m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00425)

Target Name	Transcription factor p65 (RELA)
Synonyms	Nuclear factor NF-kappa-B p65 subunit; Nuclear factor of kappa light polypeptide gene enhancer in B-cells 3; NFKB3 Click to Show/Hide
Gene Name	RELA
Chromosomal Location	11q13.1
Function	NF-kappa-B is a pleiotropic transcription factor present in almost all cell types and is the endpoint of a series of signal transduction events that are initiated by a vast array of stimuli related to many biological processes such as inflammation, immunity, differentiation, cell growth, tumorigenesis and apoptosis. NF-kappa-B is a homo- or heterodimeric complex formed by the Rel-like domain-containing proteins RELA/p65, RELB, NFKB1/p105, NFKB1/p50, REL and NFKB2/p52. The heterodimeric RELA-NFKB1 complex appears to be most abundant one. The dimers bind at kappa-B sites in the DNA of their target genes and the individual dimers have distinct preferences for different kappa-B sites that they can bind with distinguishable affinity and specificity. Different dimer combinations act as transcriptional activators or repressors, respectively. The NF-kappa-B heterodimeric RELA-NFKB1 and RELA-REL complexes, for instance, function as transcriptional activators. NF-kappa-B is controlled by various mechanisms of post-translational modification and subcellular compartmentalization as well as by interactions with other cofactors or corepressors. NF-kappa-B complexes are held in the cytoplasm in an inactive state complexed with members of the NF-kappa-B inhibitor (I-kappa-B) family. In a conventional activation pathway, I-kappa-B is phosphorylated by I-kappa-B kinases (IKKs) in response to different activators, subsequently degraded thus liberating the active NF-kappa-B complex which translocates to the nucleus. The inhibitory effect of I-kappa-B on NF-kappa-B through retention in the cytoplasm is exerted primarily through the interaction with RELA. RELA shows a weak DNA-binding site which could contribute directly to DNA binding in the NF-kappa-B complex. Beside its activity as a direct transcriptional activator, it is also able to modulate promoters accessibility to transcription factors and thereby indirectly regulate gene expression. Associates with chromatin at the NF-kappa-B promoter region via association with DDX1. Essential for cytokine gene expression in T-cells . The NF-kappa-B homodimeric RELA-RELA complex appears to be involved in invasin-mediated activation of IL-8 expression. Key transcription factor regulating the IFN response during SARS-CoV-2 infectio. Click to Show/Hide
Gene ID	5970
Uniprot ID	TF65_HUMAN
HGNC ID	HGNC:9955
KEGG ID	hsa:5970

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

RELA can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Methyltransferase-like 14 (METTL14) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by METTL14*
Cell Line	BMDM	Mus musculus
Treatment: METTL14 knockout mice BMDM Control: Wild type mice BMDM		GSE153512
Regulation		logFC: 7.00E-01 p-value: 8.41E-10
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	Knocking down METTL14 could inhibit the development of atherosclerosis in high-fat diet-treated APOE mice. After transfection with si-METTL14, the bcl-2 expression level and the viability of ox-LDL-incubated cells increased, whereas the apoptosis rate and the expressions of Bax and cleaved caspase-3 decreased. However, the effect of METTL14 knockdown was reversed by Transcription factor p65 (RELA) overexpression.
Target Regulation	Up regulation
Responsed Disease	Atherosclerosis		ICD-11: BD40.Z	Disease Info
Cell Process	Cell apoptosis
In-vitro Model	HUVEC-C	Normal	Homo sapiens	CVCL_2959
In-vitro Model	EA.hy 926	Normal	Homo sapiens	CVCL_3901
In-vivo Model	The mice were randomly divided into control, Ad-sh-NC, and Ad-sh-METTL14 groups (10 mice per group). The mice in the control group were fed a normal diet, while the Ad-sh-NC and Ad-sh-METTL14 groups were fed a high-fat diet (20% fat and 0.25% cholesterol). Furthermore, 300 uL of constructed sh-NC or sh-METTL14 adenovirus was injected every 3 weeks into the caudal veins of mice from the Ad-sh-NC or Ad-sh-METTL14 groups, respectively. The constructed vectors were obtained from HanBio Technology Co., Ltd. (Shanghai, China). All mice were sacrificed after 24 weeks and the aortas were separated for further experiments.

Methyltransferase-like 3 (METTL3) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by METTL3*
Cell Line	Caco-2 cell line	Homo sapiens
Treatment: shMETTL3 Caco-2 cells Control: shNTC Caco-2 cells		GSE167075
Regulation		logFC: 6.33E-01 p-value: 3.93E-11
More Results	Click to View More RNA-seq Results

In total 2 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[2]
Response Summary	AF4/FMR2 family member 4 (AFF4), two key regulators of NF-Kappa-B pathway (IKBKB and Transcription factor p65 (RELA)) and MYC were further identified as direct targets of METTL3-mediated m6A modification.overexpression of METTL3 significantly promoted Bladder cancer cell growth and invasion.
Target Regulation	Up regulation
Responsed Disease	Bladder cancer		ICD-11: 2C94	Disease Info
Cell Process	Glucose metabolism
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene				[3]
Response Summary	METTL3 played a pivotal tumor-suppressor role in papillary thyroid cancer carcinogenesis through c-Rel and Transcription factor p65 (RELA) inactivation of the nuclear factor Kappa-B (NF-Kappa-B) pathway by cooperating with YTHDF2 and altered TAN infiltration to regulate tumor growth.
Target Regulation	Down regulation
Responsed Disease	Papillary thyroid cancer		ICD-11: 2D10.1	Disease Info
Pathway Response	NF-kappa B signaling pathway			hsa04064
In-vitro Model	TPC-1	Thyroid gland papillary carcinoma	Homo sapiens	CVCL_6298
	Nthy-ori 3-1	Normal	Homo sapiens	CVCL_2659
	KTC-1	Thyroid carcinoma	Homo sapiens	CVCL_6300
	B-CPAP	Thyroid gland carcinoma	Homo sapiens	CVCL_0153
In-vivo Model	For xenograft models, 5 × 10⁶ BCPAP or KTC-1 cells from each group were injected subcutaneously into the flanks of female BALB/c nude mice (4-6 weeks old, Shanghai SLAC Laboratory Animal, China, n = 5 per group) in a volume of 150 uL PBS. Tumor growth was measured with a digital caliper every 4 days and calculated using the following formula: (length × width2)/2. To study the effect of IL-8 on tumor growth in vivo, scramble or shMETTL3 BCPAP cells were implanted hypodermically into BALB/c nude mice (2 × 10⁶ cells in 150 uL PBS, n = 10 per group). When palpable tumors formed on day 14, mice were treated with DMSO or the IL-8 inhibitor SB225002 (10 mg/kg) by intraperitoneal injection 3 times per week for 3 weeks. Six weeks post-injection, the mice were sacrificed, and the tumors were collected to analyze the frequency of TANs by flow cytometry. For the lung metastasis model, BCPAP and KTC-1 cells (2 × 10⁶ cells in 100 uL PBS) with the corresponding vectors were injected into the tail veins of BALB/c nude mice. Eight weeks after injection, the mice were euthanized, and metastatic lung nodules were analyzed (n = 5 for each group).

YTH domain-containing family protein 2 (YTHDF2) [READER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by YTHDF2*
Cell Line	GSC11 cell line	Homo sapiens
Treatment: siYTHDF2 GSC11 cells Control: siControl GSC11 cells		GSE142825
Regulation		logFC: 6.31E-01 p-value: 1.53E-07
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[3]
Response Summary	METTL3 played a pivotal tumor-suppressor role in papillary thyroid cancer carcinogenesis through c-Rel and Transcription factor p65 (RELA) inactivation of the nuclear factor Kappa-B (NF-Kappa-B) pathway by cooperating with YTHDF2 and altered TAN infiltration to regulate tumor growth.
Target Regulation	Down regulation
Responsed Disease	Papillary thyroid cancer		ICD-11: 2D10.1	Disease Info
Pathway Response	NF-kappa B signaling pathway			hsa04064
In-vitro Model	TPC-1	Thyroid gland papillary carcinoma	Homo sapiens	CVCL_6298
	Nthy-ori 3-1	Normal	Homo sapiens	CVCL_2659
	KTC-1	Thyroid carcinoma	Homo sapiens	CVCL_6300
	B-CPAP	Thyroid gland carcinoma	Homo sapiens	CVCL_0153
In-vivo Model	For xenograft models, 5 × 10⁶ BCPAP or KTC-1 cells from each group were injected subcutaneously into the flanks of female BALB/c nude mice (4-6 weeks old, Shanghai SLAC Laboratory Animal, China, n = 5 per group) in a volume of 150 uL PBS. Tumor growth was measured with a digital caliper every 4 days and calculated using the following formula: (length × width2)/2. To study the effect of IL-8 on tumor growth in vivo, scramble or shMETTL3 BCPAP cells were implanted hypodermically into BALB/c nude mice (2 × 10⁶ cells in 150 uL PBS, n = 10 per group). When palpable tumors formed on day 14, mice were treated with DMSO or the IL-8 inhibitor SB225002 (10 mg/kg) by intraperitoneal injection 3 times per week for 3 weeks. Six weeks post-injection, the mice were sacrificed, and the tumors were collected to analyze the frequency of TANs by flow cytometry. For the lung metastasis model, BCPAP and KTC-1 cells (2 × 10⁶ cells in 100 uL PBS) with the corresponding vectors were injected into the tail veins of BALB/c nude mice. Eight weeks after injection, the mice were euthanized, and metastatic lung nodules were analyzed (n = 5 for each group).

Insulin-like growth factor 2 mRNA-binding protein 2 (IGF2BP2) [READER]

Regulator Info

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[4]
Response Summary	N6-methyladenosine (m6A) methylation modification is implicated in the pathogenesis of lung ischemia-reperfusion injury. YTHDF3 or IGF2BP2 knockdown inhibited hypoxia/reoxygenation-activated p38, ERK1/2, AKT, and NF-Kappa-B pathways in BEAS-2B cells, and inhibited Transcription factor p65 (RELA), IL-1-beta and TNF-alpha secretion.
Target Regulation	Up regulation
Responsed Disease	Gangrene or necrosis of lung		ICD-11: CA43	Disease Info
Pathway Response	MAPK signaling pathway			hsa04010
	PI3K-Akt signaling pathway			hsa04151
Cell Process	Biological regulation
	Cell apoptosis
In-vitro Model	BEAS-2B	Normal	Homo sapiens	CVCL_0168
In-vivo Model	After being anesthetized with urethane (i.p.), SD rats were endotracheally intubated and ventilated using an animal ventilator under the conditions: respiratory rate of 70 breaths/min, tidal volume of 20 ml/kg, and inspiratory/expiratory ratio of 1:1.

