLK; endometrial; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000374515.9; ENST00000374517.6
External Link RMBase: m6A_site_833077
mod ID: M6ASITE089027 Click to Show/Hide the Full List
mod site chr9:110256449-110256450:- [7]
Sequence TCCTTACAGCCGCTCGTCAGACTCCAGCAGCCAAGATGGTG
Motif Score 3.319380952
Cell/Tissue List HeLa; HepG2; A549; HEK293T; Jurkat; peripheral-blood; GSC-11; MSC; TIME; TREX; iSLK; endometrial; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000374517.6; ENST00000374515.9
External Link RMBase: m6A_site_833078