m6A Target Gene Information
General Information of the m6A Target Gene (ID: M6ATAR00427)
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
TFRC
can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
RNA demethylase ALKBH5 (ALKBH5) [ERASER]
| Representative RNA-seq result indicating the expression of this target gene regulated by ALKBH5 | ||
| Cell Line | Neutrophils | Mus musculus |
|
Treatment: Alkbh5-/- neutrophils
Control: Wild type neutrophils
|
GSE198316 | |
| Regulation |
![]() ![]() |
logFC: -1.41E+00 p-value: 1.41E-09 |
| More Results | Click to View More RNA-seq Results | |
| In total 1 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [1] | |||
| Response Summary | IOX1, which is an inhibitor of ALKBH5, was loaded on HSSS to form HSSS-I, which could effectively ameliorate cardiac dysfunction in acute myocardial infarction. The surface-modified bioengineered ferritin nanocage targeted the dying cells in the infarct area under the guidance of Scarf1. These cells were then phagocytosed through recognition of their Transferrin receptor protein 1 (TFRC) receptor. | |||
| Responsed Disease | Acute myocardial infarction | ICD-11: BA41 | ||
| Cell Process | Lysosomal escape | |||
| In-vivo Model | Wild-type C57 (female, 12-16 weeks old), ALKBH5 /- mice (female and male, 12-16 weeks old), and SPF-grade SD rats (female, 180-230 g) were used to establish the AMI model.Sodium pentobarbital diluted to 10 mg/mL was used to anesthetize the mice or rat at the dose of 50 mg/kg through an intraperitoneal injection. By using a small animal ventilator with endotracheal intubation, thoracotomy was performed at the left fourth intercostal region. The heart was exposed, and the left anterior descending coronary artery (LCA) was occluded through a 6-0 silk suture that was placed 2-3 mm distal to the origin of the LCA with a slipknot. The apical region turned white, and ST segment elevation and T wave inversion of ECG showed that the AMI model was successfully established. Forty-five minutes after ischemia, the slipknot was released, and the ischemic region was reperfused. PBS (0.2 ml), HSSS (23.5 mg/kg, 0.2 ml), IOX1 (10 mg/kg, 0.2 ml), and HSSS-I (33.5 mg/kg, containing 10 mg/kg IOX1, 0.2 ml) were administered through caudal vein injection for 14 days at the frequency of one time per day. | |||
YTH domain-containing family protein 1 (YTHDF1) [READER]
| Representative RIP-seq result supporting the interaction between TFRC and the regulator | ||
| Cell Line | Hela | Homo sapiens |
| Regulation | logFC: 2.40E+00 | GSE63591 |
| In total 1 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [2] | |||
| Response Summary | YTHDF1 enhanced Transferrin receptor protein 1 (TFRC) expression in HPSCC through an m6A-dependent mechanism. | |||
| Target Regulation | Up regulation | |||
| Responsed Disease | Hypopharyngeal squamous cell carcinoma | ICD-11: 2B6D.0 | ||
| Pathway Response | Ferroptosis | hsa04216 | ||
| Cell Process | Ferroptosis | |||
| In-vitro Model | YCU-MS861 | Maxillary sinus squamous cell carcinoma | Homo sapiens | CVCL_8021 |
| YCU-MS861 | Maxillary sinus squamous cell carcinoma | Homo sapiens | CVCL_8021 | |
| FaDu | Hypopharyngeal squamous cell carcinoma | Homo sapiens | CVCL_1218 | |
| Detroit 562 | Pharyngeal squamous cell carcinoma | Homo sapiens | CVCL_1171 | |
Hypopharyngeal cancer [ICD-11: 2B6D]
| In total 1 item(s) under this disease | ||||
| Experiment 1 Reporting the m6A-centered Disease Response | [2] | |||
| Response Summary | YTHDF1 enhanced Transferrin receptor protein 1 (TFRC) expression in HPSCC through an m6A-dependent mechanism. | |||
| Responsed Disease | Hypopharyngeal squamous cell carcinoma [ICD-11: 2B6D.0] | |||
| Target Regulator | YTH domain-containing family protein 1 (YTHDF1) | READER | ||
| Target Regulation | Up regulation | |||
| Pathway Response | Ferroptosis | hsa04216 | ||
| Cell Process | Ferroptosis | |||
| In-vitro Model | YCU-MS861 | Maxillary sinus squamous cell carcinoma | Homo sapiens | CVCL_8021 |
| YCU-MS861 | Maxillary sinus squamous cell carcinoma | Homo sapiens | CVCL_8021 | |
| FaDu | Hypopharyngeal squamous cell carcinoma | Homo sapiens | CVCL_1218 | |
| Detroit 562 | Pharyngeal squamous cell carcinoma | Homo sapiens | CVCL_1171 | |
Acute myocardial infarction [ICD-11: BA41]
| In total 1 item(s) under this disease | ||||
| Experiment 1 Reporting the m6A-centered Disease Response | [1] | |||
| Response Summary | IOX1, which is an inhibitor of ALKBH5, was loaded on HSSS to form HSSS-I, which could effectively ameliorate cardiac dysfunction in acute myocardial infarction. The surface-modified bioengineered ferritin nanocage targeted the dying cells in the infarct area under the guidance of Scarf1. These cells were then phagocytosed through recognition of their Transferrin receptor protein 1 (TFRC) receptor. | |||
| Responsed Disease | Acute myocardial infarction [ICD-11: BA41] | |||
| Target Regulator | RNA demethylase ALKBH5 (ALKBH5) | ERASER | ||
| Cell Process | Lysosomal escape | |||
| In-vivo Model | Wild-type C57 (female, 12-16 weeks old), ALKBH5 /- mice (female and male, 12-16 weeks old), and SPF-grade SD rats (female, 180-230 g) were used to establish the AMI model.Sodium pentobarbital diluted to 10 mg/mL was used to anesthetize the mice or rat at the dose of 50 mg/kg through an intraperitoneal injection. By using a small animal ventilator with endotracheal intubation, thoracotomy was performed at the left fourth intercostal region. The heart was exposed, and the left anterior descending coronary artery (LCA) was occluded through a 6-0 silk suture that was placed 2-3 mm distal to the origin of the LCA with a slipknot. The apical region turned white, and ST segment elevation and T wave inversion of ECG showed that the AMI model was successfully established. Forty-five minutes after ischemia, the slipknot was released, and the ischemic region was reperfused. PBS (0.2 ml), HSSS (23.5 mg/kg, 0.2 ml), IOX1 (10 mg/kg, 0.2 ml), and HSSS-I (33.5 mg/kg, containing 10 mg/kg IOX1, 0.2 ml) were administered through caudal vein injection for 14 days at the frequency of one time per day. | |||
Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator
RNA modification
m6A Regulator: YTH domain-containing family protein 1 (YTHDF1)
| In total 1 item(s) under this m6A regulator | ||
| Crosstalk ID: M6ACROT00452 | ||
| Epigenetic Regulator | Double-stranded RNA-specific editase 1 (ADARB1) | |
| Regulated Target | MicroRNA 214 (MIR214) | |
| Crosstalk relationship | A-to-I → m6A | |
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00427)
| In total 14 m6A sequence/site(s) in this target gene | |||
| mod ID: A2ISITE000233 | Click to Show/Hide the Full List | ||
| mod site | chr3:196052949-196052950:- | [7] | |
| Sequence | GGCTCATTTTTTGTATTTTTAGTAGAAACGGAGTTTCACCA | ||
| Transcript ID List | ENST00000360110.9; ENST00000420415.5; ENST00000392396.7; ENST00000426789.5 | ||
| External Link | RMBase: RNA-editing_site_102120 | ||
| mod ID: A2ISITE000234 | Click to Show/Hide the Full List | ||
| mod site | chr3:196052955-196052956:- | [7] | |
| Sequence | ACGCCCGGCTCATTTTTTGTATTTTTAGTAGAAACGGAGTT | ||
| Transcript ID List | ENST00000392396.7; ENST00000426789.5; ENST00000420415.5; ENST00000360110.9 | ||
| External Link | RMBase: RNA-editing_site_102121 | ||
| mod ID: A2ISITE000235 | Click to Show/Hide the Full List | ||
| mod site | chr3:196057708-196057709:- | [8] | |
| Sequence | GGCTCACTGCAGCCTCAAGCAGTCCTCCCCCTTCAGCCTCC | ||
| Transcript ID List | ENST00000483983.5; ENST00000475593.5; ENST00000420415.5; ENST00000360110.9; ENST00000392396.7 | ||
| External Link | RMBase: RNA-editing_site_102122 | ||
| mod ID: A2ISITE000236 | Click to Show/Hide the Full List | ||
| mod site | chr3:196061735-196061736:- | [7] | |
| Sequence | AGCACTTGGGAGGCCAAGGCAGGCGGATCACCTGAGGTCAG | ||
| Transcript ID List | rmsk_1212614; ENST00000360110.9; ENST00000392396.7; ENST00000420415.5; ENST00000465288.5; ENST00000477148.1; ENST00000475593.5 | ||
| External Link | RMBase: RNA-editing_site_102123 | ||
| mod ID: A2ISITE000237 | Click to Show/Hide the Full List | ||
| mod site | chr3:196061874-196061875:- | [7] | |
| Sequence | GCCCCCAGATGAGTAGCATTAGGAACTGTTACGAATGCAAA | ||
| Transcript ID List | ENST00000420415.5; ENST00000475593.5; ENST00000465288.5; ENST00000392396.7; ENST00000360110.9; ENST00000477148.1; rmsk_1212615 | ||
| External Link | RMBase: RNA-editing_site_102124 | ||
| mod ID: A2ISITE000238 | Click to Show/Hide the Full List | ||
| mod site | chr3:196062326-196062327:- | [8] | |
| Sequence | GTTGGCCAGGATGGTCTCGAACTCCTGACCTCAGGCGATCT | ||
| Transcript ID List | ENST00000475593.5; ENST00000465288.5; ENST00000360110.9; ENST00000392396.7; ENST00000477148.1; ENST00000420415.5 | ||
| External Link | RMBase: RNA-editing_site_102125 | ||