YTH domain-containing family protein 3 (YTHDF3) [READER]

Regulator Info

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[4]
Response Summary	N6-methyladenosine (m6A) methylation modification is implicated in the pathogenesis of lung ischemia-reperfusion injury. YTHDF3 or IGF2BP2 knockdown inhibited hypoxia/reoxygenation-activated p38, ERK1/2, AKT, and NF-Kappa-B pathways in BEAS-2B cells, and inhibited Transcription factor p65 (RELA), IL-1-beta and TNF-alpha secretion.
Target Regulation	Up regulation
Responsed Disease	Gangrene or necrosis of lung		ICD-11: CA43	Disease Info
Pathway Response	MAPK signaling pathway			hsa04010
	PI3K-Akt signaling pathway			hsa04151
	Apoptosis			hsa04210
Cell Process	Biological regulation
	Cell apoptosis
In-vitro Model	BEAS-2B	Normal	Homo sapiens	CVCL_0168
In-vivo Model	After being anesthetized with urethane (i.p.), SD rats were endotracheally intubated and ventilated using an animal ventilator under the conditions: respiratory rate of 70 breaths/min, tidal volume of 20 ml/kg, and inspiratory/expiratory ratio of 1:1.

Bladder cancer [ICD-11: 2C94]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response			[2]
Response Summary	AF4/FMR2 family member 4 (AFF4), two key regulators of NF-Kappa-B pathway (IKBKB and Transcription factor p65 (RELA)) and MYC were further identified as direct targets of METTL3-mediated m6A modification.overexpression of METTL3 significantly promoted Bladder cancer cell growth and invasion.
Responsed Disease	Bladder cancer [ICD-11: 2C94]
Target Regulator	Methyltransferase-like 3 (METTL3)	WRITER	Regulator Info
Target Regulation	Up regulation
Cell Process	Glucose metabolism

Thyroid Cancer [ICD-11: 2D10]

Disease Info

In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[3]
Response Summary	METTL3 played a pivotal tumor-suppressor role in papillary thyroid cancer carcinogenesis through c-Rel and Transcription factor p65 (RELA) inactivation of the nuclear factor Kappa-B (NF-Kappa-B) pathway by cooperating with YTHDF2 and altered TAN infiltration to regulate tumor growth.
Responsed Disease	Papillary thyroid cancer [ICD-11: 2D10.1]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Down regulation
Pathway Response	NF-kappa B signaling pathway			hsa04064
In-vitro Model	TPC-1	Thyroid gland papillary carcinoma	Homo sapiens	CVCL_6298
	Nthy-ori 3-1	Normal	Homo sapiens	CVCL_2659
	KTC-1	Thyroid carcinoma	Homo sapiens	CVCL_6300
	B-CPAP	Thyroid gland carcinoma	Homo sapiens	CVCL_0153
In-vivo Model	For xenograft models, 5 × 10⁶ BCPAP or KTC-1 cells from each group were injected subcutaneously into the flanks of female BALB/c nude mice (4-6 weeks old, Shanghai SLAC Laboratory Animal, China, n = 5 per group) in a volume of 150 uL PBS. Tumor growth was measured with a digital caliper every 4 days and calculated using the following formula: (length × width2)/2. To study the effect of IL-8 on tumor growth in vivo, scramble or shMETTL3 BCPAP cells were implanted hypodermically into BALB/c nude mice (2 × 10⁶ cells in 150 uL PBS, n = 10 per group). When palpable tumors formed on day 14, mice were treated with DMSO or the IL-8 inhibitor SB225002 (10 mg/kg) by intraperitoneal injection 3 times per week for 3 weeks. Six weeks post-injection, the mice were sacrificed, and the tumors were collected to analyze the frequency of TANs by flow cytometry. For the lung metastasis model, BCPAP and KTC-1 cells (2 × 10⁶ cells in 100 uL PBS) with the corresponding vectors were injected into the tail veins of BALB/c nude mice. Eight weeks after injection, the mice were euthanized, and metastatic lung nodules were analyzed (n = 5 for each group).
Experiment 2 Reporting the m6A-centered Disease Response				[3]
Response Summary	METTL3 played a pivotal tumor-suppressor role in papillary thyroid cancer carcinogenesis through c-Rel and Transcription factor p65 (RELA) inactivation of the nuclear factor Kappa-B (NF-Kappa-B) pathway by cooperating with YTHDF2 and altered TAN infiltration to regulate tumor growth.
Responsed Disease	Papillary thyroid cancer [ICD-11: 2D10.1]
Target Regulator	YTH domain-containing family protein 2 (YTHDF2)		READER	Regulator Info
Target Regulation	Down regulation
Pathway Response	NF-kappa B signaling pathway			hsa04064
In-vitro Model	TPC-1	Thyroid gland papillary carcinoma	Homo sapiens	CVCL_6298
	Nthy-ori 3-1	Normal	Homo sapiens	CVCL_2659
	KTC-1	Thyroid carcinoma	Homo sapiens	CVCL_6300
	B-CPAP	Thyroid gland carcinoma	Homo sapiens	CVCL_0153
In-vivo Model	For xenograft models, 5 × 10⁶ BCPAP or KTC-1 cells from each group were injected subcutaneously into the flanks of female BALB/c nude mice (4-6 weeks old, Shanghai SLAC Laboratory Animal, China, n = 5 per group) in a volume of 150 uL PBS. Tumor growth was measured with a digital caliper every 4 days and calculated using the following formula: (length × width2)/2. To study the effect of IL-8 on tumor growth in vivo, scramble or shMETTL3 BCPAP cells were implanted hypodermically into BALB/c nude mice (2 × 10⁶ cells in 150 uL PBS, n = 10 per group). When palpable tumors formed on day 14, mice were treated with DMSO or the IL-8 inhibitor SB225002 (10 mg/kg) by intraperitoneal injection 3 times per week for 3 weeks. Six weeks post-injection, the mice were sacrificed, and the tumors were collected to analyze the frequency of TANs by flow cytometry. For the lung metastasis model, BCPAP and KTC-1 cells (2 × 10⁶ cells in 100 uL PBS) with the corresponding vectors were injected into the tail veins of BALB/c nude mice. Eight weeks after injection, the mice were euthanized, and metastatic lung nodules were analyzed (n = 5 for each group).

Atherosclerosis [ICD-11: BD40]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	Knocking down METTL14 could inhibit the development of atherosclerosis in high-fat diet-treated APOE mice. After transfection with si-METTL14, the bcl-2 expression level and the viability of ox-LDL-incubated cells increased, whereas the apoptosis rate and the expressions of Bax and cleaved caspase-3 decreased. However, the effect of METTL14 knockdown was reversed by Transcription factor p65 (RELA) overexpression.
Responsed Disease	Atherosclerosis [ICD-11: BD40.Z]
Target Regulator	Methyltransferase-like 14 (METTL14)		WRITER	Regulator Info
Target Regulation	Up regulation
Cell Process	Cell apoptosis
In-vitro Model	HUVEC-C	Normal	Homo sapiens	CVCL_2959
In-vitro Model	EA.hy 926	Normal	Homo sapiens	CVCL_3901
In-vivo Model	The mice were randomly divided into control, Ad-sh-NC, and Ad-sh-METTL14 groups (10 mice per group). The mice in the control group were fed a normal diet, while the Ad-sh-NC and Ad-sh-METTL14 groups were fed a high-fat diet (20% fat and 0.25% cholesterol). Furthermore, 300 uL of constructed sh-NC or sh-METTL14 adenovirus was injected every 3 weeks into the caudal veins of mice from the Ad-sh-NC or Ad-sh-METTL14 groups, respectively. The constructed vectors were obtained from HanBio Technology Co., Ltd. (Shanghai, China). All mice were sacrificed after 24 weeks and the aortas were separated for further experiments.

Gangrene or necrosis of lung [ICD-11: CA43]

Disease Info

In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[4]
Response Summary	N6-methyladenosine (m6A) methylation modification is implicated in the pathogenesis of lung ischemia-reperfusion injury. YTHDF3 or IGF2BP2 knockdown inhibited hypoxia/reoxygenation-activated p38, ERK1/2, AKT, and NF-Kappa-B pathways in BEAS-2B cells, and inhibited Transcription factor p65 (RELA), IL-1-beta and TNF-alpha secretion.
Responsed Disease	Gangrene or necrosis of lung [ICD-11: CA43]
Target Regulator	Insulin-like growth factor 2 mRNA-binding protein 2 (IGF2BP2)		READER	Regulator Info
Target Regulation	Up regulation
Pathway Response	MAPK signaling pathway			hsa04010
	PI3K-Akt signaling pathway			hsa04151
Cell Process	Biological regulation
	Cell apoptosis
In-vitro Model	BEAS-2B	Normal	Homo sapiens	CVCL_0168
In-vivo Model	After being anesthetized with urethane (i.p.), SD rats were endotracheally intubated and ventilated using an animal ventilator under the conditions: respiratory rate of 70 breaths/min, tidal volume of 20 ml/kg, and inspiratory/expiratory ratio of 1:1.
Experiment 2 Reporting the m6A-centered Disease Response				[4]
Response Summary	N6-methyladenosine (m6A) methylation modification is implicated in the pathogenesis of lung ischemia-reperfusion injury. YTHDF3 or IGF2BP2 knockdown inhibited hypoxia/reoxygenation-activated p38, ERK1/2, AKT, and NF-Kappa-B pathways in BEAS-2B cells, and inhibited Transcription factor p65 (RELA), IL-1-beta and TNF-alpha secretion.
Responsed Disease	Gangrene or necrosis of lung [ICD-11: CA43]
Target Regulator	YTH domain-containing family protein 3 (YTHDF3)		READER	Regulator Info
Target Regulation	Up regulation
Pathway Response	MAPK signaling pathway			hsa04010
	PI3K-Akt signaling pathway			hsa04151
	Apoptosis			hsa04210
Cell Process	Biological regulation
	Cell apoptosis
In-vitro Model	BEAS-2B	Normal	Homo sapiens	CVCL_0168
In-vivo Model	After being anesthetized with urethane (i.p.), SD rats were endotracheally intubated and ventilated using an animal ventilator under the conditions: respiratory rate of 70 breaths/min, tidal volume of 20 ml/kg, and inspiratory/expiratory ratio of 1:1.

Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator

Non-coding RNA

m6A Regulator: YTH domain-containing family protein 1 (YTHDF1)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05263		Crosstalk Info
Epigenetic Regulator	hsa-miR-421-3p
Regulated Target	YTH domain-containing family protein 1 (YTHDF1)
Crosstalk relationship	ncRNA → m6A
Disease	Acute ischemic stroke	Disease Info

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00425)

Transcription factor p65 (RELA)

Adenosine-to-Inosine editing (A-to-I)

In total 5 m6A sequence/site(s) in this target gene
mod ID: A2ISITE004949		Click to Show/Hide the Full List
mod site	chr11:65661107-65661108:-		[7]
Sequence	CAGGAGGTCACTGCTGCGGCAAGCTATGATTGCACCACTGC
Transcript ID List	ENST00000527909.5; ENST00000527074.5; ENST00000527874.1; ENST00000529389.5; ENST00000527749.5; ENST00000533187.5; ENST00000615805.4; ENST00000525301.5; ENST00000308639.13; ENST00000525658.5; ENST00000526283.6; ENST00000532999.5; ENST00000533546.5; ENST00000534558.5; ENST00000531238.1; ENST00000406246.8; rmsk_3569895; ENST00000531484.5; ENST00000525693.5; ENST00000612991.4; ENST00000532879.5
External Link	RMBase: RNA-editing_site_22777
mod ID: A2ISITE004950		Click to Show/Hide the Full List
mod site	chr11:65661126-65661127:-		[7]
Sequence	TGGGAGGATCGCCTGAGCCCAGGAGGTCACTGCTGCGGCAA
Transcript ID List	rmsk_3569895; ENST00000525658.5; ENST00000612991.4; ENST00000406246.8; ENST00000527749.5; ENST00000532879.5; ENST00000527909.5; ENST00000531238.1; ENST00000531484.5; ENST00000615805.4; ENST00000533546.5; ENST00000525301.5; ENST00000534558.5; ENST00000526283.6; ENST00000527874.1; ENST00000308639.13; ENST00000527074.5; ENST00000533187.5; ENST00000525693.5; ENST00000532999.5; ENST00000529389.5
External Link	RMBase: RNA-editing_site_22778
mod ID: A2ISITE004951		Click to Show/Hide the Full List
mod site	chr11:65661191-65661192:-		[7]
Sequence	TCTACAAAAAATAAGAAATTAGCTGGGTATGGTGGCATGCG
Transcript ID List	ENST00000527749.5; ENST00000526283.6; ENST00000525658.5; rmsk_3569895; ENST00000529389.5; ENST00000534558.5; ENST00000615805.4; ENST00000525693.5; ENST00000527074.5; ENST00000533187.5; ENST00000533546.5; ENST00000532999.5; ENST00000527874.1; ENST00000406246.8; ENST00000525301.5; ENST00000308639.13; ENST00000532879.5; ENST00000527909.5; ENST00000612991.4; ENST00000531484.5; ENST00000531238.1
External Link	RMBase: RNA-editing_site_22779
mod ID: A2ISITE004952		Click to Show/Hide the Full List
mod site	chr11:65661194-65661195:-		[7]
Sequence	ATGTCTACAAAAAATAAGAAATTAGCTGGGTATGGTGGCAT
Transcript ID List	ENST00000529389.5; ENST00000526283.6; ENST00000527874.1; ENST00000525693.5; ENST00000534558.5; ENST00000525301.5; ENST00000531484.5; ENST00000615805.4; ENST00000532879.5; rmsk_3569895; ENST00000532999.5; ENST00000533187.5; ENST00000533546.5; ENST00000527749.5; ENST00000406246.8; ENST00000527074.5; ENST00000531238.1; ENST00000525658.5; ENST00000527909.5; ENST00000612991.4; ENST00000308639.13
External Link	RMBase: RNA-editing_site_22780
mod ID: A2ISITE004953		Click to Show/Hide the Full List
mod site	chr11:65661198-65661199:-		[8]
Sequence	CCCCATGTCTACAAAAAATAAGAAATTAGCTGGGTATGGTG
Transcript ID List	ENST00000533187.5; ENST00000533546.5; ENST00000531484.5; ENST00000527874.1; ENST00000308639.13; ENST00000527909.5; ENST00000615805.4; rmsk_3569895; ENST00000534558.5; ENST00000526283.6; ENST00000525658.5; ENST00000612991.4; ENST00000527749.5; ENST00000525693.5; ENST00000532879.5; ENST00000406246.8; ENST00000532999.5; ENST00000525301.5; ENST00000531238.1; ENST00000527074.5; ENST00000529389.5
External Link	RMBase: RNA-editing_site_22781

N1-methyladenosine (m1A)

In total 1 m6A sequence/site(s) in this target gene
mod ID: M1ASITE000021		Click to Show/Hide the Full List
mod site	chr11:65654139-65654140:-		[9]
Sequence	GGGGGAGCTGGGGAAACTCAAACTTTTCCCCTGTCCTGATG
Cell/Tissue List	HEK293T
Seq Type List	m1A-seq
Transcript ID List	ENST00000526283.6; ENST00000531484.5; ENST00000612991.4; ENST00000308639.13; ENST00000406246.8; ENST00000525693.5; ENST00000615805.4
External Link	RMBase: m1A_site_203

5-methylcytidine (m5C)

In total 3 m6A sequence/site(s) in this target gene
mod ID: M5CSITE005220		Click to Show/Hide the Full List
mod site	chr11:65654447-65654448:-
Sequence	GCTCCCCAATGGCCTCCTTTCAGGAGATGAAGACTTCTCCT
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000531484.5; ENST00000615805.4; ENST00000525693.5; ENST00000406246.8; ENST00000526283.6; ENST00000612991.4; ENST00000308639.13
External Link	RMBase: m5C_site_7954
mod ID: M5CSITE005221		Click to Show/Hide the Full List
mod site	chr11:65654471-65654472:-		[10]
Sequence	TCCTGCTCCACTGGGGGCCCCGGGGCTCCCCAATGGCCTCC
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000531484.5; ENST00000308639.13; ENST00000615805.4; ENST00000406246.8; ENST00000612991.4; ENST00000525693.5; ENST00000526283.6
External Link	RMBase: m5C_site_7955
mod ID: M5CSITE005222		Click to Show/Hide the Full List
mod site	chr11:65662655-65662656:-
Sequence	AGGCGGGGAGGGGTCTGACTCAGTTTCCCCTCTGGGTGGAG
Cell/Tissue List	T24
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000533187.5; ENST00000534283.1; ENST00000526283.6; ENST00000527074.5; ENST00000529389.5; ENST00000532879.5; ENST00000615805.4; ENST00000406246.8; ENST00000525693.5; ENST00000527749.5; ENST00000531238.1; ENST00000308639.13; ENST00000532776.5; ENST00000532999.5; ENST00000534558.5; ENST00000525858.5; ENST00000531484.5; ENST00000527909.5; ENST00000534305.1; ENST00000533546.5; ENST00000525301.5; ENST00000612991.4; ENST00000525658.5
External Link	RMBase: m5C_site_7956

N6-methyladenosine (m6A)

