m6A Target Gene Information
General Information of the m6A Target Gene (ID: M6ATAR00417)
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
SRSF6
can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Methyltransferase-like 3 (METTL3) [WRITER]
| Representative RNA-seq result indicating the expression of this target gene regulated by METTL3 | ||
| Cell Line | HeLa cell line | Homo sapiens |
|
Treatment: METTL3 knockdown HeLa cells
Control: HeLa cells
|
GSE70061 | |
| Regulation |
![]() ![]() |
logFC: 2.87E+00 p-value: 5.80E-03 |
| More Results | Click to View More RNA-seq Results | |
| In total 1 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [1] | |||
| Response Summary | Silencing METTL3 or overexpressing dominant-negative mutant METTL3 suppressed the growth and self-renewal of Glioblastoma cells. Integrated transcriptome and MeRIP-seq analyses revealed that downregulating the expression of METTL3 decreased m6A modification levels of Serine/arginine-rich splicing factor 6 (SRSF6), which led to YTHDC1-dependent NMD of SRSF transcripts and decreased SRSF protein expression. | |||
| Target Regulation | Up regulation | |||
| Responsed Disease | Glioblastoma | ICD-11: 2A00.00 | ||
| Pathway Response | RNA degradation | hsa03018 | ||
| Cell Process | mRNA decay | |||
| In-vitro Model | U251 (Fibroblasts or fibroblast like cells) | |||
| U-87MG ATCC | Glioblastoma | Homo sapiens | CVCL_0022 | |
| In-vivo Model | For subcutaneous tumor model, each mouse was injected subcutaneously in the right flank with 2 × 106 U87MG cells (METTL3-KD or control) in 100 uL PBS. | |||
YTH domain-containing protein 1 (YTHDC1) [READER]
| In total 1 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [1] | |||
| Response Summary | Silencing METTL3 or overexpressing dominant-negative mutant METTL3 suppressed the growth and self-renewal of Glioblastoma cells. Integrated transcriptome and MeRIP-seq analyses revealed that downregulating the expression of METTL3 decreased m6A modification levels of Serine/arginine-rich splicing factor 6 (SRSF6), which led to YTHDC1-dependent NMD of SRSF transcripts and decreased SRSF protein expression. | |||
| Target Regulation | Up regulation | |||
| Responsed Disease | Glioblastoma | ICD-11: 2A00.00 | ||
| Pathway Response | RNA degradation | hsa03018 | ||
| Cell Process | mRNA decay | |||
| In-vitro Model | U251 (Fibroblasts or fibroblast like cells) | |||
| U-87MG ATCC | Glioblastoma | Homo sapiens | CVCL_0022 | |
| In-vivo Model | For subcutaneous tumor model, each mouse was injected subcutaneously in the right flank with 2 × 106 U87MG cells (METTL3-KD or control) in 100 uL PBS. | |||
Brain cancer [ICD-11: 2A00]
| In total 2 item(s) under this disease | ||||
| Experiment 1 Reporting the m6A-centered Disease Response | [1] | |||
| Response Summary | Silencing METTL3 or overexpressing dominant-negative mutant METTL3 suppressed the growth and self-renewal of Glioblastoma cells. Integrated transcriptome and MeRIP-seq analyses revealed that downregulating the expression of METTL3 decreased m6A modification levels of Serine/arginine-rich splicing factor 6 (SRSF6), which led to YTHDC1-dependent NMD of SRSF transcripts and decreased SRSF protein expression. | |||
| Responsed Disease | Glioblastoma [ICD-11: 2A00.00] | |||
| Target Regulator | Methyltransferase-like 3 (METTL3) | WRITER | ||
| Target Regulation | Up regulation | |||
| Pathway Response | RNA degradation | hsa03018 | ||
| Cell Process | mRNA decay | |||
| In-vitro Model | U251 (Fibroblasts or fibroblast like cells) | |||
| U-87MG ATCC | Glioblastoma | Homo sapiens | CVCL_0022 | |
| In-vivo Model | For subcutaneous tumor model, each mouse was injected subcutaneously in the right flank with 2 × 106 U87MG cells (METTL3-KD or control) in 100 uL PBS. | |||
| Experiment 2 Reporting the m6A-centered Disease Response | [1] | |||
| Response Summary | Silencing METTL3 or overexpressing dominant-negative mutant METTL3 suppressed the growth and self-renewal of Glioblastoma cells. Integrated transcriptome and MeRIP-seq analyses revealed that downregulating the expression of METTL3 decreased m6A modification levels of Serine/arginine-rich splicing factor 6 (SRSF6), which led to YTHDC1-dependent NMD of SRSF transcripts and decreased SRSF protein expression. | |||
| Responsed Disease | Glioblastoma [ICD-11: 2A00.00] | |||
| Target Regulator | YTH domain-containing protein 1 (YTHDC1) | READER | ||
| Target Regulation | Up regulation | |||
| Pathway Response | RNA degradation | hsa03018 | ||
| Cell Process | mRNA decay | |||
| In-vitro Model | U251 (Fibroblasts or fibroblast like cells) | |||
| U-87MG ATCC | Glioblastoma | Homo sapiens | CVCL_0022 | |
| In-vivo Model | For subcutaneous tumor model, each mouse was injected subcutaneously in the right flank with 2 × 106 U87MG cells (METTL3-KD or control) in 100 uL PBS. | |||
Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator
Histone modification
m6A Regulator: Methyltransferase-like 3 (METTL3)
| In total 1 item(s) under this m6A regulator | ||
