m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00402)

Target Name	Superoxide dismutase [Mn], mitochondrial (SOD2)
Gene Name	SOD2
Chromosomal Location	6q25.3
Family	iron/manganese superoxide dismutase family
Function	Destroys superoxide anion radicals which are normally produced within the cells and which are toxic to biological systems. Click to Show/Hide
Gene ID	6648
Uniprot ID	SODM_HUMAN
HGNC ID	HGNC:11180
KEGG ID	hsa:6648

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

SOD2 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Browse Drug

Fat mass and obesity-associated protein (FTO) [ERASER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by FTO*
Cell Line	NB4 cell line	Homo sapiens
Treatment: shFTO NB4 cells Control: shNS NB4 cells		GSE103494
Regulation		logFC: 8.09E-01 p-value: 6.85E-03
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene			[1]
Response Summary	FTO promotes Bortezomib resistance via m6A-dependent destabilization of Superoxide dismutase [Mn], mitochondrial (SOD2) expression in multiple myeloma.
Target Regulation	Down regulation
Responsed Disease	Multiple myeloma	ICD-11: 2A83.1	Disease Info
Responsed Drug	Bortezomib	Approved	Drug Info

Heterogeneous nuclear ribonucleoproteins C1/C2 (HNRNPC) [READER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by HNRNPC*
Cell Line	MG63 cell line	Homo sapiens
Treatment: HNRNPC knockdown MG63 cells Control: Wild type MG63 cells		GSE63086
Regulation		logFC: -1.14E+00 p-value: 6.60E-05
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[2]
Response Summary	SNP rs5746136 affects m6A modification and regulate Superoxide dismutase [Mn], mitochondrial (SOD2) expression by guiding the binding of hnRNPC to SOD2, which played a critical tumor suppressor role in bladder cancer cells by promoting cell apoptosis and inhibiting proliferation, migration and invasion.
Target Regulation	Up regulation
Responsed Disease	Bladder cancer		ICD-11: 2C94	Disease Info
Cell Process	Cell apoptosis
	Cell proliferation
	Cell migration
	Cell invasion
In-vitro Model	EJ (Human bladder cancer cells)
	J82	Bladder carcinoma	Homo sapiens	CVCL_0359

Multiple myeloma [ICD-11: 2A83]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response			[1]
Response Summary	FTO promotes Bortezomib resistance via m6A-dependent destabilization of Superoxide dismutase [Mn], mitochondrial (SOD2) expression in multiple myeloma.
Responsed Disease	Multiple myeloma [ICD-11: 2A83.1]
Target Regulator	Fat mass and obesity-associated protein (FTO)	ERASER	Regulator Info
Target Regulation	Down regulation
Responsed Drug	Bortezomib	Approved	Drug Info

Bladder cancer [ICD-11: 2C94]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[2]
Response Summary	SNP rs5746136 affects m6A modification and regulate Superoxide dismutase [Mn], mitochondrial (SOD2) expression by guiding the binding of hnRNPC to SOD2, which played a critical tumor suppressor role in bladder cancer cells by promoting cell apoptosis and inhibiting proliferation, migration and invasion.
Responsed Disease	Bladder cancer [ICD-11: 2C94]
Target Regulator	Heterogeneous nuclear ribonucleoproteins C1/C2 (HNRNPC)		READER	Regulator Info
Target Regulation	Up regulation
Cell Process	Cell apoptosis
	Cell proliferation
	Cell migration
	Cell invasion
In-vitro Model	EJ (Human bladder cancer cells)
	J82	Bladder carcinoma	Homo sapiens	CVCL_0359

Bortezomib [Approved]

Drug Info

In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response			[1]
Response Summary	FTO promotes Bortezomib resistance via m6A-dependent destabilization of Superoxide dismutase [Mn], mitochondrial (SOD2) expression in multiple myeloma.
Target Regulator	Fat mass and obesity-associated protein (FTO)	ERASER	Regulator Info
Target Regulation	Down regulation
Responsed Disease	Multiple myeloma	ICD-11: 2A83.1	Disease Info

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00402)

Superoxide dismutase [Mn], mitochondrial (SOD2)

Adenosine-to-Inosine editing (A-to-I)

In total 13 m6A sequence/site(s) in this target gene
mod ID: A2ISITE001831		Click to Show/Hide the Full List
mod site	chr6:159679823-159679824:-		[4]
Sequence	AGCGTGGCCAACGTGGTGAAACCCTGTCTCTACTAAAAATA
Transcript ID List	ENST00000367054.6; ENST00000546087.5; ENST00000538183.7; ENST00000367055.8; ENST00000546260.5; rmsk_2124696
External Link	RMBase: RNA-editing_site_120116
mod ID: A2ISITE001832		Click to Show/Hide the Full List
mod site	chr6:159679849-159679850:-		[4]
Sequence	CAGAACACTTGAAGGAGTTCAAGACCAGCGTGGCCAACGTG
Transcript ID List	ENST00000546260.5; rmsk_2124696; ENST00000367054.6; ENST00000546087.5; ENST00000538183.7; ENST00000367055.8
External Link	RMBase: RNA-editing_site_120117
mod ID: A2ISITE001833		Click to Show/Hide the Full List
mod site	chr6:159679877-159679878:-		[4]
Sequence	TCCCAGCACTTTGGGAGGCCAAGGCAGGCAGAACACTTGAA
Transcript ID List	ENST00000546260.5; rmsk_2124696; ENST00000538183.7; ENST00000367054.6; ENST00000367055.8; ENST00000546087.5
External Link	RMBase: RNA-editing_site_120118
mod ID: A2ISITE001834		Click to Show/Hide the Full List
mod site	chr6:159685357-159685358:-		[5]
Sequence	CGCAGCTGCTCGGGAGGCTAAGGCAGGAGAATTGCTTGAAC
Transcript ID List	ENST00000538183.7; ENST00000337404.8; ENST00000367054.6; ENST00000401980.3; ENST00000540491.1; ENST00000541573.5; ENST00000535459.5; ENST00000535561.5; ENST00000546260.5; ENST00000545162.5; ENST00000367055.8; rmsk_2124705; ENST00000444946.6; ENST00000546087.5; ENST00000537657.5
External Link	RMBase: RNA-editing_site_120119
mod ID: A2ISITE001835		Click to Show/Hide the Full List
mod site	chr6:159696924-159696925:-		[5]
Sequence	TGCCTTCAGCCTCCTGGCGTAGCTAGGACTGCAGGCACATG
Transcript ID List	ENST00000535561.5; ENST00000546087.5; ENST00000545162.5; ENST00000537657.5; ENST00000401980.3
External Link	RMBase: RNA-editing_site_120120
mod ID: A2ISITE001836		Click to Show/Hide the Full List
mod site	chr6:159702374-159702375:-		[5]
Sequence	CAACCTGGGAGGCGGAGGTTACAGTGAGCTGAGATTGCACC
Transcript ID List	ENST00000535561.5; ENST00000537657.5; ENST00000401980.3; rmsk_2124744; ENST00000546087.5; ENST00000545162.5
External Link	RMBase: RNA-editing_site_120121
mod ID: A2ISITE001837		Click to Show/Hide the Full List
mod site	chr6:159702925-159702926:-		[5]
Sequence	CCCTGGGATTAAGCAGTCCTACCTTAGCCTCCTGAGTAGCT
Transcript ID List	ENST00000545162.5; ENST00000401980.3; ENST00000537657.5; ENST00000535561.5; ENST00000546087.5
External Link	RMBase: RNA-editing_site_120122
mod ID: A2ISITE001838		Click to Show/Hide the Full List
mod site	chr6:159710373-159710374:-		[5]
Sequence	TCACTGCAACTTTGCCTCCCAGGTTCAAGTGATTTCTCCTG
Transcript ID List	ENST00000546087.5; ENST00000537657.5; ENST00000401980.3; ENST00000535561.5; ENST00000545162.5
External Link	RMBase: RNA-editing_site_120123
mod ID: A2ISITE001839		Click to Show/Hide the Full List
mod site	chr6:159717941-159717942:-		[5]
Sequence	GTGTATGTGTGAGTGTATATATATATACACATATACACACA
Transcript ID List	ENST00000545162.5; ENST00000401980.3; ENST00000535561.5; ENST00000546087.5; ENST00000537657.5; rmsk_2124762
External Link	RMBase: RNA-editing_site_120124
mod ID: A2ISITE001840		Click to Show/Hide the Full List
mod site	chr6:159719819-159719820:-		[5]
Sequence	GAGGCAGGAGACTCTCTTGAACCCGGGAGGTGGAGGTTGCA
Transcript ID List	ENST00000401980.3; ENST00000537657.5; ENST00000545162.5; rmsk_2124769; ENST00000546087.5; ENST00000535561.5
External Link	RMBase: RNA-editing_site_120125
mod ID: A2ISITE001841		Click to Show/Hide the Full List
mod site	chr6:159724287-159724288:-		[5]
Sequence	AGATCAAAGAAGTTCAGAAAAGGGCCGGGTGGCTGATGCCT
Transcript ID List	ENST00000545162.5; ENST00000537657.5; ENST00000401980.3; rmsk_2124787; ENST00000546087.5; ENST00000535561.5
External Link	RMBase: RNA-editing_site_120126
mod ID: A2ISITE001842		Click to Show/Hide the Full List
mod site	chr6:159724768-159724769:-		[5]
Sequence	GCCTTGACTTCCTGGGCTCAAGCAATCCTCCCATCTCAGCC
Transcript ID List	ENST00000401980.3; ENST00000546087.5; ENST00000537657.5; ENST00000545162.5; ENST00000535561.5
External Link	RMBase: RNA-editing_site_120127
mod ID: A2ISITE001846		Click to Show/Hide the Full List
mod site	chr6:159758819-159758820:-		[5]
Sequence	GTCCAAGCCAGGTCTTTGCTACAGGCTGGATTCACCAACCT
Transcript ID List	ENST00000546087.5
External Link	RMBase: RNA-editing_site_120131