| mod ID: A2ISITE000239 | Click to Show/Hide the Full List | ||
| mod site | chr3:196062410-196062411:- | [8] | |
| Sequence | CCTCCTGAGTAGCTGGGATTACAGGTGCTCACTACCACACC | ||
| Transcript ID List | ENST00000475593.5; ENST00000477148.1; ENST00000464368.1; ENST00000392396.7; ENST00000420415.5; ENST00000360110.9; ENST00000465288.5 | ||
| External Link | RMBase: RNA-editing_site_102126 | ||
| mod ID: A2ISITE000240 | Click to Show/Hide the Full List | ||
| mod site | chr3:196062488-196062489:- | [8] | |
| Sequence | CCAGGCTGGAGTGCAATGGCACGATCTCGGCTCACTGCAAC | ||
| Transcript ID List | ENST00000420415.5; ENST00000475593.5; ENST00000392396.7; ENST00000477148.1; ENST00000465288.5; ENST00000464368.1; ENST00000360110.9 | ||
| External Link | RMBase: RNA-editing_site_102127 | ||
| mod ID: A2ISITE000241 | Click to Show/Hide the Full List | ||
| mod site | chr3:196069074-196069075:- | [9] | |
| Sequence | ACCTGTAATCCCAACACTTTAGGAGGCTGAGGTGGGAGGAC | ||
| Transcript ID List | ENST00000360110.9; ENST00000392396.7; rmsk_1212630; ENST00000491658.1; ENST00000420415.5 | ||
| External Link | RMBase: RNA-editing_site_102128 | ||
| mod ID: A2ISITE000242 | Click to Show/Hide the Full List | ||
| mod site | chr3:196070503-196070504:- | [8] | |
| Sequence | TCCCAGCACTTTGGGAGTCCAAGGTGGGTGGATCACCTAAG | ||
| Transcript ID List | ENST00000360110.9; rmsk_1212631; ENST00000392396.7; ENST00000420415.5 | ||
| External Link | RMBase: RNA-editing_site_102129 | ||
| mod ID: A2ISITE000243 | Click to Show/Hide the Full List | ||
| mod site | chr3:196070694-196070695:- | [8] | |
| Sequence | TCAGGTGATTCACCACCCTCAGCCTCCCAAAGTGCTGGGAT | ||
| Transcript ID List | ENST00000392396.7; ENST00000420415.5; ENST00000360110.9 | ||
| External Link | RMBase: RNA-editing_site_102130 | ||
| mod ID: A2ISITE000244 | Click to Show/Hide the Full List | ||
| mod site | chr3:196070930-196070931:- | [10] | |
| Sequence | TTGTTTTGAGACAGGGTGTCACTCTGTTGCCCTAGCTGGAG | ||
| Transcript ID List | ENST00000360110.9; ENST00000392396.7; ENST00000420415.5 | ||
| External Link | RMBase: RNA-editing_site_102131 | ||
| mod ID: A2ISITE000245 | Click to Show/Hide the Full List | ||
| mod site | chr3:196071063-196071064:- | [7] | |
| Sequence | GGAGAATGCCTGACATACATAGTAGTATTTGCTAAACAAAT | ||
| Transcript ID List | rmsk_1212635; ENST00000360110.9; ENST00000420415.5; ENST00000392396.7 | ||
| External Link | RMBase: RNA-editing_site_102132 | ||
| mod ID: A2ISITE000246 | Click to Show/Hide the Full List | ||
| mod site | chr3:196077424-196077425:- | [7] | |
| Sequence | GAACATAGTGGTTCGTACTTATAATTGCAGCACTTTGGGAG | ||
| Transcript ID List | rmsk_1212648; ENST00000420415.5; ENST00000392396.7; ENST00000421258.1; ENST00000464011.1; ENST00000360110.9 | ||
| External Link | RMBase: RNA-editing_site_102133 | ||
2'-O-Methylation (2'-O-Me)
| In total 2 m6A sequence/site(s) in this target gene | |||
| mod ID: 2OMSITE000325 | Click to Show/Hide the Full List | ||
| mod site | chr3:196065558-196065559:- | [11] | |
| Sequence | CTCTGACTGGAAAACAGACTCTACATGTAGGATGGTAACCT | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | Nm-seq | ||
| Transcript ID List | ENST00000420415.5; ENST00000360110.9; ENST00000392396.7 | ||
| External Link | RMBase: Nm_site_5096 | ||
| mod ID: 2OMSITE000326 | Click to Show/Hide the Full List | ||
| mod site | chr3:196065572-196065573:- | [11] | |
| Sequence | GAAGGAGACTGTCCCTCTGACTGGAAAACAGACTCTACATG | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | Nm-seq | ||
| Transcript ID List | ENST00000420415.5; ENST00000392396.7; ENST00000360110.9 | ||
| External Link | RMBase: Nm_site_5097 | ||
N1-methyladenosine (m1A)
| In total 1 m6A sequence/site(s) in this target gene | |||
| mod ID: M1ASITE000090 | Click to Show/Hide the Full List | ||
| mod site | chr3:196082089-196082090:- | [12] | |
| Sequence | TTAGGGGCCGCCATCCCCTCAGAGCGTCGGGATATCGGGTG | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | m1A-MAP-seq | ||
| Transcript ID List | ENST00000360110.9; ENST00000420415.5; ENST00000421258.1; ENST00000392396.7; ENST00000464011.1 | ||
| External Link | RMBase: m1A_site_715 | ||
5-methylcytidine (m5C)
| In total 6 m6A sequence/site(s) in this target gene | |||
| mod ID: M5CSITE003223 | Click to Show/Hide the Full List | ||
| mod site | chr3:196050932-196050933:- | ||
| Sequence | TTAAATAAAAGCAGCATCTGCTAATAAAACCCAACAGATAC | ||
| Cell/Tissue List | T24 | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000426789.5; ENST00000420415.5; ENST00000360110.9; ENST00000392396.7 | ||
| External Link | RMBase: m5C_site_33392 | ||
| mod ID: M5CSITE003224 | Click to Show/Hide the Full List | ||
| mod site | chr3:196051294-196051295:- | [13] | |
| Sequence | CATTTATGAAAAGAGGGGACCAGAAGCCAAAGACTTAGTAT | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000392396.7; ENST00000426789.5; ENST00000360110.9; ENST00000420415.5 | ||
| External Link | RMBase: m5C_site_33393 | ||
| mod ID: M5CSITE003225 | Click to Show/Hide the Full List | ||
| mod site | chr3:196051980-196051981:- | [13] | |
| Sequence | ATTCAGGGAGCTGCAAATGCCCTCTCTGGTGACGTTTGGGA | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000426789.5; ENST00000360110.9; ENST00000392396.7; ENST00000420415.5 | ||
| External Link | RMBase: m5C_site_33394 | ||
| mod ID: M5CSITE003226 | Click to Show/Hide the Full List | ||
| mod site | chr3:196052121-196052122:- | [13] | |
| Sequence | TCTCCTTTCCGACATGTCTTCTGGGGCTCCGGCTCTCACAC | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000420415.5; ENST00000426789.5; ENST00000360110.9; ENST00000392396.7 | ||
| External Link | RMBase: m5C_site_33395 | ||
| mod ID: M5CSITE003227 | Click to Show/Hide the Full List | ||
| mod site | chr3:196069469-196069470:- | ||
| Sequence | ATTGTCAGAGCAGGGAAAATCACCTTTGCAGAAAAGGTGAG | ||
| Cell/Tissue List | T24 | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000420415.5; ENST00000491658.1; ENST00000392396.7; ENST00000360110.9 | ||
| External Link | RMBase: m5C_site_33396 | ||
| mod ID: M5CSITE003228 | Click to Show/Hide the Full List | ||
| mod site | chr3:196075165-196075166:- | [13] | |
| Sequence | ATTGCTGTGATCGTCTTTTTCTTGATTGGTGAGAATGACCA | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000421258.1; ENST00000420415.5; ENST00000464011.1; ENST00000360110.9; ENST00000392396.7 | ||
| External Link | RMBase: m5C_site_33397 | ||
N6-methyladenosine (m6A)
| In total 138 m6A sequence/site(s) in this target gene | |||
| mod ID: M6ASITE064269 | Click to Show/Hide the Full List | ||
| mod site | chr3:196049289-196049290:- | [14] | |
| Sequence | TGATTTAATAAAATACTTAAACACTGAGTTGTCATTTCTTT | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa; hESC-HEK293T | ||
| Seq Type List | m6A-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000420415.5; ENST00000426789.5; ENST00000360110.9 | ||
| External Link | RMBase: m6A_site_624039 | ||
| mod ID: M6ASITE064270 | Click to Show/Hide the Full List | ||
| mod site | chr3:196049374-196049375:- | [15] | |
| Sequence | ATTTTAGACTTTCTTTGTAAACAAATGATATGTCCTTATCA | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000360110.9; ENST00000426789.5; ENST00000420415.5 | ||
| External Link | RMBase: m6A_site_624040 | ||
| mod ID: M6ASITE064271 | Click to Show/Hide the Full List | ||
| mod site | chr3:196049387-196049388:- | [16] | |
| Sequence | GAATGTTCTTGAAATTTTAGACTTTCTTTGTAAACAAATGA | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000426789.5; ENST00000360110.9; ENST00000420415.5 | ||
| External Link | RMBase: m6A_site_624041 | ||
| mod ID: M6ASITE064272 | Click to Show/Hide the Full List | ||
| mod site | chr3:196049423-196049424:- | [16] | |
| Sequence | CTAGAACTTGCATGACCTTTACTGTGTTAGCTCTTTGAATG | ||
| Motif Score | 2.494845238 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000420415.5; ENST00000426789.5; ENST00000360110.9 | ||
| External Link | RMBase: m6A_site_624042 | ||
| mod ID: M6ASITE064273 | Click to Show/Hide the Full List | ||
| mod site | chr3:196049429-196049430:- | [16] | |
| Sequence | ACTATTCTAGAACTTGCATGACCTTTACTGTGTTAGCTCTT | ||
| Motif Score | 2.839113095 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000420415.5; ENST00000426789.5; ENST00000360110.9 | ||
| External Link | RMBase: m6A_site_624043 | ||
| mod ID: M6ASITE064274 | Click to Show/Hide the Full List | ||
| mod site | chr3:196049537-196049538:- | [17] | |
| Sequence | AATGAAATATCAGACTAGTGACAAGCTCCTGGTCTTGAGAT | ||
| Motif Score | 2.859755952 | ||
| Cell/Tissue List | kidney; hESC-HEK293T | ||
| Seq Type List | m6A-REF-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000392396.7; ENST00000360110.9; ENST00000426789.5; ENST00000420415.5 | ||
| External Link | RMBase: m6A_site_624044 | ||
| mod ID: M6ASITE064275 | Click to Show/Hide the Full List | ||
| mod site | chr3:196049544-196049545:- | [14] | |
| Sequence | ATTCCTGAATGAAATATCAGACTAGTGACAAGCTCCTGGTC | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000392396.7; ENST00000426789.5; ENST00000420415.5; ENST00000360110.9 | ||