| Crosstalk ID: M6ACROT03295 | ||
| Epigenetic Regulator | Histone-lysine N-methyltransferase EZH2 (EZH2) | |
| Regulated Target | Histone H3 lysine 27 acetylation (H3K27ac) | |
| Crosstalk relationship | Histone modification → m6A | |
| Disease | Brain cancer | |
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00417)
| In total 1 m6A sequence/site(s) in this target gene | |||
| mod ID: M1ASITE000082 | Click to Show/Hide the Full List | ||
| mod site | chr20:43458380-43458381:+ | [2] | |
| Sequence | GTACGGCTTCGTGGAGTTCGAGGACTCCCGCGACGCCGACG | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | m1A-seq | ||
| Transcript ID List | ENST00000483871.6; ENST00000244020.5 | ||
| External Link | RMBase: m1A_site_630 | ||
5-methylcytidine (m5C)
| In total 13 m6A sequence/site(s) in this target gene | |||
| mod ID: M5CSITE002701 | Click to Show/Hide the Full List | ||
| mod site | chr20:43458222-43458223:+ | [3] | |
| Sequence | AGGAAAGAAGCGGCCAAGGCCGCGGCGCCGCGTGGCAGGGC | ||
| Cell/Tissue List | T24 | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000244020.5; ENST00000483871.6 | ||
| External Link | RMBase: m5C_site_28997 | ||
| mod ID: M5CSITE002702 | Click to Show/Hide the Full List | ||
| mod site | chr20:43458224-43458225:+ | [3] | |
| Sequence | GAAAGAAGCGGCCAAGGCCGCGGCGCCGCGTGGCAGGGCCT | ||
| Cell/Tissue List | T24 | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000483871.6; ENST00000244020.5 | ||
| External Link | RMBase: m5C_site_28998 | ||
| mod ID: M5CSITE002703 | Click to Show/Hide the Full List | ||
| mod site | chr20:43458227-43458228:+ | [3] | |
| Sequence | AGAAGCGGCCAAGGCCGCGGCGCCGCGTGGCAGGGCCTCAA | ||
| Cell/Tissue List | T24 | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000244020.5; ENST00000483871.6 | ||
| External Link | RMBase: m5C_site_28999 | ||
| mod ID: M5CSITE002704 | Click to Show/Hide the Full List | ||
| mod site | chr20:43458229-43458230:+ | [3] | |
| Sequence | AAGCGGCCAAGGCCGCGGCGCCGCGTGGCAGGGCCTCAAAG | ||
| Cell/Tissue List | T24 | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000483871.6; ENST00000244020.5 | ||
| External Link | RMBase: m5C_site_29000 | ||
| mod ID: M5CSITE002705 | Click to Show/Hide the Full List | ||
| mod site | chr20:43458230-43458231:+ | [3] | |
| Sequence | AGCGGCCAAGGCCGCGGCGCCGCGTGGCAGGGCCTCAAAGA | ||
| Cell/Tissue List | T24 | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000483871.6; ENST00000244020.5 | ||
| External Link | RMBase: m5C_site_29001 | ||
| mod ID: M5CSITE002706 | Click to Show/Hide the Full List | ||
| mod site | chr20:43458232-43458233:+ | [3] | |
| Sequence | CGGCCAAGGCCGCGGCGCCGCGTGGCAGGGCCTCAAAGATG | ||
| Cell/Tissue List | T24 | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000483871.6; ENST00000244020.5 | ||
| External Link | RMBase: m5C_site_29002 | ||
| mod ID: M5CSITE002707 | Click to Show/Hide the Full List | ||
| mod site | chr20:43458262-43458263:+ | [3] | |
| Sequence | CCTCAAAGATGGCGACGGCGCGGCGTCGCGGGGGCGCGCGG | ||
| Cell/Tissue List | T24 | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000244020.5; ENST00000483871.6; rmsk_5126799 | ||
| External Link | RMBase: m5C_site_29003 | ||
| mod ID: M5CSITE002708 | Click to Show/Hide the Full List | ||
| mod site | chr20:43458265-43458266:+ | [3] | |
| Sequence | CAAAGATGGCGACGGCGCGGCGTCGCGGGGGCGCGCGGTGG | ||
| Cell/Tissue List | T24 | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | rmsk_5126799; ENST00000244020.5; ENST00000483871.6 | ||
| External Link | RMBase: m5C_site_29004 | ||
| mod ID: M5CSITE002709 | Click to Show/Hide the Full List | ||
| mod site | chr20:43458268-43458269:+ | [3] | |
| Sequence | AGATGGCGACGGCGCGGCGTCGCGGGGGCGCGCGGTGGGGT | ||
| Cell/Tissue List | T24 | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | rmsk_5126799; ENST00000244020.5; ENST00000483871.6 | ||
| External Link | RMBase: m5C_site_29005 | ||
| mod ID: M5CSITE002710 | Click to Show/Hide the Full List | ||
| mod site | chr20:43458270-43458271:+ | [3] | |
| Sequence | ATGGCGACGGCGCGGCGTCGCGGGGGCGCGCGGTGGGGTAC | ||
| Cell/Tissue List | T24 | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000244020.5; ENST00000483871.6; rmsk_5126799 | ||
| External Link | RMBase: m5C_site_29006 | ||
| mod ID: M5CSITE002711 | Click to Show/Hide the Full List | ||
| mod site | chr20:43458547-43458548:+ | [3] | |
| Sequence | CGCTCCGCGCCCTTGGGGACCCTGGGGGCGGGGGTGGGTGG | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000244020.5; ENST00000483871.6 | ||
| External Link | RMBase: m5C_site_29007 | ||
| mod ID: M5CSITE002712 | Click to Show/Hide the Full List | ||
| mod site | chr20:43460025-43460026:+ | [3] | |
| Sequence | CCGAGTCTGACCAATCTTGTCTTTCAGGATTTTATGCGACA | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000483871.6; ENST00000244020.5 | ||
| External Link | RMBase: m5C_site_29008 | ||
| mod ID: M5CSITE002713 | Click to Show/Hide the Full List | ||
| mod site | chr20:43460029-43460030:+ | [3] | |
| Sequence | GTCTGACCAATCTTGTCTTTCAGGATTTTATGCGACAAGCA | ||
| Seq Type List | Bisulfite-seq | ||