5-methylcytidine (m5C)

In total 1 m6A sequence/site(s) in this target gene
mod ID: M5CSITE004061		Click to Show/Hide the Full List
mod site	chr6:159679821-159679822:-		[6]
Sequence	CGTGGCCAACGTGGTGAAACCCTGTCTCTACTAAAAATACA
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000546087.5; ENST00000367054.6; ENST00000367055.8; ENST00000538183.7; ENST00000546260.5; rmsk_2124696
External Link	RMBase: m5C_site_38680

N6-methyladenosine (m6A)

In total 110 m6A sequence/site(s) in this target gene
mod ID: M6ASITE077808		Click to Show/Hide the Full List
mod site	chr6:159669835-159669836:-		[7]
Sequence	AAGAAACCTCACCTGTAAAGACAGGCCAAAAGTGAAGGTAT
Motif Score	2.897386905
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	rmsk_2124687; ENST00000538183.7
External Link	RMBase: m6A_site_741299
mod ID: M6ASITE077809		Click to Show/Hide the Full List
mod site	chr6:159669850-159669851:-		[7]
Sequence	CTGTATGCTGCCTACAAGAAACCTCACCTGTAAAGACAGGC
Motif Score	2.185083333
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	rmsk_2124687; ENST00000538183.7
External Link	RMBase: m6A_site_741300
mod ID: M6ASITE077810		Click to Show/Hide the Full List
mod site	chr6:159679177-159679178:-		[8]
Sequence	TTTGATTATTCATTGAAGAAACATTTATTTTCCAATTGTGT
Motif Score	2.20572619
Cell/Tissue List	HeLa; hESC-HEK293T
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000367054.6; ENST00000546260.5; ENST00000546087.5; ENST00000367055.8; ENST00000538183.7
External Link	RMBase: m6A_site_741301
mod ID: M6ASITE077811		Click to Show/Hide the Full List
mod site	chr6:159679224-159679225:-		[8]
Sequence	AAGCCTGGTACATACTGAAAACCCTATAAGGTCCTGGATAA
Motif Score	2.185083333
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000367055.8; ENST00000546260.5; ENST00000367054.6; ENST00000538183.7; ENST00000546087.5
External Link	RMBase: m6A_site_741302
mod ID: M6ASITE077812		Click to Show/Hide the Full List
mod site	chr6:159679231-159679232:-		[9]
Sequence	GTGCATCAAGCCTGGTACATACTGAAAACCCTATAAGGTCC
Motif Score	2.53247619
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000546260.5; ENST00000367054.6; ENST00000546087.5; ENST00000367055.8; ENST00000538183.7
External Link	RMBase: m6A_site_741303
mod ID: M6ASITE077813		Click to Show/Hide the Full List
mod site	chr6:159679235-159679236:-		[10]
Sequence	AGATGTGCATCAAGCCTGGTACATACTGAAAACCCTATAAG
Motif Score	2.856142857
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000367054.6; ENST00000367055.8; ENST00000538183.7; ENST00000546087.5; ENST00000546260.5
External Link	RMBase: m6A_site_741304
mod ID: M6ASITE077814		Click to Show/Hide the Full List
mod site	chr6:159679395-159679396:-		[8]
Sequence	ATATCTAAAACCACGTATAAACATAAATTGTATTTCCTGTT
Motif Score	2.20572619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000367054.6; ENST00000546260.5; ENST00000546087.5; ENST00000538183.7; ENST00000367055.8
External Link	RMBase: m6A_site_741305
mod ID: M6ASITE077815		Click to Show/Hide the Full List
mod site	chr6:159679406-159679407:-		[8]
Sequence	TATATTGAGTCATATCTAAAACCACGTATAAACATAAATTG
Motif Score	2.185083333
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000538183.7; ENST00000546087.5; ENST00000367054.6; ENST00000367055.8; ENST00000546260.5
External Link	RMBase: m6A_site_741306
mod ID: M6ASITE077816		Click to Show/Hide the Full List
mod site	chr6:159679447-159679448:-		[8]
Sequence	CTTTAAAAAAGTAATACCAAACCATAAAGTTAAAATCTATG
Motif Score	2.185083333
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000546260.5; ENST00000367055.8; ENST00000546087.5; ENST00000367054.6; ENST00000538183.7
External Link	RMBase: m6A_site_741307
mod ID: M6ASITE077817		Click to Show/Hide the Full List
mod site	chr6:159679452-159679453:-		[9]
Sequence	AGCGCCTTTAAAAAAGTAATACCAAACCATAAAGTTAAAAT
Motif Score	2.089839286
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000546260.5; ENST00000367054.6; ENST00000367055.8; ENST00000546087.5; ENST00000538183.7
External Link	RMBase: m6A_site_741308
mod ID: M6ASITE077818		Click to Show/Hide the Full List
mod site	chr6:159679515-159679516:-		[9]
Sequence	TTATTGTACACTTCATTGCAACTTGAAATTCATGGTCTTAA
Motif Score	2.595904762
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000546087.5; ENST00000367055.8; ENST00000546260.5; ENST00000538183.7; ENST00000367054.6
External Link	RMBase: m6A_site_741309
mod ID: M6ASITE077819		Click to Show/Hide the Full List
mod site	chr6:159679528-159679529:-		[9]
Sequence	AGAAATCACAACTTTATTGTACACTTCATTGCAACTTGAAA
Motif Score	2.856142857
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000538183.7; ENST00000367055.8; ENST00000367054.6; ENST00000546087.5; ENST00000546260.5
External Link	RMBase: m6A_site_741310
mod ID: M6ASITE077820		Click to Show/Hide the Full List
mod site	chr6:159679538-159679539:-		[9]
Sequence	TTTGATGTTGAGAAATCACAACTTTATTGTACACTTCATTG
Motif Score	2.595904762
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000538183.7; ENST00000546260.5; ENST00000546087.5; ENST00000367055.8; ENST00000367054.6
External Link	RMBase: m6A_site_741311
mod ID: M6ASITE077821		Click to Show/Hide the Full List
mod site	chr6:159679560-159679561:-		[9]
Sequence	AACTATTTTGTAATAATTAAACTTTGATGTTGAGAAATCAC
Motif Score	2.627720238
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000546260.5; ENST00000367055.8; ENST00000546087.5; ENST00000538183.7; ENST00000367054.6
External Link	RMBase: m6A_site_741312
mod ID: M6ASITE077822		Click to Show/Hide the Full List
mod site	chr6:159679579-159679580:-		[9]
Sequence	AAATTCTATCTGTTGCTTGAACTATTTTGTAATAATTAAAC
Motif Score	3.373380952
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000367054.6; ENST00000546087.5; ENST00000538183.7; ENST00000546260.5; ENST00000367055.8
External Link	RMBase: m6A_site_741313
mod ID: M6ASITE077823		Click to Show/Hide the Full List
mod site	chr6:159679609-159679610:-		[9]
Sequence	AACAAGGAAGCAAAGCAAATACTGTTTTTGAAATTCTATCT
Motif Score	2.53247619
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000546260.5; ENST00000546087.5; ENST00000538183.7; ENST00000367054.6; ENST00000367055.8
External Link	RMBase: m6A_site_741314
mod ID: M6ASITE077824		Click to Show/Hide the Full List
mod site	chr6:159679628-159679629:-		[9]
Sequence	ATGATTAGTGTTGGAGCAAAACAAGGAAGCAAAGCAAATAC
Motif Score	2.20572619
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000367054.6; ENST00000546260.5; ENST00000367055.8; ENST00000546087.5; ENST00000538183.7
External Link	RMBase: m6A_site_741315
mod ID: M6ASITE077825		Click to Show/Hide the Full List
mod site	chr6:159679700-159679701:-		[9]
Sequence	ATCCAAGAAGGGTTTTTGTGACTGAATCAGCAGTGCCTGCC
Motif Score	3.28175
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000538183.7; ENST00000546087.5; ENST00000367054.6; ENST00000546260.5; ENST00000367055.8
External Link	RMBase: m6A_site_741316
mod ID: M6ASITE077826		Click to Show/Hide the Full List
mod site	chr6:159679803-159679804:-		[9]
Sequence	ACCCTGTCTCTACTAAAAATACAAAAATTGTTTAGCTCTGT
Motif Score	2.110482143
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000546260.5; ENST00000546087.5; ENST00000538183.7; ENST00000367055.8; ENST00000367054.6; rmsk_2124696
External Link	RMBase: m6A_site_741317
mod ID: M6ASITE077827		Click to Show/Hide the Full List
mod site	chr6:159679865-159679866:-		[11]
Sequence	GGGAGGCCAAGGCAGGCAGAACACTTGAAGGAGTTCAAGAC
Motif Score	2.951386905
Cell/Tissue List	MT4
Seq Type List	MeRIP-seq