| External Link | RMBase: m6A_site_624045 | ||
| mod ID: M6ASITE064276 | Click to Show/Hide the Full List | ||
| mod site | chr3:196049618-196049619:- | [16] | |
| Sequence | TCTTCAGAAAACCCTTTTCTACAGTTAGGGTTGAGTTACTT | ||
| Motif Score | 2.078666667 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000360110.9; ENST00000392396.7; ENST00000426789.5; ENST00000420415.5 | ||
| External Link | RMBase: m6A_site_624046 | ||
| mod ID: M6ASITE064277 | Click to Show/Hide the Full List | ||
| mod site | chr3:196049628-196049629:- | [14] | |
| Sequence | GCAGTGAGTCTCTTCAGAAAACCCTTTTCTACAGTTAGGGT | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000392396.7; ENST00000426789.5; ENST00000420415.5; ENST00000360110.9 | ||
| External Link | RMBase: m6A_site_624047 | ||
| mod ID: M6ASITE064278 | Click to Show/Hide the Full List | ||
| mod site | chr3:196049678-196049679:- | [16] | |
| Sequence | TGGCATGTTCATCGTATAACACAATATGAATACAGGGCATG | ||
| Motif Score | 2.084928571 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000426789.5; ENST00000420415.5; ENST00000392396.7; ENST00000360110.9 | ||
| External Link | RMBase: m6A_site_624048 | ||
| mod ID: M6ASITE064279 | Click to Show/Hide the Full List | ||
| mod site | chr3:196049680-196049681:- | [15] | |
| Sequence | TGTGGCATGTTCATCGTATAACACAATATGAATACAGGGCA | ||
| Motif Score | 2.168095238 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000392396.7; ENST00000426789.5; ENST00000360110.9; ENST00000420415.5 | ||
| External Link | RMBase: m6A_site_624049 | ||
| mod ID: M6ASITE064280 | Click to Show/Hide the Full List | ||
| mod site | chr3:196049715-196049716:- | [16] | |
| Sequence | TTCGGGTGTTACGCACACGTACTTAAATGAAAGCATGTGGC | ||
| Motif Score | 3.278136905 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000420415.5; ENST00000426789.5; ENST00000392396.7; ENST00000360110.9 | ||
| External Link | RMBase: m6A_site_624050 | ||
| mod ID: M6ASITE064281 | Click to Show/Hide the Full List | ||
| mod site | chr3:196049721-196049722:- | [15] | |
| Sequence | TCCTGGTTCGGGTGTTACGCACACGTACTTAAATGAAAGCA | ||
| Motif Score | 2.830589286 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000392396.7; ENST00000420415.5; ENST00000360110.9; ENST00000426789.5 | ||
| External Link | RMBase: m6A_site_624051 | ||
| mod ID: M6ASITE064282 | Click to Show/Hide the Full List | ||
| mod site | chr3:196049780-196049781:- | [17] | |
| Sequence | TCCTCTTTTATCTTGGACTGACATTTAGCGTAGCTAAGTGA | ||
| Motif Score | 2.859755952 | ||
| Cell/Tissue List | brain; HEK293T; hESC-HEK293T | ||
| Seq Type List | m6A-REF-seq; DART-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000420415.5; ENST00000426789.5; ENST00000392396.7; ENST00000360110.9 | ||
| External Link | RMBase: m6A_site_624052 | ||
| mod ID: M6ASITE064283 | Click to Show/Hide the Full List | ||
| mod site | chr3:196049784-196049785:- | [16] | |
| Sequence | AATCTCCTCTTTTATCTTGGACTGACATTTAGCGTAGCTAA | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000420415.5; ENST00000392396.7; ENST00000360110.9; ENST00000426789.5 | ||
| External Link | RMBase: m6A_site_624053 | ||
| mod ID: M6ASITE064284 | Click to Show/Hide the Full List | ||
| mod site | chr3:196049834-196049835:- | [17] | |
| Sequence | ACTTGAATGTGTCACTACTCACAGTCTCTTTAATCTTCAGT | ||
| Motif Score | 2.047297619 | ||
| Cell/Tissue List | HEK293 | ||
| Seq Type List | m6A-REF-seq | ||
| Transcript ID List | ENST00000426789.5; ENST00000392396.7; ENST00000420415.5; ENST00000360110.9 | ||
| External Link | RMBase: m6A_site_624054 | ||
| mod ID: M6ASITE064285 | Click to Show/Hide the Full List | ||
| mod site | chr3:196049838-196049839:- | [16] | |
| Sequence | CCTCACTTGAATGTGTCACTACTCACAGTCTCTTTAATCTT | ||
| Motif Score | 2.500660714 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000420415.5; ENST00000360110.9; ENST00000392396.7; ENST00000426789.5 | ||
| External Link | RMBase: m6A_site_624055 | ||
| mod ID: M6ASITE064286 | Click to Show/Hide the Full List | ||
| mod site | chr3:196049854-196049855:- | [16] | |
| Sequence | TTACCTAGATTTACAGCCTCACTTGAATGTGTCACTACTCA | ||
| Motif Score | 2.469291667 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000426789.5; ENST00000392396.7; ENST00000360110.9; ENST00000420415.5 | ||
| External Link | RMBase: m6A_site_624056 | ||
| mod ID: M6ASITE064287 | Click to Show/Hide the Full List | ||
| mod site | chr3:196049862-196049863:- | [17] | |
| Sequence | AGTGTCACTTACCTAGATTTACAGCCTCACTTGAATGTGTC | ||
| Motif Score | 2.07285119 | ||
| Cell/Tissue List | kidney; HEK293T | ||
| Seq Type List | m6A-REF-seq; DART-seq | ||
| Transcript ID List | ENST00000420415.5; ENST00000426789.5; ENST00000360110.9; ENST00000392396.7 | ||
| External Link | RMBase: m6A_site_624057 | ||
| mod ID: M6ASITE064288 | Click to Show/Hide the Full List | ||
| mod site | chr3:196049872-196049873:- | [16] | |
| Sequence | TCAGGTTCTTAGTGTCACTTACCTAGATTTACAGCCTCACT | ||
| Motif Score | 2.052208333 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000392396.7; ENST00000426789.5; ENST00000420415.5; ENST00000360110.9 | ||
| External Link | RMBase: m6A_site_624058 | ||
| mod ID: M6ASITE064289 | Click to Show/Hide the Full List | ||
| mod site | chr3:196049925-196049926:- | [16] | |
| Sequence | TTGTCATAGGGCAGTTGGAAACGGCCTCCTAGGGAAAAGTT | ||
| Motif Score | 2.179660714 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000426789.5; ENST00000420415.5; ENST00000360110.9; ENST00000392396.7 | ||
| External Link | RMBase: m6A_site_624059 | ||
| mod ID: M6ASITE064290 | Click to Show/Hide the Full List | ||
| mod site | chr3:196050046-196050047:- | [15] | |
| Sequence | GAGAGTCCCCTGAAGGTCTGACACGTCTGCCTACCCATTCG | ||
| Motif Score | 2.859755952 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000392396.7; ENST00000426789.5; ENST00000360110.9; ENST00000420415.5 | ||
| External Link | RMBase: m6A_site_624060 | ||
| mod ID: M6ASITE064291 | Click to Show/Hide the Full List | ||
| mod site | chr3:196050100-196050101:- | [14] | |
| Sequence | TTTTGACTTAAAGCAGAGGGACTTTGTATAGAAGGTTTGGG | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000426789.5; ENST00000360110.9; ENST00000392396.7; ENST00000420415.5 | ||
| External Link | RMBase: m6A_site_624061 | ||
| mod ID: M6ASITE064292 | Click to Show/Hide the Full List | ||
| mod site | chr3:196050115-196050116:- | [16] | |
| Sequence | AATCCAGAATTGACCTTTTGACTTAAAGCAGAGGGACTTTG | ||
| Motif Score | 3.28175 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000360110.9; ENST00000420415.5; ENST00000392396.7; ENST00000426789.5 | ||
| External Link | RMBase: m6A_site_624062 | ||
| mod ID: M6ASITE064293 | Click to Show/Hide the Full List | ||
| mod site | chr3:196050123-196050124:- | [16] | |
| Sequence | CAAGTTTTAATCCAGAATTGACCTTTTGACTTAAAGCAGAG | ||
| Motif Score | 2.839113095 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000392396.7; ENST00000360110.9; ENST00000420415.5; ENST00000426789.5 | ||
| External Link | RMBase: m6A_site_624063 | ||
| mod ID: M6ASITE064294 | Click to Show/Hide the Full List | ||
| mod site | chr3:196050144-196050145:- | [14] | |
| Sequence | CTCCTATAAACTTAGTGCGGACAAGTTTTAATCCAGAATTG | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; HEK293T; hESC-HEK293T | ||
| Seq Type List | m6A-seq; DART-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000420415.5; ENST00000360110.9; ENST00000392396.7; ENST00000426789.5 | ||
| External Link | RMBase: m6A_site_624064 | ||
| mod ID: M6ASITE064295 | Click to Show/Hide the Full List | ||
| mod site | chr3:196050155-196050156:- | [14] | |
| Sequence | TTGCATGTTACCTCCTATAAACTTAGTGCGGACAAGTTTTA | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa; HEK293T | ||
| Seq Type List | m6A-seq; DART-seq | ||
| Transcript ID List | ENST00000426789.5; ENST00000420415.5; ENST00000392396.7; ENST00000360110.9 | ||
| External Link | RMBase: m6A_site_624065 | ||
| mod ID: M6ASITE064296 | Click to Show/Hide the Full List | ||
| mod site | chr3:196050182-196050183:- | [16] | |
| Sequence | CAAGTCATTTTAACTTTATCACATTATTTGCATGTTACCTC | ||
| Motif Score | 2.047297619 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000392396.7; ENST00000420415.5; ENST00000360110.9; ENST00000426789.5 | ||
| External Link | RMBase: m6A_site_624066 | ||
| mod ID: M6ASITE064297 | Click to Show/Hide the Full List | ||
| mod site | chr3:196050190-196050191:- | [16] | |
| Sequence | GCTATTGACAAGTCATTTTAACTTTATCACATTATTTGCAT | ||
| Motif Score | 2.590089286 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000426789.5; ENST00000392396.7; ENST00000360110.9; ENST00000420415.5 | ||
| External Link | RMBase: m6A_site_624067 | ||
| mod ID: M6ASITE064298 | Click to Show/Hide the Full List | ||
| mod site | chr3:196050203-196050204:- | [16] | |
| Sequence | ATTTATAATGTTTGCTATTGACAAGTCATTTTAACTTTATC | ||