| Transcript ID List | ENST00000244020.5; ENST00000483871.6 | ||
| External Link | RMBase: m5C_site_29009 | ||
N6-methyladenosine (m6A)
| In total 85 m6A sequence/site(s) in this target gene | |||
| mod ID: M6ASITE052838 | Click to Show/Hide the Full List | ||
| mod site | chr20:43457908-43457909:+ | [4] | |
| Sequence | GCGCGCCATTGTGTGGCTGGACTCGGCCGCCCCTGTGGTGT | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; fibroblasts; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000244020.5 | ||
| External Link | RMBase: m6A_site_532357 | ||
| mod ID: M6ASITE052839 | Click to Show/Hide the Full List | ||
| mod site | chr20:43457999-43458000:+ | [5] | |
| Sequence | GGCTTGCGGTCCGCCGTTCGACAACCAGCCCTTGGGTCCCC | ||
| Motif Score | 2.865571429 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000244020.5; ENST00000483871.6 | ||
| External Link | RMBase: m6A_site_532358 | ||
| mod ID: M6ASITE052840 | Click to Show/Hide the Full List | ||
| mod site | chr20:43458031-43458032:+ | [4] | |
| Sequence | TGGGTCCCCGCCCGCCACGGACATGCCGCGCGTCTACATAG | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; MT4; H1299; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000483871.6; ENST00000244020.5 | ||
| External Link | RMBase: m6A_site_532359 | ||
| mod ID: M6ASITE052841 | Click to Show/Hide the Full List | ||
| mod site | chr20:43458082-43458083:+ | [4] | |
| Sequence | CTACAACGTCCGGGAGAAGGACATCCAGCGCTTTTTCAGTG | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; HepG2; liver; A549; hESC-HEK293T; Jurkat; CD4T; peripheral-blood; GSC-11; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4; MM6 | ||
| Seq Type List | m6A-seq; m6A-REF-seq; MeRIP-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000483871.6; ENST00000244020.5 | ||
| External Link | RMBase: m6A_site_532360 | ||
| mod ID: M6ASITE052842 | Click to Show/Hide the Full List | ||
| mod site | chr20:43458127-43458128:+ | [4] | |
| Sequence | TGGCCGCCTCCTCGAAGTAGACCTCAAAAATGGGTGAGTCG | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa; HepG2; A549; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293T; MSC; iSLK; TIME; endometrial; HEC-1-A; GSCs; NB4; MM6 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000244020.5; ENST00000483871.6 | ||
| External Link | RMBase: m6A_site_532361 | ||
| mod ID: M6ASITE052843 | Click to Show/Hide the Full List | ||
| mod site | chr20:43458383-43458384:+ | [4] | |
| Sequence | CGGCTTCGTGGAGTTCGAGGACTCCCGCGACGCCGACGACG | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa; HepG2; A549; peripheral-blood; HEK293T; endometrial | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000483871.6; ENST00000244020.5 | ||
| External Link | RMBase: m6A_site_532362 | ||
| mod ID: M6ASITE052844 | Click to Show/Hide the Full List | ||
| mod site | chr20:43459337-43459338:+ | [6] | |
| Sequence | GTGAGGATTCCAAGGGTTAGACAAAACTGGTTAATCTGAAC | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | CD34 | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000483871.6; ENST00000244020.5 | ||
| External Link | RMBase: m6A_site_532363 | ||
| mod ID: M6ASITE052845 | Click to Show/Hide the Full List | ||
| mod site | chr20:43459342-43459343:+ | [6] | |
| Sequence | GATTCCAAGGGTTAGACAAAACTGGTTAATCTGAACTAGGT | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | CD34 | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000483871.6; ENST00000244020.5 | ||
| External Link | RMBase: m6A_site_532364 | ||
| mod ID: M6ASITE052846 | Click to Show/Hide the Full List | ||
| mod site | chr20:43459356-43459357:+ | [6] | |
| Sequence | GACAAAACTGGTTAATCTGAACTAGGTGACTGTTACCTTGC | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | CD34 | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000483871.6; ENST00000244020.5 | ||
| External Link | RMBase: m6A_site_532365 | ||
| mod ID: M6ASITE052847 | Click to Show/Hide the Full List | ||
| mod site | chr20:43459392-43459393:+ | [4] | |
| Sequence | CTTGCGTGTTTTGTGGCCAAACCACCACCAAAAACCTCACA | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa; CD34 | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000483871.6; ENST00000244020.5 | ||
| External Link | RMBase: m6A_site_532366 | ||
| mod ID: M6ASITE052848 | Click to Show/Hide the Full List | ||
| mod site | chr20:43459405-43459406:+ | [4] | |
| Sequence | TGGCCAAACCACCACCAAAAACCTCACACTGTGATGTAAGT | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa; CD34 | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000483871.6; ENST00000244020.5 | ||
| External Link | RMBase: m6A_site_532367 | ||
| mod ID: M6ASITE052849 | Click to Show/Hide the Full List | ||
| mod site | chr20:43459785-43459786:+ | [7] | |
| Sequence | TAAAGGTGGTGGAGGTGGATACAGCAGTCGGAGAACATCTG | ||
| Motif Score | 2.110482143 | ||
| Cell/Tissue List | liver | ||
| Seq Type List | m6A-REF-seq | ||
| Transcript ID List | ENST00000244020.5; ENST00000483871.6 | ||
| External Link | RMBase: m6A_site_532368 | ||
| mod ID: M6ASITE052850 | Click to Show/Hide the Full List | ||
| mod site | chr20:43459799-43459800:+ | [4] | |
