m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00389)

Target Name	Translocation protein SEC62 (SEC62)
Synonyms	Translocation protein 1; TP-1; hTP-1; TLOC1 Click to Show/Hide
Gene Name	SEC62
Chromosomal Location	3q26.2
Family	SEC62 family
Function	Mediates post-translational transport of precursor polypeptides across endoplasmic reticulum (ER). Proposed to act as a targeting receptor for small presecretory proteins containing short and apolar signal peptides. Targets and properly positions newly synthesized presecretory proteins into the SEC61 channel-forming translocon complex, triggering channel opening for polypeptide translocation to the ER lumen. Click to Show/Hide
Gene ID	7095
Uniprot ID	SEC62_HUMAN
HGNC ID	HGNC:11846
KEGG ID	hsa:7095

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

SEC62 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Browse Drug

Methyltransferase-like 3 (METTL3) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by METTL3*
Cell Line	CT26 cell line	Mus musculus
Treatment: METTL3 knockout CT26 cells Control: CT26 cells		GSE142589
Regulation		logFC: -8.61E-01 p-value: 1.21E-03
More Results	Click to View More RNA-seq Results
*Representative RIP-seq result supporting the interaction between SEC62 and the regulator*
Cell Line	MDA-MB-231	Homo sapiens
Regulation	logFC: 1.99E+00	GSE60213

In total 3 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	MiR-4429 prevented gastric cancer progression through targeting METTL3 to inhibit m6A-caused stabilization of Translocation protein SEC62 (SEC62), indicating miR-4429 as a promising target for treatment improvement for Gastric cancer. METTL3 interacted with SEC62 to induce the m6A on SEC62 mRNA, therefore facilitated the stabilizing effect of IGF2BP1 on SEC62 mRNA.
Target Regulation	Up regulation
Responsed Disease	Gastric cancer		ICD-11: 2B72	Disease Info
Pathway Response	Protein processing in endoplasmic reticulum			hsa04141
Cell Process	RNA stability
Cell Process	Cell apoptosis
In-vitro Model	GES-1	Normal	Homo sapiens	CVCL_EQ22
	HGC-27	Gastric carcinoma	Homo sapiens	CVCL_1279
	MGC-803	Gastric mucinous adenocarcinoma	Homo sapiens	CVCL_5334
	MKN45	Gastric adenocarcinoma	Homo sapiens	CVCL_0434
	MKN45	Gastric adenocarcinoma	Homo sapiens	CVCL_0434
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene				[2]
Response Summary	Translocation protein SEC62 (SEC62) upregulated by the METTL3-mediated m6A modification promotes the stemness and chemoresistance of colorectal cancer by binding to beta-catenin and enhancing Wnt signalling. Depletion of Sec62 sensitized the CRC cells to 5-Fu or oxaliplatin treatment.
Target Regulation	Up regulation
Responsed Disease	Colorectal cancer		ICD-11: 2B91	Disease Info
Responsed Drug	Fluorouracil		Approved	Drug Info
Pathway Response	Wnt signaling pathway			hsa04310
Cell Process	Protein degradation
In-vitro Model	DLD-1	Colon adenocarcinoma	Homo sapiens	CVCL_0248
In-vitro Model	HT29	Colon cancer	Mus musculus	CVCL_A8EZ
In-vivo Model	DLD-1 cells were subcutaneously implanted into 4-6 weeks old female nude mice. When tumors reached a size of about 50 mm³, the nude mice were randomly divided into 6 groups.
Experiment 3 Reporting the m6A Methylation Regulator of This Target Gene				[2]
Response Summary	Translocation protein SEC62 (SEC62) upregulated by the METTL3-mediated m6A modification promotes the stemness and chemoresistance of colorectal cancer by binding to beta-catenin and enhancing Wnt signalling. Depletion of Sec62 sensitized the CRC cells to 5-Fu or oxaliplatin treatment.
Target Regulation	Up regulation
Responsed Disease	Colorectal cancer		ICD-11: 2B91	Disease Info
Responsed Drug	Oxaliplatin		Approved	Drug Info
Pathway Response	Wnt signaling pathway			hsa04310
Cell Process	Protein degradation
In-vitro Model	DLD-1	Colon adenocarcinoma	Homo sapiens	CVCL_0248
In-vitro Model	HT29	Colon cancer	Mus musculus	CVCL_A8EZ
In-vivo Model	DLD-1 cells were subcutaneously implanted into 4-6 weeks old female nude mice. When tumors reached a size of about 50 mm³, the nude mice were randomly divided into 6 groups.