| Motif Score | 2.859755952 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000420415.5; ENST00000392396.7; ENST00000426789.5; ENST00000360110.9 | ||
| External Link | RMBase: m6A_site_624068 | ||
| mod ID: M6ASITE064299 | Click to Show/Hide the Full List | ||
| mod site | chr3:196050225-196050226:- | [15] | |
| Sequence | ACTTAATGAGATAGTAGCATACATTTATAATGTTTGCTATT | ||
| Motif Score | 2.110482143 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000420415.5; ENST00000426789.5; ENST00000360110.9; ENST00000392396.7 | ||
| External Link | RMBase: m6A_site_624069 | ||
| mod ID: M6ASITE064300 | Click to Show/Hide the Full List | ||
| mod site | chr3:196050245-196050246:- | [16] | |
| Sequence | ATGGTTTCTCCAGGTCCTCTACTTAATGAGATAGTAGCATA | ||
| Motif Score | 2.500660714 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000392396.7; ENST00000420415.5; ENST00000360110.9; ENST00000426789.5 | ||
| External Link | RMBase: m6A_site_624070 | ||
| mod ID: M6ASITE064301 | Click to Show/Hide the Full List | ||
| mod site | chr3:196050271-196050272:- | [16] | |
| Sequence | ATTTAGCTTGGGTTTTTGTTACCTTTATGGTTTCTCCAGGT | ||
| Motif Score | 2.052208333 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000426789.5; ENST00000420415.5; ENST00000360110.9; ENST00000392396.7 | ||
| External Link | RMBase: m6A_site_624071 | ||
| mod ID: M6ASITE064302 | Click to Show/Hide the Full List | ||
| mod site | chr3:196050303-196050304:- | [16] | |
| Sequence | CACTGTAAAATGAAATTACTACAAAATTTGAAATTTAGCTT | ||
| Motif Score | 2.078666667 | ||
| Cell/Tissue List | HEK293T; hESC-HEK293T | ||
| Seq Type List | DART-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000420415.5; ENST00000426789.5; ENST00000360110.9; ENST00000392396.7 | ||
| External Link | RMBase: m6A_site_624072 | ||
| mod ID: M6ASITE064303 | Click to Show/Hide the Full List | ||
| mod site | chr3:196050306-196050307:- | [16] | |
| Sequence | AACCACTGTAAAATGAAATTACTACAAAATTTGAAATTTAG | ||
| Motif Score | 2.494845238 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000392396.7; ENST00000420415.5; ENST00000426789.5; ENST00000360110.9 | ||
| External Link | RMBase: m6A_site_624073 | ||
| mod ID: M6ASITE064304 | Click to Show/Hide the Full List | ||
| mod site | chr3:196050363-196050364:- | [14] | |
| Sequence | TTTTAGTTTTAGTTGCAGAAACATTTTGTGGTCATTAAGCA | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa; HEK293T; hESC-HEK293T | ||
| Seq Type List | m6A-seq; DART-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000420415.5; ENST00000426789.5; ENST00000360110.9; ENST00000392396.7 | ||
| External Link | RMBase: m6A_site_624074 | ||
| mod ID: M6ASITE064305 | Click to Show/Hide the Full List | ||
| mod site | chr3:196050414-196050415:- | [16] | |
| Sequence | TTGAAGATCGTTAGTATCTAACATGTATCCCAACTCCTATA | ||
| Motif Score | 2.168095238 | ||
| Cell/Tissue List | HEK293T; hESC-HEK293T | ||
| Seq Type List | DART-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000426789.5; ENST00000392396.7; ENST00000420415.5; ENST00000360110.9 | ||
| External Link | RMBase: m6A_site_624075 | ||
| mod ID: M6ASITE064306 | Click to Show/Hide the Full List | ||
| mod site | chr3:196050447-196050448:- | [16] | |
| Sequence | ATAATTTTCTTCATGCAATGACATCTTCAAAGCTTGAAGAT | ||
| Motif Score | 2.859755952 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000392396.7; ENST00000426789.5; ENST00000360110.9; ENST00000420415.5 | ||
| External Link | RMBase: m6A_site_624076 | ||
| mod ID: M6ASITE064307 | Click to Show/Hide the Full List | ||
| mod site | chr3:196050479-196050480:- | [14] | |
| Sequence | GGTGTAAGTAATTATCGGGAACAGTGTTTCCCATAATTTTC | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000426789.5; ENST00000392396.7; ENST00000360110.9; ENST00000420415.5 | ||
| External Link | RMBase: m6A_site_624077 | ||
| mod ID: M6ASITE064308 | Click to Show/Hide the Full List | ||
| mod site | chr3:196050507-196050508:- | [16] | |
| Sequence | GACAGTGATCTCCATATGTTACACTAAGGGTGTAAGTAATT | ||
| Motif Score | 2.07285119 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000420415.5; ENST00000392396.7; ENST00000426789.5; ENST00000360110.9 | ||
| External Link | RMBase: m6A_site_624078 | ||
| mod ID: M6ASITE064309 | Click to Show/Hide the Full List | ||
| mod site | chr3:196050526-196050527:- | [14] | |
| Sequence | CCACAGTGTCTGTATCGGAGACAGTGATCTCCATATGTTAC | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000426789.5; ENST00000420415.5; ENST00000392396.7; ENST00000360110.9 | ||
| External Link | RMBase: m6A_site_624079 | ||
| mod ID: M6ASITE064310 | Click to Show/Hide the Full List | ||
| mod site | chr3:196050565-196050566:- | [14] | |
| Sequence | TCTTCCATAATGTATAAAGAACAAGGTAGTTTTTACCTACC | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa; HEK293T | ||
| Seq Type List | m6A-seq; DART-seq | ||
| Transcript ID List | ENST00000360110.9; ENST00000420415.5; ENST00000426789.5; ENST00000392396.7 | ||
| External Link | RMBase: m6A_site_624080 | ||
| mod ID: M6ASITE064311 | Click to Show/Hide the Full List | ||
| mod site | chr3:196050614-196050615:- | [15] | |
| Sequence | AAATTTCCAGTACCTTTGTCACAATCCTAACACATTATCGG | ||
| Motif Score | 2.047297619 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000426789.5; ENST00000392396.7; ENST00000420415.5; ENST00000360110.9 | ||
| External Link | RMBase: m6A_site_624081 | ||
| mod ID: M6ASITE064312 | Click to Show/Hide the Full List | ||
| mod site | chr3:196050868-196050869:- | [14] | |
| Sequence | ACACTTAAGGGTTTTAGAAAACAGCCGTCAGCCAAATGTAA | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000420415.5; ENST00000392396.7; ENST00000426789.5; ENST00000360110.9 | ||
| External Link | RMBase: m6A_site_624082 | ||
| mod ID: M6ASITE064313 | Click to Show/Hide the Full List | ||
| mod site | chr3:196050924-196050925:- | [14] | |
| Sequence | AAGCAGCATCTGCTAATAAAACCCAACAGATACTGGAAGTT | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000392396.7; ENST00000426789.5; ENST00000360110.9; ENST00000420415.5 | ||
| External Link | RMBase: m6A_site_624083 | ||
| mod ID: M6ASITE064314 | Click to Show/Hide the Full List | ||
| mod site | chr3:196051045-196051046:- | [16] | |
| Sequence | TTATTGTTTATTTATCAGTGACAGAGTTCACTATAAATGGT | ||
| Motif Score | 2.859755952 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000360110.9; ENST00000392396.7; ENST00000426789.5; ENST00000420415.5 | ||
| External Link | RMBase: m6A_site_624084 | ||
| mod ID: M6ASITE064315 | Click to Show/Hide the Full List | ||
| mod site | chr3:196051149-196051150:- | [14] | |
| Sequence | TTGCAGACTCAGTTTGTCAGACTTTAAAGAATAATATGCTG | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa; HEK293T | ||
| Seq Type List | m6A-seq; DART-seq | ||
| Transcript ID List | ENST00000392396.7; ENST00000420415.5; ENST00000360110.9; ENST00000426789.5 | ||
| External Link | RMBase: m6A_site_624085 | ||
| mod ID: M6ASITE064316 | Click to Show/Hide the Full List | ||
| mod site | chr3:196051163-196051164:- | [14] | |
| Sequence | TTTCAGGTGTTTAGTTGCAGACTCAGTTTGTCAGACTTTAA | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa; HEK293T | ||
| Seq Type List | m6A-seq; DART-seq | ||
| Transcript ID List | ENST00000392396.7; ENST00000426789.5; ENST00000420415.5; ENST00000360110.9 | ||
| External Link | RMBase: m6A_site_624086 | ||
| mod ID: M6ASITE064317 | Click to Show/Hide the Full List | ||
| mod site | chr3:196051188-196051189:- | [14] | |
| Sequence | CCAAAGCACATTGAAAGAGAACCAGTTTCAGGTGTTTAGTT | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HeLa; HEK293T | ||
| Seq Type List | m6A-seq; DART-seq | ||
| Transcript ID List | ENST00000426789.5; ENST00000360110.9; ENST00000392396.7; ENST00000420415.5 | ||
| External Link | RMBase: m6A_site_624087 | ||
| mod ID: M6ASITE064318 | Click to Show/Hide the Full List | ||
| mod site | chr3:196051201-196051202:- | [15] | |
| Sequence | ATTTTTGTTTCTTCCAAAGCACATTGAAAGAGAACCAGTTT | ||
| Motif Score | 2.830589286 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000426789.5; ENST00000420415.5; ENST00000360110.9; ENST00000392396.7 | ||
| External Link | RMBase: m6A_site_624088 | ||
| mod ID: M6ASITE064319 | Click to Show/Hide the Full List | ||
| mod site | chr3:196051282-196051283:- | [16] | |
| Sequence | GAGGGGACCAGAAGCCAAAGACTTAGTATATTTTCTTTTCC | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000392396.7; ENST00000360110.9; ENST00000420415.5; ENST00000426789.5 | ||
| External Link | RMBase: m6A_site_624089 | ||
| mod ID: M6ASITE064320 | Click to Show/Hide the Full List | ||
| mod site | chr3:196051324-196051325:- | [16] | |
| Sequence | AATAAGGCCTTAATATGTTAACCTCAGTGTCATTTATGAAA | ||
| Motif Score | 2.147452381 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000420415.5; ENST00000360110.9; ENST00000426789.5; ENST00000392396.7 | ||
| External Link | RMBase: m6A_site_624090 | ||
| mod ID: M6ASITE064321 | Click to Show/Hide the Full List | ||