| Sequence | GTGGATACAGCAGTCGGAGAACATCTGGCAGAGACAAATAC | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000483871.6; ENST00000244020.5 | ||
| External Link | RMBase: m6A_site_532369 | ||
| mod ID: M6ASITE052851 | Click to Show/Hide the Full List | ||
| mod site | chr20:43459812-43459813:+ | [4] | |
| Sequence | TCGGAGAACATCTGGCAGAGACAAATACGGACCACCTGTTC | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000483871.6; ENST00000244020.5 | ||
| External Link | RMBase: m6A_site_532370 | ||
| mod ID: M6ASITE052852 | Click to Show/Hide the Full List | ||
| mod site | chr20:43459822-43459823:+ | [4] | |
| Sequence | TCTGGCAGAGACAAATACGGACCACCTGTTCGTACAGAATA | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000483871.6; ENST00000244020.5 | ||
| External Link | RMBase: m6A_site_532371 | ||
| mod ID: M6ASITE052853 | Click to Show/Hide the Full List | ||
| mod site | chr20:43459835-43459836:+ | [7] | |
| Sequence | AATACGGACCACCTGTTCGTACAGAATACAGGCTTATTGTA | ||
| Motif Score | 2.856142857 | ||
| Cell/Tissue List | liver | ||
| Seq Type List | m6A-REF-seq | ||
| Transcript ID List | ENST00000244020.5; ENST00000483871.6 | ||
| External Link | RMBase: m6A_site_532372 | ||
| mod ID: M6ASITE052854 | Click to Show/Hide the Full List | ||
| mod site | chr20:43460043-43460044:+ | [5] | |
| Sequence | GTCTTTCAGGATTTTATGCGACAAGCAGGTGAAGTAACCTA | ||
| Motif Score | 2.865571429 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000483871.6; ENST00000244020.5 | ||
| External Link | RMBase: m6A_site_532373 | ||
| mod ID: M6ASITE052855 | Click to Show/Hide the Full List | ||
| mod site | chr20:43460086-43460087:+ | [4] | |
| Sequence | CGGATGCCCACAAGGAACGAACAAATGAGGGTGTAATTGAG | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000483871.6; ENST00000244020.5 | ||
| External Link | RMBase: m6A_site_532374 | ||
| mod ID: M6ASITE052856 | Click to Show/Hide the Full List | ||
| mod site | chr20:43460141-43460142:+ | [4] | |
| Sequence | TGACATGAAGCGTGCTTTGGACAAACTGGATGGCACAGAAA | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000244020.5; ENST00000483871.6 | ||
| External Link | RMBase: m6A_site_532375 | ||
| mod ID: M6ASITE052857 | Click to Show/Hide the Full List | ||
| mod site | chr20:43460203-43460204:+ | [5] | |
| Sequence | TTATTGAAGATAAGCCACGCACAAGCCATAGGCGATCTTAC | ||
| Motif Score | 2.830589286 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000483871.6; ENST00000244020.5 | ||
| External Link | RMBase: m6A_site_532376 | ||
| mod ID: M6ASITE052858 | Click to Show/Hide the Full List | ||
| mod site | chr20:43460804-43460805:+ | [5] | |
| Sequence | TCTGATCGGGGCTCCCATTCACATTCTCGAAGCAGATCTAA | ||
| Motif Score | 2.047297619 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000244020.5; ENST00000483871.6 | ||
| External Link | RMBase: m6A_site_532377 | ||
| mod ID: M6ASITE052859 | Click to Show/Hide the Full List | ||
| mod site | chr20:43461069-43461070:+ | [4] | |
| Sequence | GTTCCAGAGATTAACTCAGAACTCCTTGTTTGCACATTATT | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa; HEK293T; A549; HepG2; U2OS; hNPCs; hESCs; fibroblasts; GM12878; LCLs; CD8T; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; AML | ||
| Seq Type List | m6A-seq; MeRIP-seq; m6A-CLIP/IP; miCLIP | ||
| Transcript ID List | ENST00000244020.5; ENST00000483871.6 | ||
| External Link | RMBase: m6A_site_532378 | ||
| mod ID: M6ASITE052860 | Click to Show/Hide the Full List | ||
| mod site | chr20:43461082-43461083:+ | [5] | |
| Sequence | ACTCAGAACTCCTTGTTTGCACATTATTATGGAACACTTTC | ||
| Motif Score | 2.830589286 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000483871.6; ENST00000244020.5 | ||
| External Link | RMBase: m6A_site_532379 | ||
| mod ID: M6ASITE052861 | Click to Show/Hide the Full List | ||
| mod site | chr20:43461095-43461096:+ | [4] | |
| Sequence | TGTTTGCACATTATTATGGAACACTTTCCTACTTAGGCAGT | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa; HEK293T; A549; hESC-HEK293T; HepG2; U2OS; hNPCs; hESCs; fibroblasts; GM12878; LCLs; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX; AML | ||
| Seq Type List | m6A-seq; MeRIP-seq; MAZTER-seq; miCLIP | ||
| Transcript ID List | ENST00000483871.6; ENST00000244020.5 | ||
| External Link | RMBase: m6A_site_532380 | ||
| mod ID: M6ASITE052862 | Click to Show/Hide the Full List | ||
| mod site | chr20:43461105-43461106:+ | [8] | |
| Sequence | TTATTATGGAACACTTTCCTACTTAGGCAGTTACTCTTCCA | ||
| Motif Score | 2.500660714 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000483871.6; ENST00000244020.5 | ||
| External Link | RMBase: m6A_site_532381 | ||
| mod ID: M6ASITE052863 | Click to Show/Hide the Full List | ||
| mod site | chr20:43461167-43461168:+ | [4] | |
| Sequence | GCAAGAGGAATCTCTTGAAAACAGGGGCACACAGAAATTTG | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa; HEK293T; A549; HepG2; U2OS; hNPCs; hESCs; fibroblasts; GM12878; LCLs; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000244020.5; ENST00000483871.6 | ||
| External Link | RMBase: m6A_site_532382 | ||
| mod ID: M6ASITE052864 | Click to Show/Hide the Full List | ||
| mod site | chr20:43461175-43461176:+ | [5] | |