Transcript ID List	rmsk_2124696; ENST00000367055.8; ENST00000546087.5; ENST00000546260.5; ENST00000367054.6; ENST00000538183.7
External Link	RMBase: m6A_site_741318
mod ID: M6ASITE077828		Click to Show/Hide the Full List
mod site	chr6:159679890-159679891:-		[9]
Sequence	CTCACATCTGTAATCCCAGCACTTTGGGAGGCCAAGGCAGG
Motif Score	3.252583333
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000367054.6; rmsk_2124696; ENST00000367055.8; ENST00000538183.7; ENST00000546260.5; ENST00000546087.5
External Link	RMBase: m6A_site_741319
mod ID: M6ASITE077829		Click to Show/Hide the Full List
mod site	chr6:159679942-159679943:-		[8]
Sequence	GTCATCTGGTGGAAAAGGAGACTTTAAGATTGTTTAGGGCT
Motif Score	3.319380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000367055.8; ENST00000546260.5; ENST00000367054.6; ENST00000538183.7; ENST00000546087.5
External Link	RMBase: m6A_site_741320
mod ID: M6ASITE077830		Click to Show/Hide the Full List
mod site	chr6:159679975-159679976:-		[8]
Sequence	GAGACTAAGGGAATTTACAAACTAAAGATTTTAGTCATCTG
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000546087.5; ENST00000367054.6; ENST00000546260.5; ENST00000367055.8; ENST00000538183.7
External Link	RMBase: m6A_site_741321
mod ID: M6ASITE077831		Click to Show/Hide the Full List
mod site	chr6:159679979-159679980:-		[9]
Sequence	TTAAGAGACTAAGGGAATTTACAAACTAAAGATTTTAGTCA
Motif Score	2.07285119
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000546087.5; ENST00000546260.5; ENST00000367055.8; ENST00000367054.6; ENST00000538183.7
External Link	RMBase: m6A_site_741322
mod ID: M6ASITE077832		Click to Show/Hide the Full List
mod site	chr6:159679992-159679993:-		[8]
Sequence	GGATAGATTGATTTTAAGAGACTAAGGGAATTTACAAACTA
Motif Score	3.319380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000546260.5; ENST00000367055.8; ENST00000538183.7; ENST00000367054.6; ENST00000546087.5
External Link	RMBase: m6A_site_741323
mod ID: M6ASITE077833		Click to Show/Hide the Full List
mod site	chr6:159680140-159680141:-		[9]
Sequence	TATAAAGCTTTTTGATTCCTACTAAGCTTTAAGATTTAAAA
Motif Score	2.500660714
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000367055.8; ENST00000538183.7; ENST00000367054.6; ENST00000546260.5; ENST00000546087.5
External Link	RMBase: m6A_site_741324
mod ID: M6ASITE077834		Click to Show/Hide the Full List
mod site	chr6:159680190-159680191:-		[9]
Sequence	TAGATCATGGTTTGTATTGAACTAACAAGGTTTGCAGATCT
Motif Score	3.373380952
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000546087.5; ENST00000367055.8; ENST00000538183.7; ENST00000546260.5; ENST00000367054.6
External Link	RMBase: m6A_site_741325
mod ID: M6ASITE077835		Click to Show/Hide the Full List
mod site	chr6:159680249-159680250:-		[8]
Sequence	AAATAGACGGGCAAGGTGGAACCTTTTGAAAGATGAGCTTT
Motif Score	2.930744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000367054.6; ENST00000546260.5; ENST00000367055.8; ENST00000546087.5; ENST00000538183.7
External Link	RMBase: m6A_site_741326
mod ID: M6ASITE077836		Click to Show/Hide the Full List
mod site	chr6:159680304-159680305:-		[9]
Sequence	TTTATGTGTCATGTAAGATTACTGCTTGCCTCTCTAAGGAA
Motif Score	2.494845238
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000546087.5; ENST00000538183.7; ENST00000367055.8; ENST00000546260.5; ENST00000367054.6
External Link	RMBase: m6A_site_741327
mod ID: M6ASITE077837		Click to Show/Hide the Full List
mod site	chr6:159680330-159680331:-		[8]
Sequence	TATATATGTGTCACAGTGAAACAGCTTTTATGTGTCATGTA
Motif Score	2.20572619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000367055.8; ENST00000367054.6; ENST00000538183.7; ENST00000546087.5; ENST00000546260.5
External Link	RMBase: m6A_site_741328
mod ID: M6ASITE077838		Click to Show/Hide the Full List
mod site	chr6:159680359-159680360:-		[9]
Sequence	AAAAACTTTGGAGACTGATTACTTTTCATTATATATGTGTC
Motif Score	2.494845238
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000367055.8; ENST00000546260.5; ENST00000367054.6; ENST00000538183.7; ENST00000546087.5
External Link	RMBase: m6A_site_741329
mod ID: M6ASITE077839		Click to Show/Hide the Full List
mod site	chr6:159680366-159680367:-		[8]
Sequence	GGATTGGAAAAACTTTGGAGACTGATTACTTTTCATTATAT
Motif Score	3.319380952
Cell/Tissue List	HeLa; HEK293T
Seq Type List	m6A-seq; DART-seq
Transcript ID List	ENST00000546087.5; ENST00000367055.8; ENST00000367054.6; ENST00000538183.7; ENST00000546260.5
External Link	RMBase: m6A_site_741330
mod ID: M6ASITE077840		Click to Show/Hide the Full List
mod site	chr6:159680375-159680376:-		[8]
Sequence	CATGCTTGTGGATTGGAAAAACTTTGGAGACTGATTACTTT
Motif Score	2.627720238
Cell/Tissue List	HeLa; HEK293T
Seq Type List	m6A-seq; DART-seq
Transcript ID List	ENST00000367055.8; ENST00000546087.5; ENST00000538183.7; ENST00000367054.6; ENST00000546260.5
External Link	RMBase: m6A_site_741331
mod ID: M6ASITE077841		Click to Show/Hide the Full List
mod site	chr6:159680437-159680438:-		[9]
Sequence	GGCTTTAAAAATTATTAGAGACAAGAGTACCAAAGCGGTGT
Motif Score	2.897386905
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000367054.6; ENST00000367055.8; ENST00000546260.5; ENST00000546087.5; ENST00000538183.7
External Link	RMBase: m6A_site_741332
mod ID: M6ASITE077842		Click to Show/Hide the Full List
mod site	chr6:159680483-159680484:-		[9]
Sequence	AAAAAATTTAAATTCAAGGTACTTTTAAAATTCAGTTAGAA
Motif Score	3.278136905
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000546087.5; ENST00000367055.8; ENST00000538183.7; ENST00000546260.5; ENST00000367054.6
External Link	RMBase: m6A_site_741333
mod ID: M6ASITE077843		Click to Show/Hide the Full List
mod site	chr6:159680515-159680516:-		[9]
Sequence	TAGCAGTTTCAATATTGAAGACTGAAGTTTAAAAAAAATTT
Motif Score	3.319380952
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000546087.5; ENST00000538183.7; ENST00000546260.5; ENST00000367055.8; ENST00000367054.6
External Link	RMBase: m6A_site_741334
mod ID: M6ASITE077844		Click to Show/Hide the Full List
mod site	chr6:159680872-159680873:-		[9]
Sequence	CGCGACCGGAGCTCACTGCAACCTCCACTTCCCGGGTTCAA
Motif Score	2.153267857
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000538183.7; ENST00000546087.5; ENST00000546260.5; ENST00000367055.8; ENST00000367054.6
External Link	RMBase: m6A_site_741335
mod ID: M6ASITE077845		Click to Show/Hide the Full List
mod site	chr6:159680931-159680932:-		[12]
Sequence	TTTTTTCTTTTTTTTTGGAGACAGAGTCTTGCTCTGTTGCC
Motif Score	2.897386905
Cell/Tissue List	endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000367055.8; ENST00000367054.6; ENST00000546087.5; ENST00000546260.5; ENST00000538183.7
External Link	RMBase: m6A_site_741336
mod ID: M6ASITE077846		Click to Show/Hide the Full List
mod site	chr6:159681000-159681001:-		[9]
Sequence	TGGGGTGAGCAACTCTGTGTACATAGGTTTATCTCCTATTG
Motif Score	2.856142857
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000367054.6; ENST00000367055.8; ENST00000546260.5; ENST00000546087.5; ENST00000538183.7
External Link	RMBase: m6A_site_741337
mod ID: M6ASITE077847		Click to Show/Hide the Full List
mod site	chr6:159681034-159681035:-		[9]
Sequence	TTCATTTGTTTCTAATTGTTACTACAGATAATGCTGGGGTG
Motif Score	2.494845238
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000367054.6; ENST00000546260.5; ENST00000538183.7; ENST00000546087.5; ENST00000367055.8
External Link	RMBase: m6A_site_741338
mod ID: M6ASITE077848		Click to Show/Hide the Full List
mod site	chr6:159681069-159681070:-		[9]