| mod site | chr3:196051445-196051446:- | [16] | |
| Sequence | TTTCCTCATTCCTGAAAGAAACAGTTAACTTTCAGAAGAGA | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000420415.5; ENST00000360110.9; ENST00000426789.5; ENST00000392396.7 | ||
| External Link | RMBase: m6A_site_624091 | ||
| mod ID: M6ASITE064322 | Click to Show/Hide the Full List | ||
| mod site | chr3:196051525-196051526:- | [16] | |
| Sequence | TTTGATGCTAAATAGGAGATACCAGGTTGAAAGACCTTCTC | ||
| Motif Score | 2.089839286 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000392396.7; ENST00000360110.9; ENST00000420415.5; ENST00000426789.5 | ||
| External Link | RMBase: m6A_site_624092 | ||
| mod ID: M6ASITE064323 | Click to Show/Hide the Full List | ||
| mod site | chr3:196051569-196051570:- | [16] | |
| Sequence | AAGGTTGTAAGTGGTCGCTTACTTTGAGTGATCCTCCAACT | ||
| Motif Score | 2.494845238 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000360110.9; ENST00000392396.7; ENST00000420415.5; ENST00000426789.5 | ||
| External Link | RMBase: m6A_site_624093 | ||
| mod ID: M6ASITE064324 | Click to Show/Hide the Full List | ||
| mod site | chr3:196051638-196051639:- | [14] | |
| Sequence | TGTTAATGAAAATGTCAGAAACCAGTTATGTGAATGATCTC | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000420415.5; ENST00000392396.7; ENST00000426789.5; ENST00000360110.9 | ||
| External Link | RMBase: m6A_site_624094 | ||
| mod ID: M6ASITE064325 | Click to Show/Hide the Full List | ||
| mod site | chr3:196051677-196051678:- | [14] | |
| Sequence | TTAAGTGCTTTGTAATGGGAACTGCCTCTTTCCTGTTGTTG | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa; HEK293T | ||
| Seq Type List | m6A-seq; DART-seq | ||
| Transcript ID List | ENST00000420415.5; ENST00000360110.9; ENST00000426789.5; ENST00000392396.7 | ||
| External Link | RMBase: m6A_site_624095 | ||
| mod ID: M6ASITE064326 | Click to Show/Hide the Full List | ||
| mod site | chr3:196051745-196051746:- | [16] | |
| Sequence | ACTTCAAGTTAAAGTGAATAACCACTTAAAAAATGTCCATG | ||
| Motif Score | 2.147452381 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000426789.5; ENST00000420415.5; ENST00000392396.7; ENST00000360110.9 | ||
| External Link | RMBase: m6A_site_624096 | ||
| mod ID: M6ASITE064327 | Click to Show/Hide the Full List | ||
| mod site | chr3:196051816-196051817:- | [16] | |
| Sequence | TTCCATCCCATCATCTTGGTACTACTAGATGTCTTTAGGCA | ||
| Motif Score | 3.278136905 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000360110.9; ENST00000420415.5; ENST00000392396.7; ENST00000426789.5 | ||
| External Link | RMBase: m6A_site_624097 | ||
| mod ID: M6ASITE064328 | Click to Show/Hide the Full List | ||
| mod site | chr3:196051850-196051851:- | [14] | |
| Sequence | ATTTTCAGTAGGGCTACAAAACCTGATGTTAAAATTCCATC | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa; HEK293T; A549; HepG2; GM12878; LCLs; iSLK; MSC; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000420415.5; ENST00000392396.7; ENST00000360110.9; ENST00000426789.5 | ||
| External Link | RMBase: m6A_site_624098 | ||
| mod ID: M6ASITE064329 | Click to Show/Hide the Full List | ||
| mod site | chr3:196051855-196051856:- | [16] | |
| Sequence | GCTAAATTTTCAGTAGGGCTACAAAACCTGATGTTAAAATT | ||
| Motif Score | 2.078666667 | ||
| Cell/Tissue List | HEK293T; hESC-HEK293T | ||
| Seq Type List | DART-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000360110.9; ENST00000392396.7; ENST00000426789.5; ENST00000420415.5 | ||
| External Link | RMBase: m6A_site_624099 | ||
| mod ID: M6ASITE064330 | Click to Show/Hide the Full List | ||
| mod site | chr3:196051890-196051891:- | [14] | |
| Sequence | CAGGGTAGTCTGGTTTCTAGACTTGTGCTGATCGTGCTAAA | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa; HEK293T; A549; HepG2; H1A; H1B; fibroblasts; GM12878; LCLs; H1299; Jurkat; iSLK; MSC; TREX; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000392396.7; ENST00000420415.5; ENST00000426789.5; ENST00000360110.9 | ||
| External Link | RMBase: m6A_site_624100 | ||
| mod ID: M6ASITE064331 | Click to Show/Hide the Full List | ||
| mod site | chr3:196051914-196051915:- | [14] | |
| Sequence | TACCCATAGCTTCCATGAGAACAGCAGGGTAGTCTGGTTTC | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa; HEK293T; A549; HepG2; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; Jurkat; CD4T; HEK293A-TOA; iSLK; MSC; TREX; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000360110.9; ENST00000426789.5; ENST00000392396.7; ENST00000420415.5 | ||
| External Link | RMBase: m6A_site_624101 | ||
| mod ID: M6ASITE064332 | Click to Show/Hide the Full List | ||
| mod site | chr3:196051954-196051955:- | [16] | |
| Sequence | TGGTGACGTTTGGGACATTGACAATGAGTTTTAAATGTGAT | ||
| Motif Score | 2.859755952 | ||
| Cell/Tissue List | HEK293T; hESC-HEK293T; A549 | ||
| Seq Type List | DART-seq; MAZTER-seq; m6A-CLIP/IP | ||
| Transcript ID List | ENST00000360110.9; ENST00000426789.5; ENST00000392396.7; ENST00000420415.5 | ||
| External Link | RMBase: m6A_site_624102 | ||
| mod ID: M6ASITE064333 | Click to Show/Hide the Full List | ||
| mod site | chr3:196051960-196051961:- | [14] | |
| Sequence | CCTCTCTGGTGACGTTTGGGACATTGACAATGAGTTTTAAA | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; HEK293T; kidney; A549; hESC-HEK293T; HepG2; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Jurkat; CD4T; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq; m6A-REF-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000392396.7; ENST00000420415.5; ENST00000426789.5; ENST00000360110.9 | ||
| External Link | RMBase: m6A_site_624103 | ||
| mod ID: M6ASITE064334 | Click to Show/Hide the Full List | ||
| mod site | chr3:196051969-196051970:- | [16] | |
| Sequence | TGCAAATGCCCTCTCTGGTGACGTTTGGGACATTGACAATG | ||
| Motif Score | 2.833690476 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000360110.9; ENST00000426789.5; ENST00000392396.7; ENST00000420415.5 | ||
| External Link | RMBase: m6A_site_624104 | ||
| mod ID: M6ASITE064335 | Click to Show/Hide the Full List | ||
| mod site | chr3:196052003-196052004:- | [14] | |
| Sequence | AGTTGGCTCTAGCTACTTGGACTATTCAGGGAGCTGCAAAT | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa; HEK293T; A549; HepG2; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Jurkat; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; AML | ||
| Seq Type List | m6A-seq; MeRIP-seq; m6A-CLIP/IP; miCLIP | ||
| Transcript ID List | ENST00000392396.7; ENST00000420415.5; ENST00000426789.5; ENST00000360110.9 | ||
| External Link | RMBase: m6A_site_624105 | ||
| mod ID: M6ASITE064336 | Click to Show/Hide the Full List | ||
| mod site | chr3:196052026-196052027:- | [14] | |
| Sequence | TAATGAAACGCTGTTCAGAAACCAGTTGGCTCTAGCTACTT | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa; HEK293T; A549; HepG2; H1B; H1A; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Jurkat; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000420415.5; ENST00000426789.5; ENST00000360110.9; ENST00000392396.7 | ||
| External Link | RMBase: m6A_site_624106 | ||
| mod ID: M6ASITE064337 | Click to Show/Hide the Full List | ||
| mod site | chr3:196052064-196052065:- | [14] | |
| Sequence | GAGAACTTGAAACTGCGTAAACAAAATAACGGTGCTTTTAA | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa; HEK293T; A549; hESC-HEK293T; HepG2; hNPCs; fibroblasts; GM12878; LCLs; MM6; Jurkat; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000360110.9; ENST00000392396.7; ENST00000420415.5; ENST00000426789.5 | ||
| External Link | RMBase: m6A_site_624107 | ||
| mod ID: M6ASITE064338 | Click to Show/Hide the Full List | ||
| mod site | chr3:196052073-196052074:- | [14] | |
| Sequence | GCTTTACTGGAGAACTTGAAACTGCGTAAACAAAATAACGG | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa; HEK293T; A549; HepG2; hNPCs; fibroblasts; GM12878; LCLs; MM6; Jurkat; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000420415.5; ENST00000426789.5; ENST00000360110.9; ENST00000392396.7 | ||
| External Link | RMBase: m6A_site_624108 | ||
| mod ID: M6ASITE064339 | Click to Show/Hide the Full List | ||
| mod site | chr3:196052080-196052081:- | [14] | |
| Sequence | GCTGCCAGCTTTACTGGAGAACTTGAAACTGCGTAAACAAA | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa; HEK293T; A549; HepG2; hNPCs; fibroblasts; GM12878; LCLs; MM6; Jurkat; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000392396.7; ENST00000426789.5; ENST00000360110.9; ENST00000420415.5 | ||
| External Link | RMBase: m6A_site_624109 | ||
| mod ID: M6ASITE064340 | Click to Show/Hide the Full List | ||
| mod site | chr3:196052104-196052105:- | [15] | |
| Sequence | CTTCTGGGGCTCCGGCTCTCACACGCTGCCAGCTTTACTGG | ||
| Motif Score | 2.047297619 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000420415.5; ENST00000392396.7; ENST00000426789.5; ENST00000360110.9 | ||
| External Link | RMBase: m6A_site_624110 | ||
| mod ID: M6ASITE064341 | Click to Show/Hide the Full List | ||