| Sequence | AATCTCTTGAAAACAGGGGCACACAGAAATTTGATTTGTGG | ||
| Motif Score | 2.830589286 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000244020.5; ENST00000483871.6 | ||
| External Link | RMBase: m6A_site_532383 | ||
| mod ID: M6ASITE052865 | Click to Show/Hide the Full List | ||
| mod site | chr20:43461244-43461245:+ | [4] | |
| Sequence | AAGGAAATGGTGGCATGAAGACCCTCTCCCTTCTTTGTAGA | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa; HEK293T; A549; U2OS; hNPCs; hESCs; fibroblasts; GM12878; LCLs; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000244020.5; ENST00000483871.6 | ||
| External Link | RMBase: m6A_site_532384 | ||
| mod ID: M6ASITE052866 | Click to Show/Hide the Full List | ||
| mod site | chr20:43461305-43461306:+ | [8] | |
| Sequence | ATAGCTTTTGAGCTAACGTAACTTTTGTAAAGATTAAGCTC | ||
| Motif Score | 2.590089286 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000244020.5; ENST00000483871.6 | ||
| External Link | RMBase: m6A_site_532385 | ||
| mod ID: M6ASITE052867 | Click to Show/Hide the Full List | ||
| mod site | chr20:43461438-43461439:+ | [8] | |
| Sequence | GTTTGCTTATTTTTAAATTAACTGTTTTGAGCTTTGAATAC | ||
| Motif Score | 2.590089286 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000244020.5 | ||
| External Link | RMBase: m6A_site_532386 | ||
| mod ID: M6ASITE052868 | Click to Show/Hide the Full List | ||
| mod site | chr20:43461457-43461458:+ | [8] | |
| Sequence | AACTGTTTTGAGCTTTGAATACTTAAGGCTTTAGAGGGAGA | ||
| Motif Score | 2.53247619 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000244020.5 | ||
| External Link | RMBase: m6A_site_532387 | ||
| mod ID: M6ASITE052869 | Click to Show/Hide the Full List | ||
| mod site | chr20:43461478-43461479:+ | [8] | |
| Sequence | CTTAAGGCTTTAGAGGGAGAACCCAATTTTCAATTATGTTG | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HEK293T; Huh7 | ||
| Seq Type List | DART-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000244020.5 | ||
| External Link | RMBase: m6A_site_532388 | ||
| mod ID: M6ASITE052870 | Click to Show/Hide the Full List | ||
| mod site | chr20:43461546-43461547:+ | [8] | |
| Sequence | GATTTAAATAAAAGTTTGCTACCAAGATGATTGCCTTATTG | ||
| Motif Score | 2.05802381 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000244020.5 | ||
| External Link | RMBase: m6A_site_532389 | ||
| mod ID: M6ASITE052871 | Click to Show/Hide the Full List | ||
| mod site | chr20:43461618-43461619:+ | [4] | |
| Sequence | GATATCTGCCATTTGTGGAAACAACGTAAATTCTACTTAAG | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa; hESC-HEK293T | ||
| Seq Type List | m6A-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000244020.5 | ||
| External Link | RMBase: m6A_site_532390 | ||
| mod ID: M6ASITE052872 | Click to Show/Hide the Full List | ||
| mod site | chr20:43461621-43461622:+ | [8] | |
| Sequence | ATCTGCCATTTGTGGAAACAACGTAAATTCTACTTAAGTGT | ||
| Motif Score | 2.147845238 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000244020.5 | ||
| External Link | RMBase: m6A_site_532391 | ||
| mod ID: M6ASITE052873 | Click to Show/Hide the Full List | ||
| mod site | chr20:43461632-43461633:+ | [8] | |
| Sequence | GTGGAAACAACGTAAATTCTACTTAAGTGTAAACAAGGCAA | ||
| Motif Score | 2.500660714 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000244020.5 | ||
| External Link | RMBase: m6A_site_532392 | ||
| mod ID: M6ASITE052874 | Click to Show/Hide the Full List | ||
| mod site | chr20:43461644-43461645:+ | [4] | |
| Sequence | TAAATTCTACTTAAGTGTAAACAAGGCAAGCCTCAGACCAG | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa; hESC-HEK293T | ||
| Seq Type List | m6A-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000244020.5 | ||
| External Link | RMBase: m6A_site_532393 | ||
| mod ID: M6ASITE052875 | Click to Show/Hide the Full List | ||
| mod site | chr20:43461660-43461661:+ | [4] | |
| Sequence | GTAAACAAGGCAAGCCTCAGACCAGCAATAAATTACTCAGT | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000244020.5 | ||
| External Link | RMBase: m6A_site_532394 | ||
| mod ID: M6ASITE052876 | Click to Show/Hide the Full List | ||
| mod site | chr20:43461688-43461689:+ | [5] | |
| Sequence | TAAATTACTCAGTTTGGATAACATTATTTTGTGCAGTTAAT | ||
| Motif Score | 2.168095238 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000244020.5 | ||
| External Link | RMBase: m6A_site_532395 | ||
| mod ID: M6ASITE052877 | Click to Show/Hide the Full List | ||
| mod site | chr20:43461741-43461742:+ | [8] | |
| Sequence | AGTCTTTATCTGCCCCTTTAACAAGTTGAGTAAAAATAAAA | ||
| Motif Score | 2.168095238 | ||
| Cell/Tissue List | HEK293T; hESC-HEK293T | ||
| Seq Type List | DART-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000244020.5 | ||
| External Link | RMBase: m6A_site_532396 | ||
| mod ID: M6ASITE052878 | Click to Show/Hide the Full List | ||
| mod site | chr20:43461806-43461807:+ | [8] | |
| Sequence | ATGATTTTGCTTAAATTAATACTTTTAAGTAATGGAACTTT | ||
| Motif Score | 2.53247619 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000244020.5 | ||
| External Link | RMBase: m6A_site_532397 | ||