Sequence	TTTCATCATCTGCCTAATTTACTGTTTTTGAATATTTCATT
Motif Score	2.494845238
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000367054.6; ENST00000367055.8; ENST00000538183.7; ENST00000546087.5; ENST00000546260.5
External Link	RMBase: m6A_site_741339
mod ID: M6ASITE077849		Click to Show/Hide the Full List
mod site	chr6:159681104-159681105:-		[9]
Sequence	TATATTTGGCTTAGCATCATACATTTGCCATGTTGTTTCAT
Motif Score	2.110482143
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000367054.6; ENST00000546260.5; ENST00000538183.7; ENST00000546087.5; ENST00000367055.8
External Link	RMBase: m6A_site_741340
mod ID: M6ASITE077850		Click to Show/Hide the Full List
mod site	chr6:159681349-159681350:-		[9]
Sequence	CTGAAAAGTAGCTCAGGGGCACGTGTTAAGGATGTCTCTAG
Motif Score	2.80452381
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000367055.8; ENST00000546260.5; ENST00000546087.5; ENST00000367054.6; ENST00000538183.7
External Link	RMBase: m6A_site_741341
mod ID: M6ASITE077851		Click to Show/Hide the Full List
mod site	chr6:159681792-159681793:-		[8]
Sequence	TTGGGCAGCTCATGCTTGAGACCCAATCTCCATGATGACCT
Motif Score	2.876744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000546087.5; ENST00000367055.8; ENST00000538183.7; ENST00000367054.6; ENST00000546260.5
External Link	RMBase: m6A_site_741342
mod ID: M6ASITE077852		Click to Show/Hide the Full List
mod site	chr6:159681882-159681883:-		[8]
Sequence	AGGCAAACTTCAACAGCAAAACTGCAAAAAGGTGGTTTTTG
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000546260.5; ENST00000367054.6; ENST00000367055.8; ENST00000538183.7; ENST00000546087.5
External Link	RMBase: m6A_site_741343
mod ID: M6ASITE077853		Click to Show/Hide the Full List
mod site	chr6:159681896-159681897:-		[8]
Sequence	CACCTGCACAGTAAAGGCAAACTTCAACAGCAAAACTGCAA
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000538183.7; ENST00000546260.5; ENST00000367055.8; ENST00000367054.6; ENST00000546087.5
External Link	RMBase: m6A_site_741344
mod ID: M6ASITE077854		Click to Show/Hide the Full List
mod site	chr6:159681929-159681930:-		[8]
Sequence	AAATGTAGCAGGTGAACTGAACTGGGGTTTGCTCACCTGCA
Motif Score	3.373380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000367054.6; ENST00000546087.5; ENST00000546260.5; ENST00000538183.7; ENST00000367055.8
External Link	RMBase: m6A_site_741345
mod ID: M6ASITE077855		Click to Show/Hide the Full List
mod site	chr6:159681934-159681935:-		[8]
Sequence	TGTTTAAATGTAGCAGGTGAACTGAACTGGGGTTTGCTCAC
Motif Score	3.373380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000367054.6; ENST00000538183.7; ENST00000546260.5; ENST00000546087.5; ENST00000367055.8
External Link	RMBase: m6A_site_741346
mod ID: M6ASITE077856		Click to Show/Hide the Full List
mod site	chr6:159682031-159682032:-		[9]
Sequence	GAGTAATCCTCTGCAGTGATACTTCTGGTAGATGTCACCCA
Motif Score	2.53247619
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000367054.6; ENST00000546260.5; ENST00000546087.5; ENST00000538183.7; ENST00000367055.8
External Link	RMBase: m6A_site_741347
mod ID: M6ASITE077857		Click to Show/Hide the Full List
mod site	chr6:159682087-159682088:-		[8]
Sequence	TTAACACTTTCCCAAGGGAAACACTCGGCTTTCTATAGAAA
Motif Score	2.20572619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000546260.5; ENST00000367055.8; ENST00000546087.5; ENST00000367054.6; ENST00000538183.7
External Link	RMBase: m6A_site_741348
mod ID: M6ASITE077858		Click to Show/Hide the Full List
mod site	chr6:159682123-159682124:-		[9]
Sequence	TCTAGTCTTTTGCCCCAGTTACTTAAAAATAAAATATTAAC
Motif Score	2.494845238
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000367054.6; ENST00000546087.5; ENST00000546260.5; ENST00000538183.7; ENST00000367055.8
External Link	RMBase: m6A_site_741349
mod ID: M6ASITE077859		Click to Show/Hide the Full List
mod site	chr6:159682191-159682192:-		[8]
Sequence	TCCATCCATATACTTTGGGGACTTGTAGGGATGCCTTTCTA
Motif Score	4.065041667
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000538183.7; ENST00000367055.8; ENST00000546087.5; ENST00000337404.8; ENST00000444946.6; ENST00000367054.6; ENST00000546260.5
External Link	RMBase: m6A_site_741350
mod ID: M6ASITE077860		Click to Show/Hide the Full List
mod site	chr6:159682225-159682226:-		[8]
Sequence	TTACAATTGTCATTTATAAAACCATCAAAAATATTCCATCC
Motif Score	2.185083333
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000367055.8; ENST00000538183.7; ENST00000546087.5; ENST00000444946.6; ENST00000546260.5; ENST00000367054.6; ENST00000337404.8
External Link	RMBase: m6A_site_741351
mod ID: M6ASITE077861		Click to Show/Hide the Full List
mod site	chr6:159682267-159682268:-		[8]
Sequence	GTGTGATTGAATCTGATTGGACATTTTCTTCAGAGAGCTAA
Motif Score	3.643047619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000538183.7; ENST00000444946.6; ENST00000367054.6; ENST00000546087.5; ENST00000337404.8; ENST00000546260.5; ENST00000367055.8
External Link	RMBase: m6A_site_741352
mod ID: M6ASITE077862		Click to Show/Hide the Full List
mod site	chr6:159682330-159682331:-		[8]
Sequence	TCTGAATAATTTCTTACTAAACATTTTGTTATTGGGCAAGT
Motif Score	2.20572619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000538183.7; ENST00000444946.6; ENST00000546087.5; ENST00000367054.6; ENST00000546260.5; ENST00000337404.8; ENST00000367055.8
External Link	RMBase: m6A_site_741353
mod ID: M6ASITE077863		Click to Show/Hide the Full List
mod site	chr6:159682335-159682336:-		[9]
Sequence	AATGTTCTGAATAATTTCTTACTAAACATTTTGTTATTGGG
Motif Score	2.494845238
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000367054.6; ENST00000337404.8; ENST00000367055.8; ENST00000546260.5; ENST00000444946.6; ENST00000546087.5; ENST00000538183.7
External Link	RMBase: m6A_site_741354
mod ID: M6ASITE077864		Click to Show/Hide the Full List
mod site	chr6:159682359-159682360:-		[9]
Sequence	AGTCACTTATTTCATAAACAACTTAATGTTCTGAATAATTT
Motif Score	2.595904762
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000367055.8; ENST00000538183.7; ENST00000367054.6; ENST00000546087.5; ENST00000546260.5; ENST00000337404.8; ENST00000444946.6
External Link	RMBase: m6A_site_741355
mod ID: M6ASITE077865		Click to Show/Hide the Full List
mod site	chr6:159682362-159682363:-		[8]
Sequence	CTTAGTCACTTATTTCATAAACAACTTAATGTTCTGAATAA
Motif Score	2.20572619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000444946.6; ENST00000546260.5; ENST00000367055.8; ENST00000538183.7; ENST00000546087.5; ENST00000367054.6; ENST00000337404.8
External Link	RMBase: m6A_site_741356
mod ID: M6ASITE077866		Click to Show/Hide the Full List
mod site	chr6:159682491-159682492:-		[8]
Sequence	ACATGGCTTGCAAAAAGTAAACCACGATCGTTATGCTGAGT
Motif Score	2.185083333
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000538183.7; ENST00000444946.6; ENST00000541573.5; ENST00000535459.5; ENST00000337404.8; ENST00000367054.6; ENST00000546087.5; ENST00000546260.5; ENST00000367055.8
External Link	RMBase: m6A_site_741357
mod ID: M6ASITE077867		Click to Show/Hide the Full List
mod site	chr6:159682511-159682512:-		[10]
Sequence	GGAGAATGTAACTGAAAGATACATGGCTTGCAAAAAGTAAA
Motif Score	2.110482143
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000367054.6; ENST00000444946.6; ENST00000538183.7; ENST00000535459.5; ENST00000541573.5; ENST00000546260.5; ENST00000367055.8; ENST00000546087.5; ENST00000337404.8
External Link	RMBase: m6A_site_741358
mod ID: M6ASITE077868		Click to Show/Hide the Full List