| mod site | chr3:196052130-196052131:- | [15] | |
| Sequence | CCAAAAGAGTCTCCTTTCCGACATGTCTTCTGGGGCTCCGG | ||
| Motif Score | 2.865571429 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000426789.5; ENST00000392396.7; ENST00000420415.5; ENST00000360110.9 | ||
| External Link | RMBase: m6A_site_624111 | ||
| mod ID: M6ASITE064342 | Click to Show/Hide the Full List | ||
| mod site | chr3:196053438-196053439:- | [14] | |
| Sequence | GACAGATTTGTCATGAAGAAACTCAATGATCGTGTCATGAG | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa; HepG2 | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000360110.9; ENST00000420415.5; ENST00000392396.7; ENST00000426789.5 | ||
| External Link | RMBase: m6A_site_624112 | ||
| mod ID: M6ASITE064343 | Click to Show/Hide the Full List | ||
| mod site | chr3:196053461-196053462:- | [14] | |
| Sequence | ATTTCGGGAATGCTGAGAAAACAGACAGATTTGTCATGAAG | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa; HepG2 | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000360110.9; ENST00000426789.5; ENST00000392396.7; ENST00000420415.5 | ||
| External Link | RMBase: m6A_site_624113 | ||
| mod ID: M6ASITE064344 | Click to Show/Hide the Full List | ||
| mod site | chr3:196053488-196053489:- | [15] | |
| Sequence | TCCGTGCTACTTCCAGACTAACAACAGATTTCGGGAATGCT | ||
| Motif Score | 2.168095238 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000360110.9; ENST00000392396.7; ENST00000420415.5; ENST00000426789.5 | ||
| External Link | RMBase: m6A_site_624114 | ||
| mod ID: M6ASITE064345 | Click to Show/Hide the Full List | ||
| mod site | chr3:196053492-196053493:- | [14] | |
| Sequence | TTCTTCCGTGCTACTTCCAGACTAACAACAGATTTCGGGAA | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa; HepG2 | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000360110.9; ENST00000420415.5; ENST00000463047.1; ENST00000426789.5; ENST00000392396.7 | ||
| External Link | RMBase: m6A_site_624115 | ||
| mod ID: M6ASITE064346 | Click to Show/Hide the Full List | ||
| mod site | chr3:196053514-196053515:- | [14] | |
| Sequence | GCTGTATTCTGCTCGTGGAGACTTCTTCCGTGCTACTTCCA | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000463047.1; ENST00000360110.9; ENST00000426789.5; ENST00000392396.7; ENST00000475593.5; ENST00000420415.5 | ||
| External Link | RMBase: m6A_site_624116 | ||
| mod ID: M6ASITE064347 | Click to Show/Hide the Full List | ||
| mod site | chr3:196053540-196053541:- | [17] | |
| Sequence | CAGGAAATGGGCCTGAGTTTACAGTGGCTGTATTCTGCTCG | ||
| Motif Score | 2.07285119 | ||
| Cell/Tissue List | brain; HEK293 | ||
| Seq Type List | m6A-REF-seq | ||
| Transcript ID List | ENST00000463047.1; ENST00000360110.9; ENST00000392396.7; ENST00000475593.5; ENST00000420415.5; ENST00000426789.5 | ||
| External Link | RMBase: m6A_site_624117 | ||
| mod ID: M6ASITE064348 | Click to Show/Hide the Full List | ||
| mod site | chr3:196055086-196055087:- | [14] | |
| Sequence | TCTGAACCAATACAGAGCAGACATAAAGGTGAGCACTGATT | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000426789.5; ENST00000392396.7; ENST00000475593.5; ENST00000463047.1; ENST00000420415.5; ENST00000360110.9 | ||
| External Link | RMBase: m6A_site_624118 | ||
| mod ID: M6ASITE064349 | Click to Show/Hide the Full List | ||
| mod site | chr3:196055101-196055102:- | [14] | |
| Sequence | TTCATTTGTGAGGGATCTGAACCAATACAGAGCAGACATAA | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000475593.5; ENST00000360110.9; ENST00000463047.1; ENST00000420415.5; ENST00000426789.5; ENST00000392396.7 | ||
| External Link | RMBase: m6A_site_624119 | ||
| mod ID: M6ASITE064350 | Click to Show/Hide the Full List | ||
| mod site | chr3:196055137-196055138:- | [15] | |
| Sequence | GAACCTGGACTATGAGAGGTACAACAGCCAACTGCTTTCAT | ||
| Motif Score | 2.856142857 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000360110.9; ENST00000426789.5; ENST00000463047.1; ENST00000475593.5; ENST00000392396.7; ENST00000483983.5; ENST00000420415.5 | ||
| External Link | RMBase: m6A_site_624120 | ||
| mod ID: M6ASITE064351 | Click to Show/Hide the Full List | ||
| mod site | chr3:196055149-196055150:- | [14] | |
| Sequence | TGATGTTGAATTGAACCTGGACTATGAGAGGTACAACAGCC | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa; HepG2 | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000463047.1; ENST00000483983.5; ENST00000475593.5; ENST00000420415.5; ENST00000360110.9; ENST00000426789.5; ENST00000392396.7 | ||
| External Link | RMBase: m6A_site_624121 | ||
| mod ID: M6ASITE064352 | Click to Show/Hide the Full List | ||
| mod site | chr3:196055155-196055156:- | [14] | |
| Sequence | AACCCATGATGTTGAATTGAACCTGGACTATGAGAGGTACA | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HeLa; HepG2 | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000360110.9; ENST00000463047.1; ENST00000420415.5; ENST00000475593.5; ENST00000426789.5; ENST00000392396.7; ENST00000483983.5 | ||
| External Link | RMBase: m6A_site_624122 | ||
| mod ID: M6ASITE064353 | Click to Show/Hide the Full List | ||
| mod site | chr3:196055178-196055179:- | [14] | |
| Sequence | GCTGGTCAGTTCGTGATTAAACTAACCCATGATGTTGAATT | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa; HepG2 | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000360110.9; ENST00000426789.5; ENST00000392396.7; ENST00000463047.1; ENST00000483983.5; ENST00000475593.5; ENST00000420415.5 | ||
| External Link | RMBase: m6A_site_624123 | ||
| mod ID: M6ASITE064354 | Click to Show/Hide the Full List | ||
| mod site | chr3:196055227-196055228:- | [14] | |
| Sequence | TGAGAGGATTCCTGAGTTGAACAAAGTGGCACGAGCAGCTG | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa; hESC-HEK293T; HepG2 | ||
| Seq Type List | m6A-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000475593.5; ENST00000463047.1; ENST00000483983.5; ENST00000392396.7; ENST00000420415.5; ENST00000360110.9 | ||
| External Link | RMBase: m6A_site_624124 | ||
| mod ID: M6ASITE064355 | Click to Show/Hide the Full List | ||
| mod site | chr3:196055253-196055254:- | [14] | |
| Sequence | ACCATGGACACCTATAAGGAACTGATTGAGAGGATTCCTGA | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa; HepG2 | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000360110.9; ENST00000475593.5; ENST00000483983.5; ENST00000392396.7; ENST00000420415.5; ENST00000463047.1 | ||
| External Link | RMBase: m6A_site_624125 | ||
| mod ID: M6ASITE064356 | Click to Show/Hide the Full List | ||
| mod site | chr3:196055266-196055267:- | [14] | |
| Sequence | TTATTTGGGTACCACCATGGACACCTATAAGGAACTGATTG | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000392396.7; ENST00000463047.1; ENST00000475593.5; ENST00000420415.5; ENST00000483983.5; ENST00000360110.9 | ||
| External Link | RMBase: m6A_site_624126 | ||
| mod ID: M6ASITE064357 | Click to Show/Hide the Full List | ||
| mod site | chr3:196055299-196055300:- | [14] | |
| Sequence | GCCTCGCGTTGTCTTGCAGGACACAGATTATCCTTATTTGG | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000420415.5; ENST00000392396.7; ENST00000463047.1; ENST00000475593.5; ENST00000483983.5; ENST00000360110.9 | ||
| External Link | RMBase: m6A_site_624127 | ||
| mod ID: M6ASITE064358 | Click to Show/Hide the Full List | ||
| mod site | chr3:196055337-196055338:- | [14] | |
| Sequence | GTGAGGCTCTTGCTCTTAGAACTCACGTGAGTACCATAGCC | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000392396.7; ENST00000463047.1; ENST00000360110.9; ENST00000483983.5; ENST00000420415.5; ENST00000475593.5 | ||
| External Link | RMBase: m6A_site_624128 | ||
| mod ID: M6ASITE064359 | Click to Show/Hide the Full List | ||
| mod site | chr3:196058347-196058348:- | [14] | |
| Sequence | CAGTGAGAAACTCACTTTAGACAATGCTGCTTTCCCTTTCC | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000465288.5; ENST00000477148.1; ENST00000463356.5; ENST00000392396.7; ENST00000475593.5; ENST00000483983.5; ENST00000482479.1; ENST00000420415.5; ENST00000360110.9 | ||
| External Link | RMBase: m6A_site_624129 | ||
| mod ID: M6ASITE064360 | Click to Show/Hide the Full List | ||
| mod site | chr3:196058358-196058359:- | [14] | |
| Sequence | CTTTGTCTTTGCAGTGAGAAACTCACTTTAGACAATGCTGC | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000463356.5; ENST00000392396.7; ENST00000465288.5; ENST00000482479.1; ENST00000420415.5; ENST00000483983.5; ENST00000360110.9; ENST00000475593.5; ENST00000477148.1 | ||
| External Link | RMBase: m6A_site_624130 | ||
| mod ID: M6ASITE064361 | Click to Show/Hide the Full List | ||
| mod site | chr3:196058594-196058595:- | [14] | |
| Sequence | TGGGCAATTTCTATATCAGGACAGCAACTGGGCCAGCAAAG | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000482479.1; ENST00000465288.5; ENST00000483983.5; ENST00000392396.7; ENST00000477148.1; ENST00000360110.9; ENST00000475593.5; ENST00000420415.5; ENST00000463356.5 | ||
| External Link | RMBase: m6A_site_624131 | ||