| mod ID: M6ASITE052879 | Click to Show/Hide the Full List | ||
| mod site | chr20:43461822-43461823:+ | [9] | |
| Sequence | TAATACTTTTAAGTAATGGAACTTTTTTCAAAGGCAAATTT | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | peripheral-blood | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000244020.5 | ||
| External Link | RMBase: m6A_site_532398 | ||
| mod ID: M6ASITE052880 | Click to Show/Hide the Full List | ||
| mod site | chr20:43461869-43461870:+ | [8] | |
| Sequence | TTTAAGAAATAGCTCCTAATACTTGGGATCTTGTTTAGAGA | ||
| Motif Score | 2.53247619 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000244020.5 | ||
| External Link | RMBase: m6A_site_532399 | ||
| mod ID: M6ASITE052881 | Click to Show/Hide the Full List | ||
| mod site | chr20:43462018-43462019:+ | [5] | |
| Sequence | TTTATTCAAAGTGTAAAAGCACATACTGCATTTTCTGCTGA | ||
| Motif Score | 2.830589286 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000244020.5 | ||
| External Link | RMBase: m6A_site_532400 | ||
| mod ID: M6ASITE052882 | Click to Show/Hide the Full List | ||
| mod site | chr20:43462022-43462023:+ | [8] | |
| Sequence | TTCAAAGTGTAAAAGCACATACTGCATTTTCTGCTGAAAGA | ||
| Motif Score | 2.53247619 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000244020.5 | ||
| External Link | RMBase: m6A_site_532401 | ||
| mod ID: M6ASITE052883 | Click to Show/Hide the Full List | ||
| mod site | chr20:43462098-43462099:+ | [8] | |
| Sequence | TCAGTTGCCAGTTAAGTTCCACCCAGTAGTCAGTCCCCTTT | ||
| Motif Score | 2.032470238 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000244020.5 | ||
| External Link | RMBase: m6A_site_532402 | ||
| mod ID: M6ASITE052884 | Click to Show/Hide the Full List | ||
| mod site | chr20:43462156-43462157:+ | [8] | |
| Sequence | TTGATAATTGGTTAGATCATACTTGTAAATTTTAATGCTTT | ||
| Motif Score | 2.53247619 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000244020.5 | ||
| External Link | RMBase: m6A_site_532403 | ||
| mod ID: M6ASITE052885 | Click to Show/Hide the Full List | ||
| mod site | chr20:43462195-43462196:+ | [4] | |
| Sequence | TTGTGTAATTGGTTTGAAAAACAGTGAAATGGGTAAACGCA | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000244020.5 | ||
| External Link | RMBase: m6A_site_532404 | ||
| mod ID: M6ASITE052886 | Click to Show/Hide the Full List | ||
| mod site | chr20:43462218-43462219:+ | [4] | |
| Sequence | GTGAAATGGGTAAACGCAAAACTTTTGTACTTTATTACGAG | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa; HEK293T | ||
| Seq Type List | m6A-seq; DART-seq | ||
| Transcript ID List | ENST00000244020.5 | ||
| External Link | RMBase: m6A_site_532405 | ||
| mod ID: M6ASITE052887 | Click to Show/Hide the Full List | ||
| mod site | chr20:43462226-43462227:+ | [8] | |
| Sequence | GGTAAACGCAAAACTTTTGTACTTTATTACGAGTAAAGTGT | ||
| Motif Score | 3.278136905 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000244020.5 | ||
| External Link | RMBase: m6A_site_532406 | ||
| mod ID: M6ASITE052888 | Click to Show/Hide the Full List | ||
| mod site | chr20:43462254-43462255:+ | [8] | |
| Sequence | ACGAGTAAAGTGTAATGAGTACTGTGGAAACCAAATTTGAA | ||
| Motif Score | 3.278136905 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000244020.5 | ||
| External Link | RMBase: m6A_site_532407 | ||
| mod ID: M6ASITE052889 | Click to Show/Hide the Full List | ||
| mod site | chr20:43462263-43462264:+ | [4] | |
| Sequence | GTGTAATGAGTACTGTGGAAACCAAATTTGAATACTGCAAA | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000244020.5 | ||
| External Link | RMBase: m6A_site_532408 | ||
| mod ID: M6ASITE052890 | Click to Show/Hide the Full List | ||
| mod site | chr20:43462276-43462277:+ | [8] | |
| Sequence | TGTGGAAACCAAATTTGAATACTGCAAATTTGTAGGAGTTA | ||
| Motif Score | 2.53247619 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000244020.5 | ||
| External Link | RMBase: m6A_site_532409 | ||
| mod ID: M6ASITE052891 | Click to Show/Hide the Full List | ||
| mod site | chr20:43462318-43462319:+ | [8] | |
| Sequence | TAGGTTAGCAATTAGTCCATACATCCATAAGCCTGATGAGT | ||
| Motif Score | 2.110482143 | ||
| Cell/Tissue List | HEK293T; hESC-HEK293T | ||
| Seq Type List | DART-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000244020.5 | ||
| External Link | RMBase: m6A_site_532410 | ||
| mod ID: M6ASITE052892 | Click to Show/Hide the Full List | ||
| mod site | chr20:43462371-43462372:+ | [8] | |
| Sequence | TTGAGAAGTGAATTAACCTTACATCCCTTTGTTCAGATACC | ||
| Motif Score | 2.07285119 | ||
| Cell/Tissue List | HEK293T; hESC-HEK293T | ||
| Seq Type List | DART-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000244020.5 | ||
| External Link | RMBase: m6A_site_532411 | ||
| mod ID: M6ASITE052893 | Click to Show/Hide the Full List | ||
| mod site | chr20:43462389-43462390:+ | [8] | |
| Sequence | TTACATCCCTTTGTTCAGATACCTTAAAAGTTACTTTATTT | ||
| Motif Score | 2.089839286 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000244020.5 | ||
| External Link | RMBase: m6A_site_532412 | ||
| mod ID: M6ASITE052894 | Click to Show/Hide the Full List | ||
| mod site | chr20:43462401-43462402:+ | [8] | |