In total 84 m6A sequence/site(s) in this target gene
mod ID: M6ASITE007111		Click to Show/Hide the Full List
mod site	chr11:65653624-65653625:-		[11]
Sequence	TCTTGCTCTTTCTACTCTGAACTAATAAATCTGTTGCCAAG
Motif Score	3.373380952
Cell/Tissue List	HeLa; HEK293T; HepG2; LCLs; H1299; MM6; Jurkat; HEK293A-TOA; MSC; TIME; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000612991.4; ENST00000308639.13; ENST00000406246.8; ENST00000615805.4; ENST00000526283.6; ENST00000525693.5
External Link	RMBase: m6A_site_148625
mod ID: M6ASITE007112		Click to Show/Hide the Full List
mod site	chr11:65653646-65653647:-		[11]
Sequence	TGAACAATCAAAGCACTTGGACTCTTGCTCTTTCTACTCTG
Motif Score	4.065041667
Cell/Tissue List	HeLa; CD34; HEK293T; HepG2; LCLs; H1299; MM6; Jurkat; HEK293A-TOA; MSC; TIME; TREX; AML
Seq Type List	m6A-seq; MeRIP-seq; miCLIP
Transcript ID List	ENST00000406246.8; ENST00000526283.6; ENST00000308639.13; ENST00000615805.4; ENST00000525693.5; ENST00000612991.4
External Link	RMBase: m6A_site_148626
mod ID: M6ASITE007113		Click to Show/Hide the Full List
mod site	chr11:65653652-65653653:-		[12]
Sequence	TTTTACTGAACAATCAAAGCACTTGGACTCTTGCTCTTTCT
Motif Score	3.252583333
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000308639.13; ENST00000525693.5; ENST00000526283.6; ENST00000612991.4; ENST00000406246.8; ENST00000615805.4
External Link	RMBase: m6A_site_148627
mod ID: M6ASITE007114		Click to Show/Hide the Full List
mod site	chr11:65653663-65653664:-		[11]
Sequence	GGAGGCATAGTTTTTACTGAACAATCAAAGCACTTGGACTC
Motif Score	2.951386905
Cell/Tissue List	HeLa; CD34; HEK293T; hESC-HEK293T; HepG2; LCLs; H1299; MM6; Jurkat; HEK293A-TOA; MSC; TIME; TREX; AML
Seq Type List	m6A-seq; MeRIP-seq; MAZTER-seq; miCLIP
Transcript ID List	ENST00000526283.6; ENST00000308639.13; ENST00000406246.8; ENST00000615805.4; ENST00000525693.5; ENST00000612991.4
External Link	RMBase: m6A_site_148628
mod ID: M6ASITE007115		Click to Show/Hide the Full List
mod site	chr11:65653668-65653669:-		[12]
Sequence	AGTCAGGAGGCATAGTTTTTACTGAACAATCAAAGCACTTG
Motif Score	2.494845238
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000526283.6; ENST00000612991.4; ENST00000525693.5; ENST00000406246.8; ENST00000615805.4; ENST00000308639.13
External Link	RMBase: m6A_site_148629
mod ID: M6ASITE007117		Click to Show/Hide the Full List
mod site	chr11:65653771-65653772:-		[11]
Sequence	CAGAAGGGGTTTGGTCTGGGACTTCCTTGCTCTCCCTCTTC
Motif Score	4.065041667
Cell/Tissue List	HeLa; CD34; HEK293T; A549; HEK293A-TOA; TIME; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000525693.5; ENST00000615805.4; ENST00000406246.8; ENST00000526283.6; ENST00000308639.13; ENST00000612991.4
External Link	RMBase: m6A_site_148630
mod ID: M6ASITE007118		Click to Show/Hide the Full List
mod site	chr11:65653824-65653825:-		[11]
Sequence	CTCAACCATGGCTGAAGGAAACCAGTGCAACAGCACTGGCT
Motif Score	2.185083333
Cell/Tissue List	HeLa; CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000308639.13; ENST00000406246.8; ENST00000525693.5; ENST00000526283.6; ENST00000615805.4; ENST00000612991.4
External Link	RMBase: m6A_site_148631
mod ID: M6ASITE007119		Click to Show/Hide the Full List
mod site	chr11:65653872-65653873:-		[13]
Sequence	GGGGCTGGCCTTCCTGCCCTACAGAGGTCTCTGCCGGCTCT
Motif Score	2.078666667
Cell/Tissue List	kidney
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000525693.5; ENST00000308639.13; ENST00000526283.6; ENST00000612991.4; ENST00000615805.4; ENST00000406246.8
External Link	RMBase: m6A_site_148632
mod ID: M6ASITE007120		Click to Show/Hide the Full List
mod site	chr11:65653906-65653907:-		[14]
Sequence	TGGCATTGTCCCTGTGCCTAACACCAGCGTTTGAGGGGCTG
Motif Score	2.168095238
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000525693.5; ENST00000615805.4; ENST00000406246.8; ENST00000612991.4; ENST00000308639.13; ENST00000526283.6
External Link	RMBase: m6A_site_148633
mod ID: M6ASITE007121		Click to Show/Hide the Full List
mod site	chr11:65653973-65653974:-		[12]
Sequence	TCTTCCATCATGGATTCATTACAGCTTAATCAAAATAACGC
Motif Score	2.07285119
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000615805.4; ENST00000612991.4; ENST00000531484.5; ENST00000526283.6; ENST00000308639.13; ENST00000406246.8; ENST00000525693.5
External Link	RMBase: m6A_site_148634
mod ID: M6ASITE007122		Click to Show/Hide the Full List
mod site	chr11:65654045-65654046:-		[15]
Sequence	CTTCTGGTACTCTCCTAGAGACAGAAGCAGGCTGGAGGTAA
Motif Score	2.897386905
Cell/Tissue List	CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000406246.8; ENST00000612991.4; ENST00000308639.13; ENST00000531484.5; ENST00000525693.5; ENST00000526283.6; ENST00000615805.4
External Link	RMBase: m6A_site_148635
mod ID: M6ASITE007123		Click to Show/Hide the Full List
mod site	chr11:65654057-65654058:-		[12]
Sequence	CCCATCCTCCAGCTTCTGGTACTCTCCTAGAGACAGAAGCA
Motif Score	3.278136905
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000612991.4; ENST00000526283.6; ENST00000615805.4; ENST00000406246.8; ENST00000308639.13; ENST00000525693.5; ENST00000531484.5
External Link	RMBase: m6A_site_148636
mod ID: M6ASITE007124		Click to Show/Hide the Full List
mod site	chr11:65654095-65654096:-		[15]
Sequence	AGCTCCCTTCTCTGTAGGGAACTCTGGGGTCCCCCATCCCC
Motif Score	3.373380952
Cell/Tissue List	CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000406246.8; ENST00000308639.13; ENST00000526283.6; ENST00000612991.4; ENST00000531484.5; ENST00000615805.4; ENST00000525693.5
External Link	RMBase: m6A_site_148637
mod ID: M6ASITE007125		Click to Show/Hide the Full List
mod site	chr11:65654138-65654139:-		[15]
Sequence	GGGGAGCTGGGGAAACTCAAACTTTTCCCCTGTCCTGATGG
Motif Score	2.627720238
Cell/Tissue List	CD34; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000525693.5; ENST00000526283.6; ENST00000406246.8; ENST00000612991.4; ENST00000615805.4; ENST00000308639.13; ENST00000531484.5
External Link	RMBase: m6A_site_148638
mod ID: M6ASITE007126		Click to Show/Hide the Full List
mod site	chr11:65654144-65654145:-		[15]
Sequence	GAAAGGGGGGAGCTGGGGAAACTCAAACTTTTCCCCTGTCC
Motif Score	2.627720238
Cell/Tissue List	CD34; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000612991.4; ENST00000308639.13; ENST00000615805.4; ENST00000531484.5; ENST00000525693.5; ENST00000406246.8; ENST00000526283.6
External Link	RMBase: m6A_site_148639
mod ID: M6ASITE007128		Click to Show/Hide the Full List
mod site	chr11:65654173-65654174:-		[12]
Sequence	GTGCTTAAGCAGAAGCATTAACTTCTCTGGAAAGGGGGGAG
Motif Score	2.590089286
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000406246.8; ENST00000308639.13; ENST00000531484.5; ENST00000526283.6; ENST00000612991.4; ENST00000525693.5; ENST00000615805.4
External Link	RMBase: m6A_site_148640
mod ID: M6ASITE007129		Click to Show/Hide the Full List
mod site	chr11:65654276-65654277:-		[12]
Sequence	GTGTGTTCCAACTGCCCCCAACTTTGTGGATGTCTTCCTTG
Motif Score	2.595904762
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000406246.8; ENST00000525693.5; ENST00000308639.13; ENST00000615805.4; ENST00000526283.6; ENST00000531484.5; ENST00000612991.4
External Link	RMBase: m6A_site_148641
mod ID: M6ASITE007130		Click to Show/Hide the Full List
mod site	chr11:65654311-65654312:-		[12]
Sequence	GAAGCCCTCCAAAAGCACTTACGGATTCTGGTGGGGTGTGT
Motif Score	2.046785714
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000406246.8; ENST00000612991.4; ENST00000526283.6; ENST00000525693.5; ENST00000308639.13; ENST00000531484.5; ENST00000615805.4
External Link	RMBase: m6A_site_148642
mod ID: M6ASITE007131		Click to Show/Hide the Full List
mod site	chr11:65654315-65654316:-		[12]
Sequence	GATTGAAGCCCTCCAAAAGCACTTACGGATTCTGGTGGGGT
Motif Score	3.252583333
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000308639.13; ENST00000615805.4; ENST00000612991.4; ENST00000526283.6; ENST00000531484.5; ENST00000406246.8; ENST00000525693.5
External Link	RMBase: m6A_site_148643
mod ID: M6ASITE007132		Click to Show/Hide the Full List
mod site	chr11:65654369-65654370:-		[12]
Sequence	GATCAGCTCCTAAGGGGGTGACGCCTGCCCTCCCCAGAGCA
Motif Score	2.833690476
Cell/Tissue List	HEK293T; CD8T; A549
Seq Type List	DART-seq; m6A-CLIP/IP
Transcript ID List	ENST00000531484.5; ENST00000526283.6; ENST00000406246.8; ENST00000615805.4; ENST00000525693.5; ENST00000612991.4; ENST00000308639.13
External Link	RMBase: m6A_site_148644
mod ID: M6ASITE007133		Click to Show/Hide the Full List
mod site	chr11:65654411-65654412:-		[11]
Sequence	CTCCTCCATTGCGGACATGGACTTCTCAGCCCTGCTGAGTC
Motif Score	4.065041667
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000531484.5; ENST00000406246.8; ENST00000612991.4; ENST00000526283.6; ENST00000615805.4; ENST00000308639.13; ENST00000525693.5
External Link	RMBase: m6A_site_148645
mod ID: M6ASITE007134		Click to Show/Hide the Full List
mod site	chr11:65654417-65654418:-		[11]
Sequence	AGACTTCTCCTCCATTGCGGACATGGACTTCTCAGCCCTGC
Motif Score	3.643047619
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000406246.8; ENST00000531484.5; ENST00000612991.4; ENST00000526283.6; ENST00000308639.13; ENST00000615805.4; ENST00000525693.5
External Link	RMBase: m6A_site_148646
mod ID: M6ASITE007135		Click to Show/Hide the Full List
mod site	chr11:65654435-65654436:-		[11]
Sequence	CCTCCTTTCAGGAGATGAAGACTTCTCCTCCATTGCGGACA
Motif Score	3.319380952
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000612991.4; ENST00000615805.4; ENST00000531484.5; ENST00000525693.5; ENST00000308639.13; ENST00000406246.8; ENST00000526283.6
External Link	RMBase: m6A_site_148647
mod ID: M6ASITE007136		Click to Show/Hide the Full List
mod site	chr11:65654520-65654521:-		[12]
Sequence	AGGCTATAACTCGCCTAGTGACAGGGGCCCAGAGGCCCCCC
Motif Score	2.859755952
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000406246.8; ENST00000308639.13; ENST00000526283.6; ENST00000531484.5; ENST00000615805.4; ENST00000612991.4; ENST00000525693.5
External Link	RMBase: m6A_site_148648
mod ID: M6ASITE007137		Click to Show/Hide the Full List
mod site	chr11:65654573-65654574:-		[14]
Sequence	GGGCATACCTGTGGCCCCCCACACAACTGAGCCCATGCTGA
Motif Score	2.053113095
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000531484.5; ENST00000406246.8; ENST00000615805.4; ENST00000525693.5; ENST00000526283.6; ENST00000612991.4; ENST00000308639.13
External Link	RMBase: m6A_site_148649
mod ID: M6ASITE007139		Click to Show/Hide the Full List
mod site	chr11:65654597-65654598:-		[11]
Sequence	CGAGTTTCAGCAGCTGCTGAACCAGGGCATACCTGTGGCCC
Motif Score	2.930744048
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; LCLs; MM6; Huh7; Jurkat; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000526283.6; ENST00000531484.5; ENST00000308639.13; ENST00000612991.4; ENST00000406246.8; ENST00000525693.5; ENST00000615805.4
External Link	RMBase: m6A_site_148650
mod ID: M6ASITE007140		Click to Show/Hide the Full List
mod site	chr11:65654624-65654625:-		[14]
Sequence	CACAGACCTGGCATCCGTCGACAACTCCGAGTTTCAGCAGC
Motif Score	2.865571429
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000308639.13; ENST00000406246.8; ENST00000612991.4; ENST00000615805.4; ENST00000526283.6; ENST00000525693.5; ENST00000531484.5
External Link	RMBase: m6A_site_148651
mod ID: M6ASITE007141		Click to Show/Hide the Full List
mod site	chr11:65654639-65654640:-		[16]
Sequence	AGACCCAGCTGTGTTCACAGACCTGGCATCCGTCGACAACT
Motif Score	2.876744048