Insulin-like growth factor 2 mRNA-binding protein 1 (IGF2BP1) [READER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by IGF2BP1*
Cell Line	HepG2 cell line	Homo sapiens
Treatment: siIGF2BP1 HepG2 cells Control: siControl HepG2 cells		GSE161086
Regulation		logFC: -8.16E-01 p-value: 3.16E-03
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	MiR-4429 prevented gastric cancer progression through targeting METTL3 to inhibit m6A-caused stabilization of Translocation protein SEC62 (SEC62), indicating miR-4429 as a promising target for treatment improvement for Gastric cancer. METTL3 interacted with SEC62 to induce the m6A on SEC62 mRNA, therefore facilitated the stabilizing effect of IGF2BP1 on SEC62 mRNA.
Target Regulation	Up regulation
Responsed Disease	Gastric cancer		ICD-11: 2B72	Disease Info
Pathway Response	Protein processing in endoplasmic reticulum			hsa04141
Cell Process	RNA stability
Cell Process	Cell apoptosis
In-vitro Model	GES-1	Normal	Homo sapiens	CVCL_EQ22
	HGC-27	Gastric carcinoma	Homo sapiens	CVCL_1279
	MGC-803	Gastric mucinous adenocarcinoma	Homo sapiens	CVCL_5334
	MKN45	Gastric adenocarcinoma	Homo sapiens	CVCL_0434
	MKN45	Gastric adenocarcinoma	Homo sapiens	CVCL_0434

Gastric cancer [ICD-11: 2B72]

Disease Info

In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	MiR-4429 prevented gastric cancer progression through targeting METTL3 to inhibit m6A-caused stabilization of Translocation protein SEC62 (SEC62), indicating miR-4429 as a promising target for treatment improvement for Gastric cancer. METTL3 interacted with SEC62 to induce the m6A on SEC62 mRNA, therefore facilitated the stabilizing effect of IGF2BP1 on SEC62 mRNA.
Responsed Disease	Gastric cancer [ICD-11: 2B72]
Target Regulator	Insulin-like growth factor 2 mRNA-binding protein 1 (IGF2BP1)		READER	Regulator Info
Target Regulation	Up regulation
Pathway Response	Protein processing in endoplasmic reticulum			hsa04141
Cell Process	RNA stability
Cell Process	Cell apoptosis
In-vitro Model	GES-1	Normal	Homo sapiens	CVCL_EQ22
	HGC-27	Gastric carcinoma	Homo sapiens	CVCL_1279
	MGC-803	Gastric mucinous adenocarcinoma	Homo sapiens	CVCL_5334
	MKN45	Gastric adenocarcinoma	Homo sapiens	CVCL_0434
	MKN45	Gastric adenocarcinoma	Homo sapiens	CVCL_0434
Experiment 2 Reporting the m6A-centered Disease Response				[1]
Response Summary	MiR-4429 prevented gastric cancer progression through targeting METTL3 to inhibit m6A-caused stabilization of Translocation protein SEC62 (SEC62), indicating miR-4429 as a promising target for treatment improvement for Gastric cancer. METTL3 interacted with SEC62 to induce the m6A on SEC62 mRNA, therefore facilitated the stabilizing effect of IGF2BP1 on SEC62 mRNA.
Responsed Disease	Gastric cancer [ICD-11: 2B72]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Pathway Response	Protein processing in endoplasmic reticulum			hsa04141
Cell Process	RNA stability
Cell Process	Cell apoptosis
In-vitro Model	GES-1	Normal	Homo sapiens	CVCL_EQ22
	HGC-27	Gastric carcinoma	Homo sapiens	CVCL_1279
	MGC-803	Gastric mucinous adenocarcinoma	Homo sapiens	CVCL_5334
	MKN45	Gastric adenocarcinoma	Homo sapiens	CVCL_0434
	MKN45	Gastric adenocarcinoma	Homo sapiens	CVCL_0434