| Sequence | GTTCAGATACCTTAAAAGTTACTTTATTTAAAAGCATTTAT | ||
| Motif Score | 2.494845238 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000244020.5 | ||
| External Link | RMBase: m6A_site_532413 | ||
| mod ID: M6ASITE052895 | Click to Show/Hide the Full List | ||
| mod site | chr20:43462488-43462489:+ | [5] | |
| Sequence | ATACCTTTCTAGGAGGTGTCACAATGTAGGGTACCAAGGGT | ||
| Motif Score | 2.047297619 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000244020.5 | ||
| External Link | RMBase: m6A_site_532414 | ||
| mod ID: M6ASITE052896 | Click to Show/Hide the Full List | ||
| mod site | chr20:43462533-43462534:+ | [5] | |
| Sequence | TTGTGATGGGGCATGGTCGTACACTGCTCATTGTGCCACAG | ||
| Motif Score | 2.856142857 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000244020.5 | ||
| External Link | RMBase: m6A_site_532415 | ||
| mod ID: M6ASITE052897 | Click to Show/Hide the Full List | ||
| mod site | chr20:43462550-43462551:+ | [7] | |
| Sequence | CGTACACTGCTCATTGTGCCACAGGTGTGACTGGAAAGCAT | ||
| Motif Score | 2.053113095 | ||
| Cell/Tissue List | brain | ||
| Seq Type List | m6A-REF-seq | ||
| Transcript ID List | ENST00000244020.5 | ||
| External Link | RMBase: m6A_site_532416 | ||
| mod ID: M6ASITE052898 | Click to Show/Hide the Full List | ||
| mod site | chr20:43462559-43462560:+ | [8] | |
| Sequence | CTCATTGTGCCACAGGTGTGACTGGAAAGCATGATATTCTA | ||
| Motif Score | 3.28175 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000244020.5 | ||
| External Link | RMBase: m6A_site_532417 | ||
| mod ID: M6ASITE052899 | Click to Show/Hide the Full List | ||
| mod site | chr20:43462812-43462813:+ | [8] | |
| Sequence | ATTATCTTATTTTCTTTGATACTTTATTTAATTAGATGTTT | ||
| Motif Score | 2.53247619 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000244020.5 | ||
| External Link | RMBase: m6A_site_532418 | ||
| mod ID: M6ASITE052900 | Click to Show/Hide the Full List | ||
| mod site | chr20:43462921-43462922:+ | [8] | |
| Sequence | TATAGTTCATTGTTTTGCCTACTCAGCAGAAGTGATGACTC | ||
| Motif Score | 2.500660714 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000244020.5 | ||
| External Link | RMBase: m6A_site_532419 | ||
| mod ID: M6ASITE052901 | Click to Show/Hide the Full List | ||
| mod site | chr20:43462938-43462939:+ | [8] | |
| Sequence | CCTACTCAGCAGAAGTGATGACTCTTAAAAATTGGCTTTGA | ||
| Motif Score | 3.28175 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000244020.5 | ||
| External Link | RMBase: m6A_site_532420 | ||
| mod ID: M6ASITE052902 | Click to Show/Hide the Full List | ||
| mod site | chr20:43462987-43462988:+ | [4] | |
| Sequence | CTCTTGTTTTCAGGGAAAGAACATAAAAGCTTTTTGAACTA | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa; HEK293T; hESC-HEK293T | ||
| Seq Type List | m6A-seq; DART-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000244020.5 | ||
| External Link | RMBase: m6A_site_532421 | ||
| mod ID: M6ASITE052903 | Click to Show/Hide the Full List | ||
| mod site | chr20:43463004-43463005:+ | [4] | |
| Sequence | AGAACATAAAAGCTTTTTGAACTACAGCCTTTTTAAAAGAG | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa; HEK293T | ||
| Seq Type List | m6A-seq; DART-seq | ||
| Transcript ID List | ENST00000244020.5 | ||
| External Link | RMBase: m6A_site_532422 | ||
| mod ID: M6ASITE052904 | Click to Show/Hide the Full List | ||
| mod site | chr20:43463040-43463041:+ | [8] | |
| Sequence | AAGAGGGATGGGAGGATATTACAGTAAGAAATTAGGCTTTC | ||
| Motif Score | 2.07285119 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000244020.5 | ||
| External Link | RMBase: m6A_site_532423 | ||
| mod ID: M6ASITE052905 | Click to Show/Hide the Full List | ||
| mod site | chr20:43463073-43463074:+ | [4] | |
| Sequence | AGGCTTTCTAAAAGTATGAAACATCCTTCAACTGGGCTCTC | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa; kidney; liver | ||
| Seq Type List | m6A-seq; m6A-REF-seq | ||
| Transcript ID List | ENST00000244020.5 | ||
| External Link | RMBase: m6A_site_532424 | ||
| mod ID: M6ASITE052906 | Click to Show/Hide the Full List | ||
| mod site | chr20:43463083-43463084:+ | [8] | |
| Sequence | AAAGTATGAAACATCCTTCAACTGGGCTCTCTTGTTAATAG | ||
| Motif Score | 2.595904762 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000244020.5 | ||
| External Link | RMBase: m6A_site_532425 | ||
| mod ID: M6ASITE052907 | Click to Show/Hide the Full List | ||
| mod site | chr20:43463105-43463106:+ | [4] | |
| Sequence | TGGGCTCTCTTGTTAATAGGACATCATATGGTAATAGACTG | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; HEK293T; hESC-HEK293T | ||
| Seq Type List | m6A-seq; DART-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000244020.5 | ||
| External Link | RMBase: m6A_site_532426 | ||
| mod ID: M6ASITE052908 | Click to Show/Hide the Full List | ||
| mod site | chr20:43463122-43463123:+ | [4] | |
| Sequence | AGGACATCATATGGTAATAGACTGGTTTGACTATATTGTTA | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa; HEK293T | ||
| Seq Type List | m6A-seq; DART-seq | ||
| Transcript ID List | ENST00000244020.5 | ||
| External Link | RMBase: m6A_site_532427 | ||
| mod ID: M6ASITE052909 | Click to Show/Hide the Full List | ||