Cell/Tissue List	HepG2; HEK293T; HeLa; A549; U2OS; MM6; Huh7; Jurkat; peripheral-blood; GSC-11; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000615805.4; ENST00000406246.8; ENST00000525693.5; ENST00000531484.5; ENST00000308639.13; ENST00000526283.6; ENST00000612991.4
External Link	RMBase: m6A_site_148652
mod ID: M6ASITE007142		Click to Show/Hide the Full List
mod site	chr11:65654643-65654644:-		[12]
Sequence	GCACAGACCCAGCTGTGTTCACAGACCTGGCATCCGTCGAC
Motif Score	2.047297619
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000531484.5; ENST00000525693.5; ENST00000526283.6; ENST00000308639.13; ENST00000612991.4; ENST00000406246.8; ENST00000615805.4
External Link	RMBase: m6A_site_148653
mod ID: M6ASITE007143		Click to Show/Hide the Full List
mod site	chr11:65654657-65654658:-		[11]
Sequence	CTTGCTTGGCAACAGCACAGACCCAGCTGTGTTCACAGACC
Motif Score	2.876744048
Cell/Tissue List	HeLa; HepG2; HEK293T; U2OS; MM6; Huh7; Jurkat; peripheral-blood; GSC-11; iSLK; MSC; TIME; TREX; endometrial; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	rmsk_3569880; ENST00000612991.4; ENST00000531484.5; ENST00000615805.4; ENST00000526283.6; ENST00000525693.5; ENST00000406246.8; ENST00000308639.13
External Link	RMBase: m6A_site_148654
mod ID: M6ASITE007144		Click to Show/Hide the Full List
mod site	chr11:65654687-65654688:-		[11]
Sequence	GCTGCAGTTTGATGATGAAGACCTGGGGGCCTTGCTTGGCA
Motif Score	2.876744048
Cell/Tissue List	HeLa; HepG2; HEK293T; MM6; Jurkat; peripheral-blood; GSC-11; TIME; TREX; MSC; endometrial; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000531484.5; ENST00000525693.5; ENST00000612991.4; ENST00000615805.4; ENST00000406246.8; rmsk_3569880; ENST00000526283.6; ENST00000308639.13
External Link	RMBase: m6A_site_148655
mod ID: M6ASITE007145		Click to Show/Hide the Full List
mod site	chr11:65654979-65654980:-		[12]
Sequence	CACCCCAGCCCTATCCCTTTACGTCATCCCTGAGCACCATC
Motif Score	2.046785714
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000525693.5; ENST00000526283.6; ENST00000615805.4; ENST00000308639.13; ENST00000532999.5; ENST00000406246.8; ENST00000531484.5; ENST00000612991.4
External Link	RMBase: m6A_site_148656
mod ID: M6ASITE007146		Click to Show/Hide the Full List
mod site	chr11:65655167-65655168:-		[11]
Sequence	GGAGGTGTGGCTAGAACTGGACCCTACAGGCTGGGTCAGAT
Motif Score	3.622404762
Cell/Tissue List	HeLa; LCLs; MT4; MM6; Huh7; Jurkat; TREX; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000526283.6; ENST00000308639.13; ENST00000406246.8; ENST00000531484.5; ENST00000525693.5; ENST00000615805.4; ENST00000612991.4; ENST00000532999.5
External Link	RMBase: m6A_site_148657
mod ID: M6ASITE007147		Click to Show/Hide the Full List
mod site	chr11:65655172-65655173:-		[11]
Sequence	AAGGTGGAGGTGTGGCTAGAACTGGACCCTACAGGCTGGGT
Motif Score	3.373380952
Cell/Tissue List	HeLa; LCLs; MT4; MM6; Huh7; Jurkat; TREX; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000406246.8; ENST00000308639.13; ENST00000526283.6; ENST00000525693.5; ENST00000531484.5; ENST00000612991.4; ENST00000532999.5; ENST00000615805.4
External Link	RMBase: m6A_site_148658
mod ID: M6ASITE007148		Click to Show/Hide the Full List
mod site	chr11:65655197-65655198:-		[11]
Sequence	GGCTTGAGTAGTCAGGGAGGACTCCAAGGTGGAGGTGTGGC
Motif Score	4.065041667
Cell/Tissue List	HeLa; LCLs; MM6; Huh7; Jurkat; TREX; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000406246.8; ENST00000532999.5; ENST00000525693.5; ENST00000526283.6; ENST00000615805.4; ENST00000531484.5; ENST00000612991.4; ENST00000308639.13
External Link	RMBase: m6A_site_148659
mod ID: M6ASITE007150		Click to Show/Hide the Full List
mod site	chr11:65655280-65655281:-		[11]
Sequence	ACTTAGTTTTTCAGCTGTAAACTGAGGAGTCCAGCTTATCT
Motif Score	2.627720238
Cell/Tissue List	HeLa; H1B
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000526283.6; rmsk_3569882; ENST00000615805.4; ENST00000532999.5; ENST00000308639.13; ENST00000612991.4; ENST00000406246.8; ENST00000525693.5; ENST00000531484.5
External Link	RMBase: m6A_site_148660
mod ID: M6ASITE007151		Click to Show/Hide the Full List
mod site	chr11:65655300-65655301:-		[11]
Sequence	TGGGCTCATTGCCTCTCAGGACTTAGTTTTTCAGCTGTAAA
Motif Score	4.065041667
Cell/Tissue List	HeLa; H1B
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000525693.5; ENST00000308639.13; ENST00000612991.4; rmsk_3569882; ENST00000532999.5; ENST00000615805.4; ENST00000531484.5; ENST00000406246.8; ENST00000526283.6
External Link	RMBase: m6A_site_148661
mod ID: M6ASITE007152		Click to Show/Hide the Full List
mod site	chr11:65655365-65655366:-		[17]
Sequence	TGCCTGTGCGAGGCTCAAAAACTGACAAGCTCTGCACTTCA
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000525693.5; ENST00000532999.5; ENST00000406246.8; ENST00000612991.4; ENST00000531484.5; ENST00000615805.4; ENST00000308639.13; ENST00000526283.6
External Link	RMBase: m6A_site_148662
mod ID: M6ASITE007153		Click to Show/Hide the Full List
mod site	chr11:65655418-65655419:-		[17]
Sequence	CTCTCACTTGAATTGGGGGAACAAAAATCACCTCTAAATTA
Motif Score	2.951386905
Cell/Tissue List	HeLa
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000525693.5; ENST00000531484.5; ENST00000532999.5; ENST00000308639.13; ENST00000612991.4; ENST00000406246.8; ENST00000615805.4; ENST00000526283.6
External Link	RMBase: m6A_site_148663
mod ID: M6ASITE007154		Click to Show/Hide the Full List
mod site	chr11:65655513-65655514:-		[11]
Sequence	ATGCACACTGAAGCCTGGGAACCACCGTGCCACTTAAATTC
Motif Score	2.930744048
Cell/Tissue List	HeLa; Jurkat
Seq Type List	m6A-seq
Transcript ID List	ENST00000531484.5; ENST00000526283.6; ENST00000525693.5; rmsk_3569883; ENST00000532999.5; ENST00000406246.8; ENST00000308639.13; ENST00000612991.4; ENST00000615805.4
External Link	RMBase: m6A_site_148664
mod ID: M6ASITE007155		Click to Show/Hide the Full List
mod site	chr11:65655556-65655557:-		[11]
Sequence	TTTGAAAGGATGGCGCAGGAACCAGCGACTTCCTGGGATGC
Motif Score	2.930744048
Cell/Tissue List	HeLa; Jurkat
Seq Type List	m6A-seq
Transcript ID List	ENST00000531484.5; ENST00000308639.13; ENST00000615805.4; ENST00000406246.8; ENST00000612991.4; ENST00000526283.6; ENST00000525693.5; rmsk_3569883; ENST00000532999.5
External Link	RMBase: m6A_site_148665
mod ID: M6ASITE007156		Click to Show/Hide the Full List
mod site	chr11:65655594-65655595:-		[11]
Sequence	ACTCCTGGGCCCCATTACAGACCTACTGAATCAGAGGCTTT
Motif Score	2.876744048
Cell/Tissue List	HeLa; Jurkat
Seq Type List	m6A-seq
Transcript ID List	ENST00000308639.13; ENST00000526283.6; ENST00000612991.4; ENST00000532999.5; rmsk_3569883; ENST00000531484.5; ENST00000525693.5; ENST00000406246.8; ENST00000615805.4
External Link	RMBase: m6A_site_148666
mod ID: M6ASITE007157		Click to Show/Hide the Full List
mod site	chr11:65655614-65655615:-		[11]
Sequence	GAGGAGCAGTGGAGATGAAGACTCCTGGGCCCCATTACAGA
Motif Score	3.319380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000406246.8; ENST00000612991.4; ENST00000531484.5; ENST00000525693.5; rmsk_3569883; ENST00000615805.4; ENST00000308639.13; ENST00000532999.5; ENST00000526283.6
External Link	RMBase: m6A_site_148667
mod ID: M6ASITE007158		Click to Show/Hide the Full List
mod site	chr11:65655890-65655891:-		[11]
Sequence	AACGTAAAAGGACATATGAGACCTTCAAGAGCATCATGAAG
Motif Score	2.876744048
Cell/Tissue List	HeLa; CD34; MT4; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000526257.1; ENST00000525693.5; ENST00000526283.6; ENST00000612991.4; ENST00000406246.8; ENST00000532999.5; ENST00000615805.4; ENST00000531484.5; ENST00000308639.13; ENST00000529389.5
External Link	RMBase: m6A_site_148668
mod ID: M6ASITE007159		Click to Show/Hide the Full List
mod site	chr11:65655899-65655900:-		[11]
Sequence	TTGAGGAGAAACGTAAAAGGACATATGAGACCTTCAAGAGC
Motif Score	3.643047619
Cell/Tissue List	HeLa; CD34; hESC-HEK293T; MT4; Huh7
Seq Type List	m6A-seq; MAZTER-seq; MeRIP-seq
Transcript ID List	ENST00000526257.1; ENST00000531484.5; ENST00000526283.6; ENST00000525693.5; ENST00000612991.4; ENST00000406246.8; ENST00000308639.13; ENST00000529389.5; ENST00000532999.5; ENST00000615805.4
External Link	RMBase: m6A_site_148669
mod ID: M6ASITE007161		Click to Show/Hide the Full List
mod site	chr11:65658387-65658388:-		[11]
Sequence	CCGGACCCCTCCCTACGCAGACCCCAGCCTGCAGGCTCCTG
Motif Score	2.876744048
Cell/Tissue List	HeLa; CD34; MT4; Huh7; peripheral-blood
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000615805.4; ENST00000525693.5; ENST00000406246.8; ENST00000526283.6; ENST00000529389.5; ENST00000308639.13; ENST00000612991.4; ENST00000525658.5; ENST00000531484.5; ENST00000532999.5; ENST00000526257.1
External Link	RMBase: m6A_site_148670
mod ID: M6ASITE007162		Click to Show/Hide the Full List
mod site	chr11:65658403-65658404:-		[11]
Sequence	AAGTGGCCATTGTGTTCCGGACCCCTCCCTACGCAGACCCC
Motif Score	3.622404762
Cell/Tissue List	HeLa; CD34; MT4; Huh7; peripheral-blood
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000526257.1; ENST00000612991.4; ENST00000526283.6; ENST00000615805.4; ENST00000525658.5; ENST00000308639.13; ENST00000406246.8; ENST00000529389.5; ENST00000532999.5; ENST00000531484.5; ENST00000525693.5
External Link	RMBase: m6A_site_148671
mod ID: M6ASITE007163		Click to Show/Hide the Full List
mod site	chr11:65658425-65658426:-		[14]
Sequence	TCGCAAGCTGATGTGCACCGACAAGTGGCCATTGTGTTCCG
Motif Score	2.865571429
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000526257.1; ENST00000308639.13; ENST00000525658.5; ENST00000615805.4; ENST00000406246.8; ENST00000531484.5; ENST00000525693.5; ENST00000529389.5; ENST00000532999.5; ENST00000526283.6; ENST00000612991.4
External Link	RMBase: m6A_site_148672
mod ID: M6ASITE007164		Click to Show/Hide the Full List
mod site	chr11:65658473-65658474:-		[15]
Sequence	ATTGAGGTGTATTTCACGGGACCAGGCTGGGAGGCCCGAGG
Motif Score	3.622404762
Cell/Tissue List	CD34; MM6; Huh7; peripheral-blood
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000526257.1; ENST00000529389.5; ENST00000525658.5; ENST00000526283.6; ENST00000615805.4; ENST00000531484.5; ENST00000612991.4; ENST00000533546.5; ENST00000406246.8; ENST00000532999.5; ENST00000525693.5; ENST00000308639.13
External Link	RMBase: m6A_site_148673
mod ID: M6ASITE007165		Click to Show/Hide the Full List
mod site	chr11:65658495-65658496:-		[15]
Sequence	CACCGCATCTCCTGCAGAGGACATTGAGGTGTATTTCACGG
Motif Score	3.643047619
Cell/Tissue List	CD34; hESC-HEK293T; MM6; Huh7; peripheral-blood
Seq Type List	m6A-seq; MAZTER-seq; MeRIP-seq
Transcript ID List	ENST00000525693.5; ENST00000526283.6; ENST00000615805.4; ENST00000529389.5; ENST00000308639.13; ENST00000531484.5; ENST00000533546.5; ENST00000526257.1; ENST00000525658.5; ENST00000406246.8; ENST00000532999.5; ENST00000612991.4
External Link	RMBase: m6A_site_148674
mod ID: M6ASITE007166		Click to Show/Hide the Full List
mod site	chr11:65658731-65658732:-		[14]
Sequence	TGAGATCTTCCTACTGTGTGACAAGGTGCAGAAAGGTATAC
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000529389.5; ENST00000308639.13; ENST00000533546.5; ENST00000525693.5; ENST00000526257.1; ENST00000527749.5; ENST00000526738.1; ENST00000534558.5; ENST00000526283.6; ENST00000615805.4; ENST00000532999.5; ENST00000525658.5; ENST00000612991.4; ENST00000406246.8; ENST00000531484.5; ENST00000527909.5
External Link	RMBase: m6A_site_148675
mod ID: M6ASITE007167		Click to Show/Hide the Full List
mod site	chr11:65658776-65658777:-		[15]
Sequence	GATCTGCCGAGTGAACCGAAACTCTGGCAGCTGCCTCGGTG