| mod ID: M6ASITE064362 | Click to Show/Hide the Full List | ||
| mod site | chr3:196060190-196060191:- | [16] | |
| Sequence | TGTATACGCTTATTGAGAAAACAATGCAAAATGTGAGTATA | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HEK293T; hESC-HEK293T; MT4 | ||
| Seq Type List | DART-seq; MAZTER-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000420415.5; ENST00000360110.9; ENST00000477148.1; ENST00000483983.5; ENST00000465288.5; ENST00000475593.5; ENST00000392396.7; ENST00000463356.5 | ||
| External Link | RMBase: m6A_site_624132 | ||
| mod ID: M6ASITE064363 | Click to Show/Hide the Full List | ||
| mod site | chr3:196060261-196060262:- | [18] | |
| Sequence | GGAGAAGGGGCAATGATAAAACAATTTATTTTCAGGTACCA | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | MT4 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000475593.5; ENST00000392396.7; ENST00000477148.1; ENST00000420415.5; ENST00000360110.9; ENST00000483983.5; ENST00000465288.5 | ||
| External Link | RMBase: m6A_site_624133 | ||
| mod ID: M6ASITE064364 | Click to Show/Hide the Full List | ||
| mod site | chr3:196062683-196062684:- | [14] | |
| Sequence | CTACTGTATGTGATAAATAAACAGATTTATACTTATTAGTG | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000360110.9; ENST00000420415.5; ENST00000475593.5; ENST00000477148.1; ENST00000392396.7; ENST00000465288.5; ENST00000464368.1 | ||
| External Link | RMBase: m6A_site_624134 | ||
| mod ID: M6ASITE064365 | Click to Show/Hide the Full List | ||
| mod site | chr3:196062887-196062888:- | [14] | |
| Sequence | TGCCAGTTGGAGTGCTGGAGACTTTGGATCGGTTGGTGCCA | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa; HEK293T | ||
| Seq Type List | m6A-seq; DART-seq | ||
| Transcript ID List | ENST00000360110.9; ENST00000464368.1; ENST00000392396.7; ENST00000477148.1; ENST00000420415.5; ENST00000475593.5; ENST00000465288.5 | ||
| External Link | RMBase: m6A_site_624135 | ||
| mod ID: M6ASITE064366 | Click to Show/Hide the Full List | ||
| mod site | chr3:196063026-196063027:- | [14] | |
| Sequence | ATCTGCTATCTTGGAATTAGACCTTCTGATTCATCTTAAGT | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000464368.1; ENST00000392396.7; ENST00000420415.5; ENST00000465288.5; ENST00000477148.1; ENST00000360110.9 | ||
| External Link | RMBase: m6A_site_624136 | ||
| mod ID: M6ASITE064367 | Click to Show/Hide the Full List | ||
| mod site | chr3:196064342-196064343:- | [14] | |
| Sequence | GGCACAGCTCTCCTATTGAAACTTGCCCAGATGTTCTCAGA | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000420415.5; ENST00000360110.9; ENST00000392396.7; ENST00000464368.1 | ||
| External Link | RMBase: m6A_site_624137 | ||
| mod ID: M6ASITE064368 | Click to Show/Hide the Full List | ||
| mod site | chr3:196065446-196065447:- | [14] | |
| Sequence | GTTATTAAAGGCTTTGTAGAACCAGGTAAAGACCGCCCCCC | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000392396.7; ENST00000464368.1; ENST00000420415.5; ENST00000360110.9 | ||
| External Link | RMBase: m6A_site_624138 | ||
| mod ID: M6ASITE064369 | Click to Show/Hide the Full List | ||
| mod site | chr3:196065477-196065478:- | [15] | |
| Sequence | GAAAGAGATAAAAATTCTTAACATCTTTGGAGTTATTAAAG | ||
| Motif Score | 2.168095238 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000420415.5; ENST00000392396.7; ENST00000360110.9; ENST00000464368.1 | ||
| External Link | RMBase: m6A_site_624139 | ||
| mod ID: M6ASITE064370 | Click to Show/Hide the Full List | ||
| mod site | chr3:196065556-196065557:- | [15] | |
| Sequence | CTGACTGGAAAACAGACTCTACATGTAGGATGGTAACCTCA | ||
| Motif Score | 2.078666667 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000420415.5; ENST00000392396.7; ENST00000360110.9 | ||
| External Link | RMBase: m6A_site_624140 | ||
| mod ID: M6ASITE064371 | Click to Show/Hide the Full List | ||
| mod site | chr3:196065565-196065566:- | [14] | |
| Sequence | ACTGTCCCTCTGACTGGAAAACAGACTCTACATGTAGGATG | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000360110.9; ENST00000392396.7; ENST00000420415.5 | ||
| External Link | RMBase: m6A_site_624141 | ||
| mod ID: M6ASITE064372 | Click to Show/Hide the Full List | ||
| mod site | chr3:196065585-196065586:- | [14] | |
| Sequence | TTCTAGGAATATGGAAGGAGACTGTCCCTCTGACTGGAAAA | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000420415.5; ENST00000360110.9; ENST00000392396.7 | ||
| External Link | RMBase: m6A_site_624142 | ||
| mod ID: M6ASITE064373 | Click to Show/Hide the Full List | ||
| mod site | chr3:196067551-196067552:- | [14] | |
| Sequence | TGCCTAATATACCTGTCCAGACAATCTCCAGAGCTGCTGCA | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa; hESC-HEK293T | ||
| Seq Type List | m6A-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000392396.7; ENST00000360110.9; ENST00000420415.5 | ||
| External Link | RMBase: m6A_site_624143 | ||
| mod ID: M6ASITE064374 | Click to Show/Hide the Full List | ||
| mod site | chr3:196067604-196067605:- | [15] | |
| Sequence | TGGATTCCCTTCCTTCAATCACACTCAGTTTCCACCATCTC | ||
| Motif Score | 2.047297619 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000360110.9; ENST00000420415.5; ENST00000392396.7 | ||
| External Link | RMBase: m6A_site_624144 | ||
| mod ID: M6ASITE064375 | Click to Show/Hide the Full List | ||
| mod site | chr3:196067644-196067645:- | [14] | |
| Sequence | TTTCCTAGGCTCATCTGGGGACAGGTGACCCTTACACACCT | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000420415.5; ENST00000392396.7; ENST00000491658.1; ENST00000360110.9 | ||
| External Link | RMBase: m6A_site_624145 | ||
| mod ID: M6ASITE064376 | Click to Show/Hide the Full List | ||
| mod site | chr3:196068034-196068035:- | [14] | |
| Sequence | GCAGAACTTTCATTCTTTGGACATGTGAGTTATTTCTTGAG | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; hESC-HEK293T | ||
| Seq Type List | m6A-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000420415.5; ENST00000392396.7; ENST00000360110.9; ENST00000491658.1 | ||
| External Link | RMBase: m6A_site_624146 | ||
| mod ID: M6ASITE064377 | Click to Show/Hide the Full List | ||
| mod site | chr3:196068049-196068050:- | [14] | |
| Sequence | TTTCCCATTGTTAACGCAGAACTTTCATTCTTTGGACATGT | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000420415.5; ENST00000392396.7; ENST00000491658.1; ENST00000360110.9 | ||
| External Link | RMBase: m6A_site_624147 | ||
| mod ID: M6ASITE064378 | Click to Show/Hide the Full List | ||
| mod site | chr3:196068075-196068076:- | [14] | |
| Sequence | TGTTGATATACATGGACCAGACTAAATTTCCCATTGTTAAC | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000491658.1; ENST00000360110.9; ENST00000420415.5; ENST00000392396.7 | ||
| External Link | RMBase: m6A_site_624148 | ||
| mod ID: M6ASITE064379 | Click to Show/Hide the Full List | ||
| mod site | chr3:196068080-196068081:- | [14] | |
| Sequence | TGGTGTGTTGATATACATGGACCAGACTAAATTTCCCATTG | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000420415.5; ENST00000360110.9; ENST00000392396.7; ENST00000491658.1 | ||
| External Link | RMBase: m6A_site_624149 | ||
| mod ID: M6ASITE064380 | Click to Show/Hide the Full List | ||
| mod site | chr3:196068086-196068087:- | [15] | |
| Sequence | TGCAATTGGTGTGTTGATATACATGGACCAGACTAAATTTC | ||
| Motif Score | 2.110482143 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000392396.7; ENST00000360110.9; ENST00000420415.5; ENST00000491658.1 | ||
| External Link | RMBase: m6A_site_624150 | ||
| mod ID: M6ASITE064381 | Click to Show/Hide the Full List | ||
| mod site | chr3:196069515-196069516:- | [15] | |
| Sequence | AAAAGATTTTGAGGATTTATACACTCCTGTGAATGGATCTA | ||
| Motif Score | 2.110482143 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000491658.1; ENST00000360110.9; ENST00000420415.5; ENST00000392396.7 | ||
| External Link | RMBase: m6A_site_624151 | ||
| mod ID: M6ASITE064382 | Click to Show/Hide the Full List | ||
| mod site | chr3:196069562-196069563:- | [14] | |
| Sequence | ATGTCTTTGTTCTAGGGTAAACTGGTCCATGCTAATTTTGG | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000392396.7; ENST00000360110.9; ENST00000491658.1; ENST00000420415.5 | ||
| External Link | RMBase: m6A_site_624152 | ||
| mod ID: M6ASITE064383 | Click to Show/Hide the Full List | ||
| mod site | chr3:196071458-196071459:- | [14] | |
| Sequence | ATAGTTGATAAGAACGGTAGACTTGTTTACCTGGTGGAGAA | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000392396.7; ENST00000360110.9; ENST00000420415.5; ENST00000421258.1 | ||
| External Link | RMBase: m6A_site_624153 | ||
| mod ID: M6ASITE064384 | Click to Show/Hide the Full List | ||
| mod site | chr3:196071489-196071490:- | [14] | |
| Sequence | TCTTTTTAACAGCGCTCAAAACTCGGTGATCATAGTTGATA | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000360110.9; ENST00000392396.7; ENST00000420415.5; ENST00000421258.1 | ||
| External Link | RMBase: m6A_site_624154 | ||
| mod ID: M6ASITE064385 | Click to Show/Hide the Full List | ||
| mod site | chr3:196072005-196072006:- | [14] | |