mod site	chr6:159684859-159684860:-		[8]
Sequence	ATCAGGATCCACTGCAAGGAACAACAGGTTAGATTTAAAAA
Motif Score	2.951386905
Cell/Tissue List	HeLa; hESC-HEK293T
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000546087.5; ENST00000535459.5; ENST00000541573.5; ENST00000367054.6; ENST00000444946.6; ENST00000538183.7; ENST00000337404.8; ENST00000367055.8; ENST00000546260.5; ENST00000540491.1
External Link	RMBase: m6A_site_741359
mod ID: M6ASITE077869		Click to Show/Hide the Full List
mod site	chr6:159684899-159684900:-		[10]
Sequence	AATAAGGAACGGGGACACTTACAAATTGCTGCTTGTCCAAA
Motif Score	2.07285119
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000541573.5; ENST00000535459.5; ENST00000538183.7; ENST00000535561.5; ENST00000545162.5; ENST00000546260.5; ENST00000540491.1; ENST00000444946.6; ENST00000367054.6; ENST00000367055.8; ENST00000337404.8; ENST00000546087.5
External Link	RMBase: m6A_site_741360
mod ID: M6ASITE077870		Click to Show/Hide the Full List
mod site	chr6:159684905-159684906:-		[10]
Sequence	GGTTTCAATAAGGAACGGGGACACTTACAAATTGCTGCTTG
Motif Score	3.643047619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000367054.6; ENST00000535459.5; ENST00000545162.5; ENST00000538183.7; ENST00000546087.5; ENST00000367055.8; ENST00000541573.5; ENST00000540491.1; ENST00000337404.8; ENST00000537657.5; ENST00000444946.6; ENST00000546260.5; ENST00000535561.5
External Link	RMBase: m6A_site_741361
mod ID: M6ASITE077871		Click to Show/Hide the Full List
mod site	chr6:159684990-159684991:-		[9]
Sequence	ACGTGACTTTGGTTCCTTTGACAAGTTTAAGGAGAAGCTGA
Motif Score	2.859755952
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000541573.5; ENST00000444946.6; ENST00000537657.5; ENST00000337404.8; ENST00000535561.5; ENST00000545162.5; ENST00000546260.5; ENST00000540491.1; ENST00000367054.6; ENST00000546087.5; ENST00000538183.7; ENST00000401980.3; ENST00000367055.8; ENST00000535459.5
External Link	RMBase: m6A_site_741362
mod ID: M6ASITE077872		Click to Show/Hide the Full List
mod site	chr6:159688132-159688133:-		[13]
Sequence	AGCCCTAACGGTGGTGGAGAACCCAAAGGTTGGTATATATT
Motif Score	2.930744048
Cell/Tissue List	Jurkat
Seq Type List	m6A-seq
Transcript ID List	ENST00000545162.5; ENST00000538183.7; ENST00000535561.5; ENST00000367054.6; ENST00000337404.8; ENST00000546087.5; ENST00000537657.5; ENST00000546260.5; ENST00000535459.5; ENST00000401980.3; ENST00000540491.1; ENST00000541573.5; ENST00000367055.8; ENST00000444946.6
External Link	RMBase: m6A_site_741363
mod ID: M6ASITE077873		Click to Show/Hide the Full List
mod site	chr6:159688161-159688162:-		[10]
Sequence	TCAATCATAGCATTTTCTGGACAAACCTCAGCCCTAACGGT
Motif Score	3.643047619
Cell/Tissue List	hESC-HEK293T; Jurkat; peripheral-blood; endometrial
Seq Type List	MAZTER-seq; m6A-seq
Transcript ID List	ENST00000367054.6; ENST00000546087.5; ENST00000401980.3; ENST00000545162.5; ENST00000535561.5; ENST00000538183.7; ENST00000337404.8; ENST00000541573.5; ENST00000367055.8; ENST00000540491.1; ENST00000537657.5; ENST00000444946.6; ENST00000546260.5; ENST00000535459.5
External Link	RMBase: m6A_site_741364
mod ID: M6ASITE077874		Click to Show/Hide the Full List
mod site	chr6:159691173-159691174:-		[7]
Sequence	TTCTCTTCAGTATTTTAAAAACAACTTAATTTCAGTCCTTT
Motif Score	2.20572619
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000337404.8; ENST00000401980.3; ENST00000545162.5; ENST00000541573.5; ENST00000444946.6; ENST00000546260.5; ENST00000546087.5; ENST00000537657.5; ENST00000538183.7; ENST00000367055.8; ENST00000452684.2; ENST00000367054.6; ENST00000535561.5; ENST00000540491.1
External Link	RMBase: m6A_site_741365
mod ID: M6ASITE077875		Click to Show/Hide the Full List
mod site	chr6:159691197-159691198:-		[7]
Sequence	GGCAACATCTGACACCAGGAACCTTTCTCTTCAGTATTTTA
Motif Score	2.930744048
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000367055.8; ENST00000444946.6; ENST00000540491.1; ENST00000546087.5; ENST00000541573.5; ENST00000546260.5; ENST00000367054.6; ENST00000401980.3; ENST00000545162.5; ENST00000452684.2; ENST00000538183.7; ENST00000537657.5; ENST00000535561.5; ENST00000337404.8
External Link	RMBase: m6A_site_741366
mod ID: M6ASITE077876		Click to Show/Hide the Full List
mod site	chr6:159691875-159691876:-		[14]
Sequence	GAACAGTTCAGGATCTTTAGACTTGATACTTTTCTTGATTT
Motif Score	3.319380952
Cell/Tissue List	A549
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000401980.3; ENST00000541573.5; ENST00000538183.7; ENST00000546087.5; ENST00000444946.6; ENST00000540491.1; ENST00000337404.8; ENST00000367054.6; ENST00000545162.5; ENST00000546260.5; ENST00000535561.5; ENST00000537657.5; ENST00000367055.8; ENST00000452684.2
External Link	RMBase: m6A_site_741367
mod ID: M6ASITE077877		Click to Show/Hide the Full List
mod site	chr6:159691893-159691894:-		[14]
Sequence	AGCAGTAACCTAACTGTGGAACAGTTCAGGATCTTTAGACT
Motif Score	2.951386905
Cell/Tissue List	A549
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000452684.2; ENST00000546260.5; ENST00000538183.7; ENST00000545162.5; ENST00000546087.5; ENST00000537657.5; ENST00000535561.5; ENST00000540491.1; ENST00000541573.5; ENST00000367054.6; ENST00000444946.6; ENST00000401980.3; ENST00000367055.8; ENST00000337404.8
External Link	RMBase: m6A_site_741368
mod ID: M6ASITE077878		Click to Show/Hide the Full List
mod site	chr6:159691984-159691985:-		[14]
Sequence	CCAGCTACCCTGCAGGTGAAACTTCACTGAGCCCACTTGAC
Motif Score	2.627720238
Cell/Tissue List	A549; HEK293A-TOA
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000540491.1; ENST00000537657.5; ENST00000367055.8; ENST00000538183.7; ENST00000546087.5; ENST00000444946.6; ENST00000545162.5; ENST00000546260.5; ENST00000337404.8; ENST00000452684.2; ENST00000541573.5; ENST00000367054.6; ENST00000401980.3; ENST00000535561.5
External Link	RMBase: m6A_site_741369
mod ID: M6ASITE077879		Click to Show/Hide the Full List
mod site	chr6:159692017-159692018:-		[15]
Sequence	CTCCAGCCTAGGACTTGGAGACTCCCTGCATCCCCAGCTAC
Motif Score	3.319380952
Cell/Tissue List	HEK293A-TOA
Seq Type List	m6A-seq
Transcript ID List	ENST00000444946.6; ENST00000367055.8; ENST00000337404.8; ENST00000545162.5; ENST00000367054.6; ENST00000546260.5; ENST00000401980.3; ENST00000541573.5; ENST00000535561.5; ENST00000537657.5; ENST00000540491.1; ENST00000538183.7; ENST00000546087.5; ENST00000452684.2
External Link	RMBase: m6A_site_741370
mod ID: M6ASITE077880		Click to Show/Hide the Full List
mod site	chr6:159692025-159692026:-		[15]
Sequence	GGTCGGGACTCCAGCCTAGGACTTGGAGACTCCCTGCATCC
Motif Score	4.065041667
Cell/Tissue List	HEK293A-TOA
Seq Type List	m6A-seq
Transcript ID List	ENST00000535561.5; ENST00000546087.5; ENST00000545162.5; ENST00000541573.5; ENST00000537657.5; ENST00000444946.6; ENST00000540491.1; ENST00000538183.7; ENST00000401980.3; ENST00000367055.8; ENST00000337404.8; ENST00000367054.6; ENST00000452684.2; ENST00000546260.5
External Link	RMBase: m6A_site_741371
mod ID: M6ASITE077881		Click to Show/Hide the Full List
mod site	chr6:159692038-159692039:-		[15]
Sequence	TGAGAGCAAACGGGGTCGGGACTCCAGCCTAGGACTTGGAG
Motif Score	4.065041667
Cell/Tissue List	HEK293A-TOA
Seq Type List	m6A-seq
Transcript ID List	ENST00000444946.6; ENST00000540491.1; ENST00000367055.8; ENST00000538183.7; ENST00000546087.5; ENST00000537657.5; ENST00000337404.8; ENST00000401980.3; ENST00000535561.5; ENST00000367054.6; ENST00000452684.2; ENST00000546260.5; ENST00000545162.5; ENST00000541573.5