Motif Score	2.627720238
Cell/Tissue List	CD34; MT4; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000527909.5; ENST00000526283.6; ENST00000308639.13; ENST00000525693.5; ENST00000526738.1; ENST00000612991.4; ENST00000525658.5; ENST00000531484.5; ENST00000533546.5; ENST00000615805.4; ENST00000529330.1; ENST00000529389.5; ENST00000532999.5; ENST00000534558.5; ENST00000526257.1; ENST00000527749.5; ENST00000406246.8
External Link	RMBase: m6A_site_148676
mod ID: M6ASITE007168		Click to Show/Hide the Full List
mod site	chr11:65658782-65658783:-		[15]
Sequence	GCTCAAGATCTGCCGAGTGAACCGAAACTCTGGCAGCTGCC
Motif Score	2.930744048
Cell/Tissue List	CD34; MT4; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000308639.13; ENST00000529330.1; ENST00000526257.1; ENST00000526738.1; ENST00000534558.5; ENST00000527749.5; ENST00000615805.4; ENST00000526283.6; ENST00000532999.5; ENST00000525658.5; ENST00000525693.5; ENST00000529389.5; ENST00000612991.4; ENST00000406246.8; ENST00000527909.5; ENST00000533546.5; ENST00000531484.5
External Link	RMBase: m6A_site_148677
mod ID: M6ASITE007169		Click to Show/Hide the Full List
mod site	chr11:65658812-65658813:-		[14]
Sequence	CACTGCCTCAGGTGCCCCCAACACTGCCGAGCTCAAGATCT
Motif Score	2.173910714
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000308639.13; ENST00000527909.5; ENST00000525658.5; ENST00000527749.5; ENST00000529330.1; ENST00000525693.5; ENST00000615805.4; ENST00000531484.5; ENST00000534558.5; ENST00000612991.4; ENST00000526257.1; ENST00000533546.5; ENST00000529389.5; ENST00000406246.8; ENST00000526283.6; ENST00000526738.1; ENST00000532999.5
External Link	RMBase: m6A_site_148678
mod ID: M6ASITE007170		Click to Show/Hide the Full List
mod site	chr11:65659670-65659671:-		[14]
Sequence	CCTTTCTCATCCCATCTTTGACAATCGTGAGTAGCGAGGGA
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000525693.5; ENST00000527909.5; ENST00000526257.1; ENST00000532999.5; ENST00000531484.5; ENST00000308639.13; ENST00000526283.6; ENST00000406246.8; ENST00000615805.4; ENST00000612991.4; ENST00000529389.5; ENST00000526738.1; ENST00000534558.5; ENST00000525658.5; ENST00000529330.1; ENST00000533546.5; ENST00000527749.5
External Link	RMBase: m6A_site_148679
mod ID: M6ASITE007172		Click to Show/Hide the Full List
mod site	chr11:65659724-65659725:-		[15]
Sequence	CTTCCAGGTGACAGTGCGGGACCCATCAGGCAGGCCCCTCC
Motif Score	3.622404762
Cell/Tissue List	CD34; MT4; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000532999.5; ENST00000406246.8; ENST00000532879.5; ENST00000531484.5; ENST00000527909.5; ENST00000615805.4; ENST00000526257.1; ENST00000525693.5; ENST00000529330.1; ENST00000526738.1; ENST00000533546.5; ENST00000529389.5; ENST00000525658.5; ENST00000534558.5; ENST00000527749.5; ENST00000308639.13; ENST00000526283.6; ENST00000612991.4
External Link	RMBase: m6A_site_148680
mod ID: M6ASITE007173		Click to Show/Hide the Full List
mod site	chr11:65659734-65659735:-		[13]
Sequence	TGCGGCTCTGCTTCCAGGTGACAGTGCGGGACCCATCAGGC
Motif Score	2.859755952
Cell/Tissue List	liver
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000534558.5; ENST00000527909.5; ENST00000612991.4; ENST00000615805.4; ENST00000529389.5; ENST00000533546.5; ENST00000532879.5; ENST00000526283.6; ENST00000525658.5; ENST00000308639.13; ENST00000527749.5; ENST00000526257.1; ENST00000529330.1; ENST00000531484.5; ENST00000406246.8; ENST00000532999.5; ENST00000526738.1; ENST00000525693.5
External Link	RMBase: m6A_site_148681
mod ID: M6ASITE007174		Click to Show/Hide the Full List
mod site	chr11:65659772-65659773:-		[15]
Sequence	TATAGAAGAGCAGCGTGGGGACTACGACCTGAATGCTGTGC
Motif Score	4.065041667
Cell/Tissue List	CD34
Seq Type List	m6A-seq
Transcript ID List	ENST00000525693.5; ENST00000527749.5; ENST00000612991.4; ENST00000532879.5; ENST00000533546.5; ENST00000534558.5; ENST00000525658.5; ENST00000531238.1; ENST00000615805.4; ENST00000308639.13; ENST00000532999.5; ENST00000531484.5; ENST00000529330.1; ENST00000526738.1; ENST00000529389.5; ENST00000406246.8; ENST00000526283.6; ENST00000527909.5
External Link	RMBase: m6A_site_148682
mod ID: M6ASITE007175		Click to Show/Hide the Full List
mod site	chr11:65660039-65660040:-		[18]
Sequence	CATCTCCCTCACTGGCCAAGACACAGTAAAGCTGGAATCTT
Motif Score	2.897386905
Cell/Tissue List	HEK293T
Seq Type List	m6A-seq
Transcript ID List	ENST00000527909.5; ENST00000531238.1; ENST00000615805.4; ENST00000526738.1; ENST00000531484.5; ENST00000406246.8; ENST00000525658.5; ENST00000526283.6; ENST00000525693.5; ENST00000529330.1; ENST00000612991.4; ENST00000529389.5; ENST00000534558.5; ENST00000533546.5; ENST00000308639.13; ENST00000527749.5; ENST00000532999.5; ENST00000532879.5
External Link	RMBase: m6A_site_148683
mod ID: M6ASITE007176		Click to Show/Hide the Full List
mod site	chr11:65660112-65660113:-		[11]
Sequence	CCCTTCCAAGGTGAGGGCAAACCTGCCTGCCACACCCGCAC
Motif Score	2.185083333
Cell/Tissue List	HeLa; Huh7; CD4T; peripheral-blood; endometrial; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000527749.5; ENST00000526283.6; ENST00000531484.5; ENST00000532999.5; ENST00000529330.1; ENST00000527074.5; ENST00000525658.5; ENST00000531238.1; ENST00000615805.4; ENST00000529389.5; ENST00000406246.8; ENST00000527909.5; ENST00000612991.4; ENST00000526738.1; ENST00000308639.13; ENST00000532879.5; ENST00000525693.5; ENST00000533546.5; ENST00000534558.5
External Link	RMBase: m6A_site_148684
mod ID: M6ASITE007177		Click to Show/Hide the Full List
mod site	chr11:65660137-65660138:-		[14]
Sequence	TCAGCGCATCCAGACCAACAACAACCCCTTCCAAGGTGAGG
Motif Score	2.173910714
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000527074.5; ENST00000531238.1; ENST00000534558.5; ENST00000612991.4; ENST00000532999.5; ENST00000406246.8; ENST00000525693.5; ENST00000526283.6; ENST00000529389.5; ENST00000525658.5; ENST00000527749.5; ENST00000532879.5; ENST00000531484.5; ENST00000529330.1; ENST00000527909.5; ENST00000615805.4; ENST00000533546.5; ENST00000308639.13; ENST00000526738.1
External Link	RMBase: m6A_site_148685
mod ID: M6ASITE007178		Click to Show/Hide the Full List
mod site	chr11:65660140-65660141:-		[14]
Sequence	CAGTCAGCGCATCCAGACCAACAACAACCCCTTCCAAGGTG
Motif Score	2.173910714
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000527074.5; ENST00000531238.1; ENST00000406246.8; ENST00000615805.4; ENST00000527749.5; ENST00000529330.1; ENST00000525658.5; ENST00000308639.13; ENST00000526738.1; ENST00000532999.5; ENST00000531484.5; ENST00000526283.6; ENST00000612991.4; ENST00000533546.5; ENST00000527909.5; ENST00000534558.5; ENST00000529389.5; ENST00000525693.5; ENST00000532879.5
External Link	RMBase: m6A_site_148686
mod ID: M6ASITE007179		Click to Show/Hide the Full List
mod site	chr11:65660144-65660145:-		[11]
Sequence	CTATCAGTCAGCGCATCCAGACCAACAACAACCCCTTCCAA
Motif Score	2.876744048
Cell/Tissue List	HeLa; CD34; Huh7; CD4T; peripheral-blood; endometrial; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000527074.5; ENST00000527749.5; ENST00000529389.5; ENST00000533546.5; ENST00000615805.4; ENST00000531484.5; ENST00000525658.5; ENST00000532879.5; ENST00000308639.13; ENST00000526738.1; ENST00000532999.5; ENST00000527909.5; ENST00000529330.1; ENST00000525693.5; ENST00000531238.1; ENST00000526283.6; ENST00000534558.5; ENST00000406246.8; ENST00000612991.4
External Link	RMBase: m6A_site_148687
mod ID: M6ASITE007180		Click to Show/Hide the Full List
mod site	chr11:65660176-65660177:-		[11]
Sequence	CCAGTGTGTGAAGAAGCGGGACCTGGAGCAGGCTATCAGTC
Motif Score	3.622404762
Cell/Tissue List	HeLa; CD34; Huh7; CD4T; peripheral-blood; TREX; endometrial; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000615805.4; ENST00000533187.5; ENST00000533546.5; ENST00000525693.5; ENST00000531238.1; ENST00000308639.13; ENST00000526738.1; ENST00000527909.5; ENST00000532879.5; ENST00000612991.4; ENST00000534558.5; ENST00000406246.8; ENST00000525301.5; ENST00000532999.5; ENST00000531484.5; ENST00000525658.5; ENST00000526283.6; ENST00000527749.5; ENST00000529389.5; ENST00000527074.5
External Link	RMBase: m6A_site_148688
mod ID: M6ASITE007181		Click to Show/Hide the Full List
mod site	chr11:65660206-65660207:-		[11]
Sequence	GGGGGCGCTCAGTTTCCAGAACCTGGGAATCCAGTGTGTGA
Motif Score	2.930744048
Cell/Tissue List	HeLa; CD34; MT4; Huh7; CD4T; peripheral-blood; TREX; endometrial; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000612991.4; ENST00000531484.5; ENST00000527909.5; ENST00000406246.8; ENST00000531238.1; ENST00000527749.5; ENST00000525693.5; ENST00000615805.4; ENST00000527074.5; ENST00000525658.5; ENST00000527874.1; ENST00000532999.5; ENST00000533546.5; ENST00000308639.13; ENST00000526283.6; ENST00000525301.5; ENST00000526738.1; ENST00000533187.5; ENST00000532879.5; ENST00000534558.5; ENST00000529389.5
External Link	RMBase: m6A_site_148689
mod ID: M6ASITE007183		Click to Show/Hide the Full List
mod site	chr11:65660236-65660237:-		[11]
Sequence	GCTCTGTGAGAGACAGTGGGACAGACGACTGGGGGCGCTCA
Motif Score	3.643047619
Cell/Tissue List	HeLa; CD34; MT4; Huh7; CD4T; peripheral-blood; TREX; endometrial; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000527749.5; ENST00000525301.5; ENST00000534558.5; ENST00000612991.4; ENST00000532999.5; ENST00000527874.1; ENST00000531484.5; ENST00000525693.5; ENST00000527074.5; ENST00000527909.5; ENST00000533187.5; ENST00000529389.5; ENST00000615805.4; ENST00000525658.5; ENST00000308639.13; ENST00000526283.6; ENST00000406246.8; ENST00000531238.1; ENST00000532879.5; ENST00000526738.1; ENST00000533546.5
External Link	RMBase: m6A_site_148690
mod ID: M6ASITE007184		Click to Show/Hide the Full List
mod site	chr11:65660244-65660245:-		[11]
Sequence	AGGTCTGGGCTCTGTGAGAGACAGTGGGACAGACGACTGGG
Motif Score	2.897386905
Cell/Tissue List	HeLa; CD34; MT4; Huh7; CD4T; peripheral-blood; TREX; endometrial; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000529389.5; ENST00000527909.5; ENST00000406246.8; ENST00000615805.4; ENST00000525658.5; ENST00000533187.5; ENST00000534558.5; ENST00000612991.4; ENST00000526283.6; ENST00000533546.5; ENST00000525301.5; ENST00000525693.5; ENST00000532879.5; ENST00000527749.5; ENST00000531238.1; ENST00000531484.5; ENST00000308639.13; ENST00000527074.5; ENST00000526738.1; ENST00000532999.5; ENST00000527874.1
External Link	RMBase: m6A_site_148691
mod ID: M6ASITE007185		Click to Show/Hide the Full List
mod site	chr11:65660369-65660370:-		[11]
Sequence	CTTGTCAGCTGAGTGAAGGGACAGGGTTCGTTGCAGCACAG
Motif Score	3.643047619
Cell/Tissue List	HeLa; CD34; LCLs; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000533187.5; ENST00000532999.5; ENST00000529389.5; ENST00000525693.5; ENST00000533546.5; ENST00000534558.5; ENST00000527874.1; ENST00000526283.6; ENST00000308639.13; ENST00000525301.5; ENST00000531238.1; ENST00000525658.5; ENST00000406246.8; ENST00000612991.4; ENST00000615805.4; ENST00000526738.1; ENST00000531484.5; ENST00000527074.5; ENST00000532879.5; ENST00000527909.5; ENST00000527749.5
External Link	RMBase: m6A_site_148692
mod ID: M6ASITE007186		Click to Show/Hide the Full List
mod site	chr11:65660510-65660511:-		[15]
Sequence	GAACATTCCAAGCCGACCAAACAAGTGCAAAGGCCTTGAGG
Motif Score	2.20572619