| Sequence | TGTTAAGATTCAGGTCAAAGACAGGTATGTTGAAAGATGGT | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa; HepG2 | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000392396.7; ENST00000421258.1; ENST00000420415.5; ENST00000360110.9 | ||
| External Link | RMBase: m6A_site_624155 | ||
| mod ID: M6ASITE064386 | Click to Show/Hide the Full List | ||
| mod site | chr3:196072031-196072032:- | [15] | |
| Sequence | AGCAAAGTCTGGCGTGATCAACATTTTGTTAAGATTCAGGT | ||
| Motif Score | 2.173910714 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000392396.7; ENST00000420415.5; ENST00000421258.1; ENST00000360110.9 | ||
| External Link | RMBase: m6A_site_624156 | ||
| mod ID: M6ASITE064387 | Click to Show/Hide the Full List | ||
| mod site | chr3:196072055-196072056:- | [14] | |
| Sequence | AATCAATTTCGTGAATTTAAACTCAGCAAAGTCTGGCGTGA | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000392396.7; ENST00000360110.9; ENST00000421258.1; ENST00000420415.5 | ||
| External Link | RMBase: m6A_site_624157 | ||
| mod ID: M6ASITE064388 | Click to Show/Hide the Full List | ||
| mod site | chr3:196073947-196073948:- | [14] | |
| Sequence | GGAGAAACTGGACAGCACAGACTTCACCGGCACCATCAAGT | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa; HepG2; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000392396.7; ENST00000421258.1; ENST00000420415.5; ENST00000360110.9 | ||
| External Link | RMBase: m6A_site_624158 | ||
| mod ID: M6ASITE064389 | Click to Show/Hide the Full List | ||
| mod site | chr3:196073956-196073957:- | [14] | |
| Sequence | AAAGTTGTCGGAGAAACTGGACAGCACAGACTTCACCGGCA | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; HepG2; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000421258.1; ENST00000392396.7; ENST00000420415.5; ENST00000360110.9 | ||
| External Link | RMBase: m6A_site_624159 | ||
| mod ID: M6ASITE064390 | Click to Show/Hide the Full List | ||
| mod site | chr3:196073961-196073962:- | [14] | |
| Sequence | AAGAGAAAGTTGTCGGAGAAACTGGACAGCACAGACTTCAC | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa; HepG2; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000421258.1; ENST00000360110.9; ENST00000420415.5; ENST00000392396.7 | ||
| External Link | RMBase: m6A_site_624160 | ||
| mod ID: M6ASITE064391 | Click to Show/Hide the Full List | ||
| mod site | chr3:196074019-196074020:- | [14] | |
| Sequence | GAGGGAGGAGCCAGGAGAGGACTTCCCTGCAGCACGTCGCT | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa; HepG2; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000392396.7; ENST00000360110.9; ENST00000420415.5; ENST00000421258.1 | ||
| External Link | RMBase: m6A_site_624161 | ||
| mod ID: M6ASITE064392 | Click to Show/Hide the Full List | ||
| mod site | chr3:196074053-196074054:- | [14] | |
| Sequence | AGTGTGAGAGACTGGCAGGAACCGAGTCTCCAGTGAGGGAG | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HeLa; HepG2; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000420415.5; ENST00000421258.1; ENST00000392396.7; ENST00000360110.9 | ||
| External Link | RMBase: m6A_site_624162 | ||
| mod ID: M6ASITE064393 | Click to Show/Hide the Full List | ||
| mod site | chr3:196074063-196074064:- | [14] | |
| Sequence | CCAAAAACTGAGTGTGAGAGACTGGCAGGAACCGAGTCTCC | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa; HepG2; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000392396.7; ENST00000360110.9; ENST00000421258.1; ENST00000420415.5 | ||
| External Link | RMBase: m6A_site_624163 | ||
| mod ID: M6ASITE064394 | Click to Show/Hide the Full List | ||
| mod site | chr3:196074077-196074078:- | [14] | |
| Sequence | GTAAAGGGGTAGAACCAAAAACTGAGTGTGAGAGACTGGCA | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa; HepG2; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000360110.9; ENST00000421258.1; ENST00000392396.7; ENST00000420415.5 | ||
| External Link | RMBase: m6A_site_624164 | ||
| mod ID: M6ASITE064395 | Click to Show/Hide the Full List | ||
| mod site | chr3:196074084-196074085:- | [14] | |
| Sequence | GGCTATTGTAAAGGGGTAGAACCAAAAACTGAGTGTGAGAG | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HeLa; HepG2; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000392396.7; ENST00000421258.1; ENST00000420415.5; ENST00000360110.9 | ||
| External Link | RMBase: m6A_site_624165 | ||
| mod ID: M6ASITE064396 | Click to Show/Hide the Full List | ||
| mod site | chr3:196074222-196074223:- | [14] | |
| Sequence | CTACTTAGAATTTGATGAAAACCAGTATTTTCAAGGCTTAC | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa; HepG2; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000360110.9; ENST00000392396.7; ENST00000464011.1; ENST00000420415.5; ENST00000421258.1 | ||
| External Link | RMBase: m6A_site_624166 | ||
| mod ID: M6ASITE064397 | Click to Show/Hide the Full List | ||
| mod site | chr3:196074243-196074244:- | [14] | |
| Sequence | GATGCATTATATACTTTAAAACTACTTAGAATTTGATGAAA | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000360110.9; ENST00000464011.1; ENST00000392396.7; ENST00000421258.1; ENST00000420415.5 | ||
| External Link | RMBase: m6A_site_624167 | ||
| mod ID: M6ASITE064398 | Click to Show/Hide the Full List | ||
| mod site | chr3:196074268-196074269:- | [14] | |
| Sequence | AGTGGTTTAAAGTATACAAAACTGAGATGCATTATATACTT | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000420415.5; ENST00000392396.7; ENST00000421258.1; ENST00000464011.1; ENST00000360110.9 | ||
| External Link | RMBase: m6A_site_624168 | ||
| mod ID: M6ASITE064399 | Click to Show/Hide the Full List | ||
| mod site | chr3:196074399-196074400:- | [14] | |
| Sequence | CGCTAGAAAATATCCGCAGGACACTGGCGGTGCAGCAGCTC | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000360110.9; ENST00000421258.1; ENST00000392396.7; ENST00000420415.5; ENST00000464011.1 | ||
| External Link | RMBase: m6A_site_624169 | ||
| mod ID: M6ASITE064400 | Click to Show/Hide the Full List | ||
| mod site | chr3:196075188-196075189:- | [14] | |
| Sequence | GTGGAAGTATCTGCTATGGGACTATTGCTGTGATCGTCTTT | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa; A549; Huh7; MSC; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000420415.5; ENST00000360110.9; ENST00000464011.1; ENST00000421258.1; ENST00000392396.7 | ||
| External Link | RMBase: m6A_site_624170 | ||
| mod ID: M6ASITE064401 | Click to Show/Hide the Full List | ||
| mod site | chr3:196075222-196075223:- | [14] | |
| Sequence | ACAAAGGCCAATGTCACAAAACCAAAAAGGTGTAGTGGAAG | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa; CD34; HepG2; A549; Huh7; iSLK; MSC; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000464011.1; ENST00000392396.7; ENST00000420415.5; ENST00000421258.1; ENST00000360110.9 | ||
| External Link | RMBase: m6A_site_624171 | ||
| mod ID: M6ASITE064402 | Click to Show/Hide the Full List | ||
| mod site | chr3:196075227-196075228:- | [15] | |
| Sequence | ATAACACAAAGGCCAATGTCACAAAACCAAAAAGGTGTAGT | ||
| Motif Score | 2.047297619 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000421258.1; ENST00000420415.5; ENST00000392396.7; ENST00000360110.9; ENST00000464011.1 | ||
| External Link | RMBase: m6A_site_624172 | ||
| mod ID: M6ASITE064403 | Click to Show/Hide the Full List | ||
| mod site | chr3:196075250-196075251:- | [15] | |
| Sequence | AGATGAAGAAGAAAATGCTGACAATAACACAAAGGCCAATG | ||
| Motif Score | 2.859755952 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000360110.9; ENST00000420415.5; ENST00000464011.1; ENST00000392396.7; ENST00000421258.1 | ||
| External Link | RMBase: m6A_site_624173 | ||
| mod ID: M6ASITE064404 | Click to Show/Hide the Full List | ||
| mod site | chr3:196075279-196075280:- | [14] | |
| Sequence | AACAGTCATGTGGAGATGAAACTTGCTGTAGATGAAGAAGA | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa; CD34; HepG2; A549; Huh7; iSLK; MSC; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000464011.1; ENST00000392396.7; ENST00000360110.9; ENST00000421258.1; ENST00000420415.5 | ||
| External Link | RMBase: m6A_site_624174 | ||
| mod ID: M6ASITE064405 | Click to Show/Hide the Full List | ||
| mod site | chr3:196075348-196075349:- | [14] | |
| Sequence | GCAACACAGTTTGGTGGAGAACCATTGTCATATACCCGGTT | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HeLa; CD34; HepG2; A549; U2OS; Huh7; HEK293A-TOA; iSLK; MSC; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000360110.9; ENST00000392396.7; ENST00000421258.1; ENST00000464011.1; ENST00000420415.5 | ||
| External Link | RMBase: m6A_site_624175 | ||
| mod ID: M6ASITE064406 | Click to Show/Hide the Full List | ||
| mod site | chr3:196082022-196082023:- | [14] | |
| Sequence | TGTGAGTGCGGGCTTCTAGAACTACACCGACCCTCGTGTCC | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa; MSC | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000464011.1; ENST00000421258.1; ENST00000420415.5; ENST00000392396.7; ENST00000360110.9 | ||
| External Link | RMBase: m6A_site_624176 | ||
References