| mod site | chr20:43463131-43463132:+ | [8] | |
| Sequence | TATGGTAATAGACTGGTTTGACTATATTGTTAGCTGCCACA | ||
| Motif Score | 3.28175 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000244020.5 | ||
| External Link | RMBase: m6A_site_532428 | ||
| mod ID: M6ASITE052910 | Click to Show/Hide the Full List | ||
| mod site | chr20:43463149-43463150:+ | [8] | |
| Sequence | TGACTATATTGTTAGCTGCCACAGTAAGCAGGTCATTGTAT | ||
| Motif Score | 2.053113095 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000244020.5 | ||
| External Link | RMBase: m6A_site_532429 | ||
| mod ID: M6ASITE052911 | Click to Show/Hide the Full List | ||
| mod site | chr20:43463208-43463209:+ | [8] | |
| Sequence | ATAATTTTCTAGTAATAGCCACGACCAATTTATTAACAGTC | ||
| Motif Score | 2.027047619 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000244020.5 | ||
| External Link | RMBase: m6A_site_532430 | ||
| mod ID: M6ASITE052912 | Click to Show/Hide the Full List | ||
| mod site | chr20:43463268-43463269:+ | [8] | |
| Sequence | AGTTCTCAGTCACTGGATGCACAAAATCACTGTGTAACATT | ||
| Motif Score | 2.830589286 | ||
| Cell/Tissue List | HEK293T; hESC-HEK293T | ||
| Seq Type List | DART-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000244020.5 | ||
| External Link | RMBase: m6A_site_532431 | ||
| mod ID: M6ASITE052913 | Click to Show/Hide the Full List | ||
| mod site | chr20:43463276-43463277:+ | [8] | |
| Sequence | GTCACTGGATGCACAAAATCACTGTGTAACATTGGCTCACT | ||
| Motif Score | 2.469291667 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000244020.5 | ||
| External Link | RMBase: m6A_site_532432 | ||
| mod ID: M6ASITE052914 | Click to Show/Hide the Full List | ||
| mod site | chr20:43463284-43463285:+ | [5] | |
| Sequence | ATGCACAAAATCACTGTGTAACATTGGCTCACTTGGTGAGC | ||
| Motif Score | 2.168095238 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000244020.5 | ||
| External Link | RMBase: m6A_site_532433 | ||
| mod ID: M6ASITE052915 | Click to Show/Hide the Full List | ||
| mod site | chr20:43463314-43463315:+ | [8] | |
| Sequence | ACTTGGTGAGCATAGGGTTGACTGATAAAATGTTTAATTCC | ||
| Motif Score | 3.28175 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000244020.5 | ||
| External Link | RMBase: m6A_site_532434 | ||
| mod ID: M6ASITE052916 | Click to Show/Hide the Full List | ||
| mod site | chr20:43463366-43463367:+ | [5] | |
| Sequence | GTGAGAAGAATGAGTTGATGACATGCTCCATACCAGTGGCT | ||
| Motif Score | 2.859755952 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000244020.5 | ||
| External Link | RMBase: m6A_site_532435 | ||
| mod ID: M6ASITE052917 | Click to Show/Hide the Full List | ||
| mod site | chr20:43463424-43463425:+ | [4] | |
| Sequence | GGAGCAGAAAAGAAGTGAGAACATCTTGATTCCCCTTTCTT | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa; HEK293T; hESC-HEK293T | ||
| Seq Type List | m6A-seq; DART-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000244020.5 | ||
| External Link | RMBase: m6A_site_532436 | ||
| mod ID: M6ASITE052918 | Click to Show/Hide the Full List | ||
| mod site | chr20:43463447-43463448:+ | [8] | |
| Sequence | TCTTGATTCCCCTTTCTTTTACTTGATGGTGTTTATGAACA | ||
| Motif Score | 2.494845238 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000244020.5 | ||
| External Link | RMBase: m6A_site_532437 | ||
| mod ID: M6ASITE052919 | Click to Show/Hide the Full List | ||
| mod site | chr20:43463465-43463466:+ | [4] | |
| Sequence | TTACTTGATGGTGTTTATGAACATGCCGTAGTGCCTTTATG | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa; hESC-HEK293T | ||
| Seq Type List | m6A-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000244020.5 | ||
| External Link | RMBase: m6A_site_532438 | ||
| mod ID: M6ASITE052920 | Click to Show/Hide the Full List | ||
| mod site | chr20:43463505-43463506:+ | [8] | |
| Sequence | GGCCAGTTTGAGTCCTGCCTACTTTGACTTTTACGTTCCCA | ||
| Motif Score | 2.500660714 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000244020.5 | ||
| External Link | RMBase: m6A_site_532439 | ||
| mod ID: M6ASITE052921 | Click to Show/Hide the Full List | ||
| mod site | chr20:43463511-43463512:+ | [8] | |
| Sequence | TTTGAGTCCTGCCTACTTTGACTTTTACGTTCCCATTCCTG | ||
| Motif Score | 3.28175 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000244020.5 | ||
| External Link | RMBase: m6A_site_532440 | ||
| mod ID: M6ASITE052922 | Click to Show/Hide the Full List | ||
| mod site | chr20:43463641-43463642:+ | [4] | |
| Sequence | ATTGCATATGCCCACTTAGGACCAGATTCTTAACAAATGTT | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000244020.5 | ||
| External Link | RMBase: m6A_site_532441 | ||
N7-methylguanosine (m7G)
| In total 1 m6A sequence/site(s) in this target gene | |||
| mod ID: m7GSITE000081 | Click to Show/Hide the Full List | ||
| mod site | chr20:43460519-43460520:+ | [10] | |
| Sequence | TTTTTCTCCTAATAGGTCTCGATCTAGAAGACGGTCACGAA | ||
| Cell/Tissue List | A549; HeLa; HepG2 | ||
| Seq Type List | BoRed-seq&m7G-RIP-seq; m7G-seq | ||
| Transcript ID List | ENST00000483871.6; ENST00000244020.5 | ||
| External Link | RMBase: m7G_site_567 | ||
References