External Link	RMBase: m6A_site_741372
mod ID: M6ASITE077882		Click to Show/Hide the Full List
mod site	chr6:159692203-159692204:-		[8]
Sequence	GCCTGTCCACTGGTGGCCAGACATCATCGGGTCCGCAGGTG
Motif Score	2.897386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000537657.5; ENST00000546260.5; ENST00000367054.6; ENST00000538183.7; ENST00000535561.5; ENST00000546087.5; ENST00000367055.8; ENST00000444946.6; ENST00000401980.3; ENST00000540491.1; ENST00000545162.5; ENST00000337404.8; ENST00000452684.2
External Link	RMBase: m6A_site_741373
mod ID: M6ASITE077883		Click to Show/Hide the Full List
mod site	chr6:159692439-159692440:-		[14]
Sequence	CACTTCTGTCATCTCAGGGAACTTGGGGTCCTGCGAAGGAG
Motif Score	3.373380952
Cell/Tissue List	A549
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000452684.2; ENST00000367054.6; ENST00000538183.7; ENST00000401980.3; ENST00000546260.5; ENST00000546087.5; ENST00000540491.1; ENST00000337404.8; ENST00000367055.8; ENST00000444946.6; ENST00000537657.5; ENST00000545162.5; ENST00000535561.5
External Link	RMBase: m6A_site_741374
mod ID: M6ASITE077884		Click to Show/Hide the Full List
mod site	chr6:159692462-159692463:-		[8]
Sequence	GAGTGCCTCGATGGGTTTGAACACACTTCTGTCATCTCAGG
Motif Score	2.951386905
Cell/Tissue List	HeLa; A549
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000401980.3; ENST00000546087.5; ENST00000540491.1; ENST00000535561.5; ENST00000546260.5; ENST00000545162.5; ENST00000337404.8; ENST00000537657.5; ENST00000538183.7; ENST00000444946.6; ENST00000367055.8; ENST00000452684.2; ENST00000367054.6
External Link	RMBase: m6A_site_741375
mod ID: M6ASITE077885		Click to Show/Hide the Full List
mod site	chr6:159692508-159692509:-		[8]
Sequence	CACGATAGTCTCTCTTTTAAACACATGGTCTACCTCATTGT
Motif Score	2.20572619
Cell/Tissue List	HeLa; A549
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000537657.5; ENST00000540491.1; ENST00000337404.8; ENST00000538183.7; ENST00000545162.5; ENST00000401980.3; ENST00000444946.6; ENST00000452684.2; ENST00000367054.6; ENST00000367055.8; ENST00000535561.5; ENST00000546087.5; ENST00000546260.5
External Link	RMBase: m6A_site_741376
mod ID: M6ASITE077886		Click to Show/Hide the Full List
mod site	chr6:159692566-159692567:-		[8]
Sequence	GGGCCTCTCCGTGGAGGAGAACTCGCTTCGTATTTGTACCG
Motif Score	3.373380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000444946.6; ENST00000367055.8; ENST00000367054.6; ENST00000452684.2; ENST00000546260.5; ENST00000546087.5; ENST00000337404.8; ENST00000545162.5; ENST00000537657.5; ENST00000538183.7; ENST00000401980.3; ENST00000540491.1; ENST00000535561.5
External Link	RMBase: m6A_site_741377
mod ID: M6ASITE077887		Click to Show/Hide the Full List
mod site	chr6:159692707-159692708:-		[8]
Sequence	GCACCACGCGGCCTACGTGAACAACCTGAACGTCACCGAGG
Motif Score	2.951386905
Cell/Tissue List	HeLa; HepG2; A549; hESC-HEK293T; Jurkat; CD4T; peripheral-blood; GSC-11; endometrial; HEC-1-A; MM6
Seq Type List	m6A-seq; MeRIP-seq; MAZTER-seq
Transcript ID List	ENST00000367054.6; ENST00000545162.5; ENST00000546087.5; ENST00000452684.2; ENST00000537657.5; ENST00000535561.5; ENST00000546260.5; ENST00000538183.7; ENST00000444946.6; ENST00000367055.8; ENST00000401980.3; ENST00000337404.8
External Link	RMBase: m6A_site_741378
mod ID: M6ASITE077888		Click to Show/Hide the Full List
mod site	chr6:159692764-159692765:-		[10]
Sequence	CTACGGCGCCCTGGAACCTCACATCAACGCGCAGATCATGC
Motif Score	2.047297619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000401980.3; ENST00000535561.5; ENST00000545162.5; ENST00000367054.6; ENST00000538183.7; ENST00000546260.5; ENST00000537657.5; ENST00000367055.8; ENST00000337404.8; ENST00000444946.6; ENST00000452684.2; ENST00000546087.5
External Link	RMBase: m6A_site_741379
mod ID: M6ASITE077889		Click to Show/Hide the Full List
mod site	chr6:159692769-159692770:-		[8]
Sequence	TACGACTACGGCGCCCTGGAACCTCACATCAACGCGCAGAT
Motif Score	2.930744048
Cell/Tissue List	HeLa; HepG2; A549; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293T; MSC; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000538183.7; ENST00000535561.5; ENST00000444946.6; ENST00000401980.3; ENST00000546260.5; ENST00000337404.8; ENST00000545162.5; ENST00000546087.5; ENST00000367054.6; ENST00000537657.5; ENST00000367055.8; ENST00000452684.2
External Link	RMBase: m6A_site_741380
mod ID: M6ASITE077890		Click to Show/Hide the Full List
mod site	chr6:159692809-159692810:-		[16]
Sequence	TCTGGGCTCCAGGCAGAAGCACAGCCTCCCCGACCTGCCCT
Motif Score	2.830589286
Cell/Tissue List	liver
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000337404.8; ENST00000444946.6; ENST00000367054.6; ENST00000546087.5; ENST00000535561.5; ENST00000538183.7; ENST00000367055.8; ENST00000545162.5; ENST00000401980.3; ENST00000452684.2; ENST00000537657.5; ENST00000546260.5
External Link	RMBase: m6A_site_741381
mod ID: M6ASITE077891		Click to Show/Hide the Full List
mod site	chr6:159713750-159713751:-		[9]
Sequence	AGAAACCATGGGACACAGATACGTTGAAGTATTCAAGTCTA
Motif Score	2.084416667
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000546087.5; ENST00000537657.5; ENST00000545162.5; ENST00000535561.5; ENST00000401980.3; ENST00000403291.1
External Link	RMBase: m6A_site_741382
mod ID: M6ASITE077892		Click to Show/Hide the Full List
mod site	chr6:159713758-159713759:-		[17]
Sequence	AAAGACAGAGAAACCATGGGACACAGATACGTTGAAGTATT
Motif Score	3.643047619
Cell/Tissue List	GM12878; TIME; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000535561.5; ENST00000401980.3; ENST00000403291.1; ENST00000537657.5; ENST00000546087.5; ENST00000545162.5
External Link	RMBase: m6A_site_741383
mod ID: M6ASITE077893		Click to Show/Hide the Full List
mod site	chr6:159713766-159713767:-		[17]
Sequence	TTGGCTTTAAAGACAGAGAAACCATGGGACACAGATACGTT
Motif Score	2.185083333
Cell/Tissue List	GM12878; TIME; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000537657.5; ENST00000546087.5; ENST00000535561.5; ENST00000403291.1; ENST00000401980.3; ENST00000545162.5
External Link	RMBase: m6A_site_741384
mod ID: M6ASITE077894		Click to Show/Hide the Full List
mod site	chr6:159713774-159713775:-		[17]
Sequence	AAGCGAAATTGGCTTTAAAGACAGAGAAACCATGGGACACA
Motif Score	2.897386905
Cell/Tissue List	GM12878; TIME; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000535561.5; ENST00000546087.5; ENST00000403291.1; ENST00000545162.5; ENST00000401980.3; ENST00000537657.5
External Link	RMBase: m6A_site_741385
mod ID: M6ASITE077895		Click to Show/Hide the Full List
mod site	chr6:159713811-159713812:-		[17]
Sequence	AGTGGTGAAGCATTTGTTGAACTTGAATCTGCAGATGAAGC
Motif Score	3.373380952
Cell/Tissue List	GM12878; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000545162.5; ENST00000403291.1; ENST00000535561.5; ENST00000546087.5; ENST00000401980.3; ENST00000537657.5
External Link	RMBase: m6A_site_741386
mod ID: M6ASITE077896		Click to Show/Hide the Full List
mod site	chr6:159713835-159713836:-		[17]
Sequence	ATCTACACCGGAGAAGGCAGACCAAGTGGTGAAGCATTTGT
Motif Score	2.876744048
Cell/Tissue List	GM12878; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000537657.5; ENST00000403291.1; ENST00000546087.5; ENST00000401980.3; ENST00000535561.5; ENST00000545162.5
External Link	RMBase: m6A_site_741387
mod ID: M6ASITE077914		Click to Show/Hide the Full List