Cell/Tissue List	CD34; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000529389.5; ENST00000527749.5; ENST00000406246.8; ENST00000527074.5; ENST00000533187.5; ENST00000532879.5; ENST00000615805.4; ENST00000525301.5; ENST00000527909.5; ENST00000526738.1; ENST00000527874.1; ENST00000533546.5; ENST00000526283.6; ENST00000531484.5; ENST00000531238.1; ENST00000534558.5; ENST00000525693.5; ENST00000612991.4; ENST00000525658.5; ENST00000532999.5; ENST00000308639.13
External Link	RMBase: m6A_site_148693
mod ID: M6ASITE007187		Click to Show/Hide the Full List
mod site	chr11:65660528-65660529:-		[15]
Sequence	AGGAGAGAAGTAGGAAAAGAACATTCCAAGCCGACCAAACA
Motif Score	2.951386905
Cell/Tissue List	CD34; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000532879.5; ENST00000525693.5; ENST00000526283.6; ENST00000534558.5; ENST00000527874.1; ENST00000533546.5; ENST00000531238.1; ENST00000525658.5; ENST00000527909.5; ENST00000527749.5; ENST00000615805.4; ENST00000525301.5; ENST00000532999.5; ENST00000526738.1; ENST00000612991.4; ENST00000308639.13; ENST00000529389.5; ENST00000406246.8; ENST00000533187.5; ENST00000527074.5; ENST00000531484.5
External Link	RMBase: m6A_site_148694
mod ID: M6ASITE007188		Click to Show/Hide the Full List
mod site	chr11:65660566-65660567:-		[15]
Sequence	GAAGGCCTCCCTCAGCTAAGACTTGAATGGTGAGAAGGAGG
Motif Score	3.319380952
Cell/Tissue List	CD34; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000531238.1; ENST00000532879.5; ENST00000529389.5; ENST00000525658.5; ENST00000531484.5; ENST00000525693.5; ENST00000527074.5; ENST00000527874.1; ENST00000533546.5; ENST00000534558.5; ENST00000612991.4; ENST00000308639.13; ENST00000532999.5; ENST00000406246.8; ENST00000527749.5; ENST00000525301.5; ENST00000533187.5; ENST00000526738.1; ENST00000526283.6; ENST00000615805.4; ENST00000527909.5
External Link	RMBase: m6A_site_148695
mod ID: M6ASITE007189		Click to Show/Hide the Full List
mod site	chr11:65660711-65660712:-		[15]
Sequence	ATAAATACACAGATAAATAAACAAGGTGCTGTCAGAGTAAC
Motif Score	2.20572619
Cell/Tissue List	CD34
Seq Type List	m6A-seq
Transcript ID List	rmsk_3569893; ENST00000533187.5; ENST00000525658.5; ENST00000529389.5; ENST00000612991.4; ENST00000532879.5; ENST00000526738.1; ENST00000527749.5; ENST00000615805.4; ENST00000532999.5; ENST00000527874.1; ENST00000406246.8; ENST00000531484.5; ENST00000526283.6; ENST00000534558.5; ENST00000308639.13; ENST00000527074.5; ENST00000525301.5; ENST00000527909.5; ENST00000525693.5; ENST00000533546.5; ENST00000531238.1
External Link	RMBase: m6A_site_148696
mod ID: M6ASITE007190		Click to Show/Hide the Full List
mod site	chr11:65661701-65661702:-		[11]
Sequence	TGAGGCTGAGCTCTGCCCGGACCGCTGCATCCACAGGTGAG
Motif Score	3.622404762
Cell/Tissue List	HeLa; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000525693.5; ENST00000532776.5; ENST00000533546.5; ENST00000527749.5; ENST00000615805.4; ENST00000534558.5; ENST00000531238.1; ENST00000531484.5; ENST00000308639.13; ENST00000612991.4; ENST00000525658.5; ENST00000525301.5; ENST00000534305.1; ENST00000527074.5; ENST00000532879.5; ENST00000532999.5; ENST00000527909.5; ENST00000527874.1; ENST00000525858.5; ENST00000526283.6; ENST00000533187.5; ENST00000406246.8; ENST00000529389.5
External Link	RMBase: m6A_site_148697
mod ID: M6ASITE007191		Click to Show/Hide the Full List
mod site	chr11:65661740-65661741:-		[19]
Sequence	CCACGAGCTTGTAGGAAAGGACTGCCGGGATGGCTTCTATG
Motif Score	4.065041667
Cell/Tissue List	HeLa; MT4; peripheral-blood; endometrial; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000533187.5; ENST00000529389.5; ENST00000531238.1; ENST00000406246.8; ENST00000534558.5; ENST00000527874.1; ENST00000615805.4; ENST00000527074.5; ENST00000534305.1; ENST00000525693.5; ENST00000526283.6; ENST00000532776.5; ENST00000525658.5; ENST00000525301.5; ENST00000533546.5; ENST00000612991.4; ENST00000308639.13; ENST00000525858.5; ENST00000532999.5; ENST00000527749.5; ENST00000532879.5; ENST00000531484.5; ENST00000527909.5
External Link	RMBase: m6A_site_148698
mod ID: M6ASITE007192		Click to Show/Hide the Full List
mod site	chr11:65661782-65661783:-		[15]
Sequence	CATCTCCCTGGTCACCAAGGACCCTCCTCACCGGCCTCACC
Motif Score	3.622404762
Cell/Tissue List	CD34; HeLa; MT4; peripheral-blood; endometrial; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000527909.5; ENST00000534305.1; ENST00000529389.5; ENST00000527074.5; ENST00000527749.5; ENST00000525301.5; ENST00000406246.8; ENST00000527874.1; ENST00000525658.5; ENST00000531484.5; ENST00000525858.5; ENST00000533187.5; ENST00000526283.6; ENST00000532776.5; ENST00000525693.5; ENST00000532999.5; ENST00000533546.5; ENST00000612991.4; ENST00000531238.1; ENST00000308639.13; ENST00000534558.5; ENST00000532879.5; ENST00000615805.4
External Link	RMBase: m6A_site_148699
mod ID: M6ASITE007194		Click to Show/Hide the Full List
mod site	chr11:65661810-65661811:-		[15]
Sequence	ATGGCTACACAGGACCAGGGACAGTGCGCATCTCCCTGGTC
Motif Score	3.643047619
Cell/Tissue List	CD34; HeLa; MT4; peripheral-blood; endometrial; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000527874.1; ENST00000534558.5; ENST00000525693.5; ENST00000532999.5; ENST00000406246.8; ENST00000525858.5; ENST00000533546.5; ENST00000525301.5; ENST00000529389.5; ENST00000534305.1; ENST00000526283.6; ENST00000612991.4; ENST00000525658.5; ENST00000531484.5; ENST00000527909.5; ENST00000532879.5; ENST00000531238.1; ENST00000533187.5; ENST00000308639.13; ENST00000527749.5; ENST00000527074.5; ENST00000615805.4; ENST00000532776.5
External Link	RMBase: m6A_site_148700
mod ID: M6ASITE007195		Click to Show/Hide the Full List
mod site	chr11:65661817-65661818:-		[15]
Sequence	CAGATCAATGGCTACACAGGACCAGGGACAGTGCGCATCTC
Motif Score	3.622404762
Cell/Tissue List	CD34; HeLa; MT4; peripheral-blood; endometrial; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000533546.5; ENST00000527749.5; ENST00000527074.5; ENST00000406246.8; ENST00000615805.4; ENST00000534558.5; ENST00000525301.5; ENST00000531484.5; ENST00000532776.5; ENST00000527874.1; ENST00000531238.1; ENST00000532879.5; ENST00000527909.5; ENST00000533187.5; ENST00000529389.5; ENST00000532999.5; ENST00000525658.5; ENST00000612991.4; ENST00000525693.5; ENST00000525858.5; ENST00000526283.6; ENST00000308639.13; ENST00000534305.1
External Link	RMBase: m6A_site_148701
mod ID: M6ASITE007196		Click to Show/Hide the Full List
mod site	chr11:65661824-65661825:-		[14]
Sequence	CTTTGGACAGATCAATGGCTACACAGGACCAGGGACAGTGC
Motif Score	2.078666667
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000308639.13; ENST00000527909.5; ENST00000612991.4; ENST00000534305.1; ENST00000406246.8; ENST00000531484.5; ENST00000527749.5; ENST00000534558.5; ENST00000615805.4; ENST00000533187.5; ENST00000532999.5; ENST00000531238.1; ENST00000532879.5; ENST00000527074.5; ENST00000525658.5; ENST00000527874.1; ENST00000526283.6; ENST00000525693.5; ENST00000525858.5; ENST00000529389.5; ENST00000532776.5; ENST00000525301.5; ENST00000533546.5
External Link	RMBase: m6A_site_148702
mod ID: M6ASITE007197		Click to Show/Hide the Full List
mod site	chr11:65661838-65661839:-		[19]
Sequence	TCTGGGCCTCTGTACTTTGGACAGATCAATGGCTACACAGG
Motif Score	3.643047619
Cell/Tissue List	HeLa; MT4; peripheral-blood; endometrial; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000532999.5; ENST00000533187.5; ENST00000525658.5; ENST00000527749.5; ENST00000526283.6; ENST00000406246.8; ENST00000525693.5; ENST00000612991.4; ENST00000533546.5; ENST00000527874.1; ENST00000534558.5; ENST00000527909.5; ENST00000529389.5; ENST00000532879.5; ENST00000531484.5; ENST00000531238.1; ENST00000615805.4; ENST00000532776.5; ENST00000525858.5; ENST00000525301.5; ENST00000308639.13; ENST00000527074.5; ENST00000534305.1
External Link	RMBase: m6A_site_148703
mod ID: M6ASITE007198		Click to Show/Hide the Full List
mod site	chr11:65661895-65661896:-		[15]
Sequence	TGCGGGGAAGGGACTGTGGAACCCCAGCCCTCTGTGTTTGG
Motif Score	2.930744048
Cell/Tissue List	CD34; HeLa; MT4; A549; MM6; peripheral-blood; endometrial; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000534305.1; ENST00000531238.1; ENST00000527909.5; ENST00000532879.5; ENST00000525658.5; ENST00000308639.13; ENST00000533187.5; ENST00000527749.5; ENST00000531484.5; ENST00000534558.5; ENST00000532776.5; ENST00000525301.5; ENST00000533546.5; ENST00000615805.4; ENST00000529389.5; ENST00000527074.5; ENST00000525858.5; ENST00000406246.8; ENST00000527874.1; ENST00000525693.5; ENST00000526283.6; ENST00000532999.5; ENST00000612991.4
External Link	RMBase: m6A_site_148704
mod ID: M6ASITE007199		Click to Show/Hide the Full List
mod site	chr11:65661903-65661904:-		[15]
Sequence	CCAGGGTGTGCGGGGAAGGGACTGTGGAACCCCAGCCCTCT
Motif Score	4.065041667
Cell/Tissue List	CD34; HeLa; MT4; A549; MM6; peripheral-blood; endometrial; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000533546.5; ENST00000527874.1; ENST00000531484.5; ENST00000525301.5; ENST00000612991.4; ENST00000525693.5; ENST00000534305.1; ENST00000525858.5; ENST00000527074.5; ENST00000533187.5; ENST00000527749.5; ENST00000532776.5; ENST00000527909.5; ENST00000406246.8; ENST00000615805.4; ENST00000532879.5; ENST00000308639.13; ENST00000525658.5; ENST00000532999.5; ENST00000526283.6; ENST00000529389.5; ENST00000534558.5; ENST00000531238.1
External Link	RMBase: m6A_site_148705
mod ID: M6ASITE007200		Click to Show/Hide the Full List
mod site	chr11:65661953-65661954:-		[15]
Sequence	GGAGCACAGATACCACCAAGACCCACCCCACCATCAAGGTC
Motif Score	2.876744048
Cell/Tissue List	CD34; HeLa; MT4; A549; MM6; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000527074.5; ENST00000308639.13; ENST00000406246.8; ENST00000525858.5; ENST00000531484.5; ENST00000527874.1; ENST00000527909.5; ENST00000612991.4; ENST00000534305.1; ENST00000526283.6; ENST00000531238.1; ENST00000525693.5; ENST00000533187.5; ENST00000534283.1; ENST00000532776.5; ENST00000525301.5; ENST00000527749.5; ENST00000615805.4; ENST00000532999.5; ENST00000525658.5; ENST00000532879.5; ENST00000529389.5; ENST00000533546.5; ENST00000534558.5
External Link	RMBase: m6A_site_148706
mod ID: M6ASITE007201		Click to Show/Hide the Full List
mod site	chr11:65662203-65662204:-		[11]
Sequence	GATCTCCCTCCCCTTTCAGAACTGTTCCCCCTCATCTTCCC
Motif Score	3.373380952
Cell/Tissue List	HeLa; GSC-11; HEK293A-TOA
Seq Type List	m6A-seq
Transcript ID List	ENST00000534305.1; ENST00000533187.5; ENST00000527074.5; ENST00000532999.5; ENST00000525858.5; ENST00000612991.4; ENST00000531238.1; ENST00000525693.5; ENST00000525301.5; ENST00000534283.1; ENST00000527874.1; ENST00000406246.8; ENST00000526283.6; ENST00000533546.5; ENST00000529389.5; ENST00000527749.5; ENST00000525658.5; ENST00000531484.5; ENST00000532879.5; ENST00000308639.13; ENST00000527909.5; ENST00000534558.5; ENST00000615805.4; ENST00000532776.5
External Link	RMBase: m6A_site_148707
mod ID: M6ASITE007202		Click to Show/Hide the Full List
mod site	chr11:65662840-65662841:-		[11]
Sequence	ACCCCGGCCCCGCCCCCGGGACCCCGGCCATGGACGGTGAG
Motif Score	3.622404762
Cell/Tissue List	HeLa; CD34; U2OS; A549; HEK293T; HEK293A-TOA; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000308639.13; ENST00000534558.5; ENST00000532879.5; ENST00000525693.5; ENST00000529389.5; ENST00000525301.5; ENST00000534305.1; ENST00000406246.8; ENST00000615805.4; ENST00000533546.5; ENST00000532776.5; ENST00000527074.5; ENST00000531484.5; ENST00000525858.5; ENST00000526283.6; ENST00000531238.1; ENST00000525658.5; ENST00000532999.5; ENST00000527909.5; ENST00000612991.4
External Link	RMBase: m6A_site_148708