mod site	chr6:159726871-159726872:-		[9]
Sequence	GCGGCGAGCCGCGGGCGTTTACTCTTAGCAGAAGCTCACCT
Motif Score	2.494845238
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000546087.5; ENST00000545162.5; ENST00000535561.5; ENST00000537657.5; ENST00000401980.3
External Link	RMBase: m6A_site_741405
mod ID: M6ASITE077915		Click to Show/Hide the Full List
mod site	chr6:159726922-159726923:-		[8]
Sequence	ATGCTTCCGCGTGTCGGAGGACCAGGTGCCACCTCAAGAGA
Motif Score	3.622404762
Cell/Tissue List	HeLa; GSC-11
Seq Type List	m6A-seq
Transcript ID List	ENST00000535561.5; ENST00000401980.3; ENST00000537657.5; ENST00000545162.5; ENST00000546087.5
External Link	RMBase: m6A_site_741406
mod ID: M6ASITE077917		Click to Show/Hide the Full List
mod site	chr6:159727284-159727285:-		[8]
Sequence	AGTCACTCGCCCGCCGCCGAACCCCGCCAGGAGAGGAAAGG
Motif Score	2.930744048
Cell/Tissue List	HeLa; HepG2; peripheral-blood; GSC-11; HEK293T; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000401980.3; ENST00000545162.5; ENST00000537657.5; ENST00000546087.5
External Link	RMBase: m6A_site_741408
mod ID: M6ASITE077920		Click to Show/Hide the Full List
mod site	chr6:159730959-159730960:-		[8]
Sequence	CTTTTTTTTTTCTAGTAGAGACAGCGTTTCACTATGTTGGC
Motif Score	2.897386905
Cell/Tissue List	HeLa; HepG2; A549; Huh7; CD4T; MSC; TIME; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000537657.5; ENST00000546087.5
External Link	RMBase: m6A_site_741411
mod ID: M6ASITE077943		Click to Show/Hide the Full List
mod site	chr6:159748552-159748553:-		[8]
Sequence	GGGAAAAGAAAAAAGCTGAAACACAAGGTTCATCTGGTAAG
Motif Score	2.20572619
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; GM12878; Huh7; iSLK; MSC; TIME; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000546087.5
External Link	RMBase: m6A_site_741434
mod ID: M6ASITE077947		Click to Show/Hide the Full List
mod site	chr6:159748673-159748674:-		[8]
Sequence	TCTATTTTCTTCAAACAGAAACATTTCTCAAGTGTCTACAT
Motif Score	2.20572619
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; hNPCs; hESCs; GM12878; Huh7; HEK293A-TOA; iSLK; MSC; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000546087.5
External Link	RMBase: m6A_site_741438
mod ID: M6ASITE078013		Click to Show/Hide the Full List
mod site	chr6:159761077-159761078:-		[8]
Sequence	TCCTGGAAACCTACATTAAGACTTTGCAGAGATATGCGGAT
Motif Score	3.319380952
Cell/Tissue List	HeLa; HEK293T; H1B; H1A; hNPCs; hESCs; GM12878; Huh7; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000546087.5; ENST00000535372.1
External Link	RMBase: m6A_site_741507
mod ID: M6ASITE078014		Click to Show/Hide the Full List
mod site	chr6:159761089-159761090:-		[8]
Sequence	AGAATCATTAAATCCTGGAAACCTACATTAAGACTTTGCAG
Motif Score	2.185083333
Cell/Tissue List	HeLa; HEK293T; H1B; H1A; hNPCs; hESCs; GM12878; Huh7; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000546087.5; ENST00000535372.1
External Link	RMBase: m6A_site_741508
mod ID: M6ASITE078015		Click to Show/Hide the Full List
mod site	chr6:159761127-159761128:-		[8]
Sequence	CTGGAGAATCTTCCTGAAGAACTTTAAAGTTGATTGAAAGA
Motif Score	3.373380952
Cell/Tissue List	HeLa; HEK293T; H1B; H1A; hNPCs; hESCs; GM12878; MM6; Huh7; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000535372.1; ENST00000546087.5
External Link	RMBase: m6A_site_741509
mod ID: M6ASITE078016		Click to Show/Hide the Full List
mod site	chr6:159761149-159761150:-		[18]
Sequence	AAGGGGAAAACTGTTGACGGACCTGGAGAATCTTCCTGAAG
Motif Score	3.622404762
Cell/Tissue List	HEK293T; H1B; H1A; GM12878; MM6; Huh7; TREX
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000535372.1; ENST00000546087.5
External Link	RMBase: m6A_site_741510
mod ID: M6ASITE078017		Click to Show/Hide the Full List
mod site	chr6:159761160-159761161:-		[18]
Sequence	ACAAAGTCATGAAGGGGAAAACTGTTGACGGACCTGGAGAA
Motif Score	2.627720238
Cell/Tissue List	HEK293T; H1B; H1A; GM12878; MM6; Huh7; TREX
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000535372.1; ENST00000546087.5
External Link	RMBase: m6A_site_741511
mod ID: M6ASITE078018		Click to Show/Hide the Full List
mod site	chr6:159761196-159761197:-		[18]
Sequence	GGGAACACCTGGATAGTGGAACAAGAAAGCTTTGTCACAAA
Motif Score	2.951386905
Cell/Tissue List	HEK293T; H1B; Huh7; TREX
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000535372.1; ENST00000546087.5
External Link	RMBase: m6A_site_741512
mod ID: M6ASITE078019		Click to Show/Hide the Full List
mod site	chr6:159761212-159761213:-		[18]
Sequence	GTTACAGCAACTTGTTGGGAACACCTGGATAGTGGAACAAG
Motif Score	2.951386905
Cell/Tissue List	HEK293T; Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000535372.1; ENST00000546087.5
External Link	RMBase: m6A_site_741513
mod ID: M6ASITE078020		Click to Show/Hide the Full List
mod site	chr6:159761323-159761324:-		[18]
Sequence	TGGGGTCAGTTTTGTTTAAAACCCTTTCTGACTTCCCAGCC
Motif Score	2.185083333
Cell/Tissue List	HEK293T; Huh7; TREX
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000546087.5; ENST00000535372.1
External Link	RMBase: m6A_site_741516
mod ID: M6ASITE078021		Click to Show/Hide the Full List
mod site	chr6:159761367-159761368:-		[18]
Sequence	TTCCTTTGGTTGACGTTTGGACAGTGAAAGGAGCATGTAAC
Motif Score	3.643047619
Cell/Tissue List	HEK293T; Huh7; TREX
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000535372.1; ENST00000546087.5
External Link	RMBase: m6A_site_741519
mod ID: M6ASITE078022		Click to Show/Hide the Full List
mod site	chr6:159761629-159761630:-		[8]
Sequence	TATCTCTCGTTCAGCTCAGGACTGGAATCCCACGGGCGAGA
Motif Score	4.065041667
Cell/Tissue List	HeLa; HepG2; H1A; H1B; A549; CD4T; GSC-11; HEK293T; HEK293A-TOA; MSC; TREX; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000546087.5; ENST00000535372.1
External Link	RMBase: m6A_site_741524
mod ID: M6ASITE078023		Click to Show/Hide the Full List
mod site	chr6:159761652-159761653:-		[8]
Sequence	AAGACTGGGGGGTGACAAAGACTTATCTCTCGTTCAGCTCA
Motif Score	3.319380952
Cell/Tissue List	HeLa; H1A; H1B
Seq Type List	m6A-seq
Transcript ID List	ENST00000535372.1; ENST00000546087.5
External Link	RMBase: m6A_site_741525
mod ID: M6ASITE078024		Click to Show/Hide the Full List
mod site	chr6:159761669-159761670:-		[8]
Sequence	GGTTTCTCGAAACAGTAAAGACTGGGGGGTGACAAAGACTT
Motif Score	3.319380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000546087.5; ENST00000535372.1
External Link	RMBase: m6A_site_741526
mod ID: M6ASITE078025		Click to Show/Hide the Full List
mod site	chr6:159761678-159761679:-		[8]
Sequence	AAATCTTAGGGTTTCTCGAAACAGTAAAGACTGGGGGGTGA
Motif Score	2.20572619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000535372.1; ENST00000546087.5
External Link	RMBase: m6A_site_741527
mod ID: M6ASITE078026		Click to Show/Hide the Full List
mod site	chr6:159761999-159762000:-		[8]
Sequence	ACAGGCCTGCCGCGGGCGGGACCTGAGGTAGCCCCGCCCCT
Motif Score	3.622404762
Cell/Tissue List	HeLa; H1A; H1B; hESCs; A549; CD4T; HEK293T; HEK293A-TOA; MSC; TREX; endometrial
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000546087.5; ENST00000535372.1
External Link	RMBase: m6A_site_741529
mod ID: M6ASITE078027		Click to Show/Hide the Full List
mod site	chr6:159762170-159762171:-		[8]
Sequence	CGAAGCAGCAGGCGCCTCGGACTCTGCGCGGCTCCCGCCGG
Motif Score	4.065041667
Cell/Tissue List	HeLa; H1A; H1B; A549; peripheral-blood; HEK293A-TOA; iSLK; MSC; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000535372.1; ENST00000546087.5
External Link	RMBase: m6A_site_741531