N7-methylguanosine (m7G)

In total 1 m6A sequence/site(s) in this target gene
mod ID: m7GSITE000010		Click to Show/Hide the Full List
mod site	chr11:65655734-65655735:-		[20]
Sequence	CGACCCCCGGCCTCCACCTCGACGCATTGCTGTGCCTTCCC
Cell/Tissue List	A549; HeLa; HepG2
Seq Type List	BoRed-seq&m7G-RIP-seq; m7G-seq
Transcript ID List	ENST00000615805.4; ENST00000532999.5; ENST00000531484.5; ENST00000406246.8; ENST00000525693.5; ENST00000612991.4; ENST00000526283.6; ENST00000308639.13; ENST00000526257.1
External Link	RMBase: m7G_site_170

Ref 1	Methyltransferase-like 14 silencing relieves the development of atherosclerosis via m(6)A modification of p65 mRNA. Bioengineered. 2022 May;13(5):11832-11843. doi: 10.1080/21655979.2022.2031409.
Ref 2	The m(6)A methyltransferase METTL3 promotes bladder cancer progression via AFF4/NF-KappaB/MYC signaling network. Oncogene. 2019 May;38(19):3667-3680. doi: 10.1038/s41388-019-0683-z. Epub 2019 Jan 18.
Ref 3	METTL3 restrains papillary thyroid cancer progression via m(6)A/c-Rel/IL-8-mediated neutrophil infiltration. Mol Ther. 2021 May 5;29(5):1821-1837. doi: 10.1016/j.ymthe.2021.01.019. Epub 2021 Jan 21.
Ref 4	N6-methyladenosine reader YTH N6-methyladenosine RNA binding protein 3 or insulin like growth factor 2 mRNA binding protein 2 knockdown protects human bronchial epithelial cells from hypoxia/reoxygenation injury by inactivating p38 MAPK, AKT, ERK1/2, and NF-KappaB pathways. Bioengineered. 2022 May;13(5):11973-11986. doi: 10.1080/21655979.2021.1999550.
Ref 5	Glyburide transport across the human placenta. Obstet Gynecol. 2015 Mar;125(3):583-588. doi: 10.1097/AOG.0000000000000672.
Ref 6	Discovery of a small molecule MDM2 inhibitor (AMG 232) for treating cancer. J Med Chem. 2014 Aug 14;57(15):6332-41. doi: 10.1021/jm500627s. Epub 2014 Jul 9.
Ref 7	Accurate identification of A-to-I RNA editing in human by transcriptome sequencing. Genome Res. 2012 Jan;22(1):142-50. doi: 10.1101/gr.124107.111. Epub 2011 Sep 29.
Ref 8	Comprehensive analysis of RNA-Seq data reveals extensive RNA editing in a human transcriptome. Nat Biotechnol. 2012 Feb 12;30(3):253-60. doi: 10.1038/nbt.2122.
Ref 9	The m1A landscape on cytosolic and mitochondrial mRNA at single-base resolution. Nature. 2017 Nov 9;551(7679):251-255. doi: 10.1038/nature24456. Epub 2017 Oct 25.
Ref 10	5-methylcytosine promotes mRNA export - NSUN2 as the methyltransferase and ALYREF as an m(5)C reader. Cell Res. 2017 May;27(5):606-625. doi: 10.1038/cr.2017.55. Epub 2017 Apr 18.
Ref 11	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 12	DART-seq: an antibody-free method for global m(6)A detection. Nat Methods. 2019 Dec;16(12):1275-1280. doi: 10.1038/s41592-019-0570-0. Epub 2019 Sep 23.
Ref 13	Single-base mapping of m(6)A by an antibody-independent method. Sci Adv. 2019 Jul 3;5(7):eaax0250. doi: 10.1126/sciadv.aax0250. eCollection 2019 Jul.
Ref 14	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.
Ref 15	Suppression of m(6)A reader Ythdf2 promotes hematopoietic stem cell expansion. Cell Res. 2018 Sep;28(9):904-917. doi: 10.1038/s41422-018-0072-0. Epub 2018 Jul 31.
Ref 16	Histone H3 trimethylation at lysine 36 guides m(6)A RNA modification co-transcriptionally. Nature. 2019 Mar;567(7748):414-419. doi: 10.1038/s41586-019-1016-7. Epub 2019 Mar 13.
Ref 17	Viral N(6)-methyladenosine upregulates replication and pathogenesis of human respiratory syncytial virus. Nat Commun. 2019 Oct 9;10(1):4595. doi: 10.1038/s41467-019-12504-y.
Ref 18	Dynamics of Human and Viral RNA Methylation during Zika Virus Infection. Cell Host Microbe. 2016 Nov 9;20(5):666-673. doi: 10.1016/j.chom.2016.10.002. Epub 2016 Oct 20.
Ref 19	N6-methyladenosine-dependent regulation of messenger RNA stability. Nature. 2014 Jan 2;505(7481):117-20. doi: 10.1038/nature12730. Epub 2013 Nov 27.
Ref 20	METTL1 Promotes let-7 MicroRNA Processing via m7G Methylation. Mol Cell. 2019 Jun 20;74(6):1278-1290.e9. doi: 10.1016/j.molcel.2019.03.040. Epub 2019 Apr 25.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map