Pseudouridine (Pseudo)

In total 1 m6A sequence/site(s) in this target gene
mod ID: PSESITE000247		Click to Show/Hide the Full List
mod site	chr6:159720529-159720530:-		[19]
Sequence	TTAACTTACTACCATCCTTTTCTTGGGGTTGCACTACTGTC
Transcript ID List	ENST00000535561.5; ENST00000545162.5; ENST00000401980.3; ENST00000546087.5; ENST00000516179.1; ENST00000537657.5
External Link	RMBase: Pseudo_site_4369

Ref 1	FTO promotes Bortezomib resistance via m6A-dependent destabilization of SOD2 expression in multiple myeloma. Cancer Gene Ther. 2022 Feb 10. doi: 10.1038/s41417-022-00429-6. Online ahead of print.
Ref 2	Genetic variants in N6-methyladenosine are associated with bladder cancer risk in the Chinese population. Arch Toxicol. 2021 Jan;95(1):299-309. doi: 10.1007/s00204-020-02911-2. Epub 2020 Sep 22.
Ref 3	GEMSTONE-301: a phase III clinical trial of CS1001 as consolidation therapy in patients with locally advanced/unresectable (stage III) non-small cell lung cancer (NSCLC) who did not have disease progression after prior concurrent/sequential chemoradiotherapy. Transl Lung Cancer Res. 2020 Oct;9(5):2008-2015. doi: 10.21037/tlcr-20-608.
Ref 4	Systematic identification of abundant A-to-I editing sites in the human transcriptome. Nat Biotechnol. 2004 Aug;22(8):1001-5. doi: 10.1038/nbt996. Epub 2004 Jul 18.
Ref 5	RADAR: a rigorously annotated database of A-to-I RNA editing. Nucleic Acids Res. 2014 Jan;42(Database issue):D109-13. doi: 10.1093/nar/gkt996. Epub 2013 Oct 25.
Ref 6	5-methylcytosine promotes mRNA export - NSUN2 as the methyltransferase and ALYREF as an m(5)C reader. Cell Res. 2017 May;27(5):606-625. doi: 10.1038/cr.2017.55. Epub 2017 Apr 18.
Ref 7	N6-Methyladenosine in Flaviviridae Viral RNA Genomes Regulates Infection. Cell Host Microbe. 2016 Nov 9;20(5):654-665. doi: 10.1016/j.chom.2016.09.015. Epub 2016 Oct 20.
Ref 8	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 9	DART-seq: an antibody-free method for global m(6)A detection. Nat Methods. 2019 Dec;16(12):1275-1280. doi: 10.1038/s41592-019-0570-0. Epub 2019 Sep 23.
Ref 10	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.
Ref 11	Dynamics of the human and viral m(6)A RNA methylomes during HIV-1 infection of T cells. Nat Microbiol. 2016 Feb 22;1:16011. doi: 10.1038/nmicrobiol.2016.11.
Ref 12	m(6)A mRNA methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer. Nat Cell Biol. 2018 Sep;20(9):1074-1083. doi: 10.1038/s41556-018-0174-4. Epub 2018 Aug 27.
Ref 13	N(6)-methyladenosine of HIV-1 RNA regulates viral infection and HIV-1 Gag protein expression. Elife. 2016 Jul 2;5:e15528. doi: 10.7554/eLife.15528.
Ref 14	Viral N(6)-methyladenosine upregulates replication and pathogenesis of human respiratory syncytial virus. Nat Commun. 2019 Oct 9;10(1):4595. doi: 10.1038/s41467-019-12504-y.
Ref 15	The U6 snRNA m(6)A Methyltransferase METTL16 Regulates SAM Synthetase Intron Retention. Cell. 2017 May 18;169(5):824-835.e14. doi: 10.1016/j.cell.2017.05.003.
Ref 16	Single-base mapping of m(6)A by an antibody-independent method. Sci Adv. 2019 Jul 3;5(7):eaax0250. doi: 10.1126/sciadv.aax0250. eCollection 2019 Jul.
Ref 17	Structure and thermodynamics of N6-methyladenosine in RNA: a spring-loaded base modification. J Am Chem Soc. 2015 Feb 11;137(5):2107-15. doi: 10.1021/ja513080v. Epub 2015 Feb 2.
Ref 18	Comprehensive analysis of mRNA methylation reveals enrichment in 3' UTRs and near stop codons. Cell. 2012 Jun 22;149(7):1635-46. doi: 10.1016/j.cell.2012.05.003. Epub 2012 May 17.
Ref 19	snoRNA-LBME-db, a comprehensive database of human H/ACA and C/D box snoRNAs. Nucleic Acids Res. 2006 Jan 1;34(Database issue):D158-62. doi: 10.1093/nar/gkj002.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map