Colorectal cancer [ICD-11: 2B91]

Disease Info

In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[2]
Response Summary	Translocation protein SEC62 (SEC62) upregulated by the METTL3-mediated m6A modification promotes the stemness and chemoresistance of colorectal cancer by binding to beta-catenin and enhancing Wnt signalling. Depletion of Sec62 sensitized the CRC cells to 5-Fu or oxaliplatin treatment.
Responsed Disease	Colorectal cancer [ICD-11: 2B91]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Responsed Drug	Fluorouracil		Approved	Drug Info
Pathway Response	Wnt signaling pathway			hsa04310
Cell Process	Protein degradation
In-vitro Model	DLD-1	Colon adenocarcinoma	Homo sapiens	CVCL_0248
	HT29	Colon cancer	Mus musculus	CVCL_A8EZ
In-vivo Model	DLD-1 cells were subcutaneously implanted into 4-6 weeks old female nude mice. When tumors reached a size of about 50 mm³, the nude mice were randomly divided into 6 groups.
Experiment 2 Reporting the m6A-centered Disease Response				[2]
Response Summary	Translocation protein SEC62 (SEC62) upregulated by the METTL3-mediated m6A modification promotes the stemness and chemoresistance of colorectal cancer by binding to beta-catenin and enhancing Wnt signalling. Depletion of Sec62 sensitized the CRC cells to 5-Fu or oxaliplatin treatment.
Responsed Disease	Colorectal cancer [ICD-11: 2B91]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Responsed Drug	Oxaliplatin		Approved	Drug Info
Pathway Response	Wnt signaling pathway			hsa04310
Cell Process	Protein degradation
In-vitro Model	DLD-1	Colon adenocarcinoma	Homo sapiens	CVCL_0248
	HT29	Colon cancer	Mus musculus	CVCL_A8EZ
In-vivo Model	DLD-1 cells were subcutaneously implanted into 4-6 weeks old female nude mice. When tumors reached a size of about 50 mm³, the nude mice were randomly divided into 6 groups.

Fluorouracil [Approved]

Drug Info

In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response				[2]
Response Summary	Translocation protein SEC62 (SEC62) upregulated by the METTL3-mediated m6A modification promotes the stemness and chemoresistance of colorectal cancer by binding to beta-catenin and enhancing Wnt signalling. Depletion of Sec62 sensitized the CRC cells to 5-Fu or oxaliplatin treatment.
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Responsed Disease	Colorectal cancer		ICD-11: 2B91	Disease Info
Pathway Response	Wnt signaling pathway			hsa04310
Cell Process	Protein degradation
In-vitro Model	DLD-1	Colon adenocarcinoma	Homo sapiens	CVCL_0248
In-vitro Model	HT29	Colon cancer	Mus musculus	CVCL_A8EZ
In-vivo Model	DLD-1 cells were subcutaneously implanted into 4-6 weeks old female nude mice. When tumors reached a size of about 50 mm³, the nude mice were randomly divided into 6 groups.

Oxaliplatin [Approved]

Drug Info

In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response				[2]
Response Summary	Translocation protein SEC62 (SEC62) upregulated by the METTL3-mediated m6A modification promotes the stemness and chemoresistance of colorectal cancer by binding to beta-catenin and enhancing Wnt signalling. Depletion of Sec62 sensitized the CRC cells to 5-Fu or oxaliplatin treatment.
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Responsed Disease	Colorectal cancer		ICD-11: 2B91	Disease Info
Pathway Response	Wnt signaling pathway			hsa04310
Cell Process	Protein degradation
In-vitro Model	DLD-1	Colon adenocarcinoma	Homo sapiens	CVCL_0248
In-vitro Model	HT29	Colon cancer	Mus musculus	CVCL_A8EZ
In-vivo Model	DLD-1 cells were subcutaneously implanted into 4-6 weeks old female nude mice. When tumors reached a size of about 50 mm³, the nude mice were randomly divided into 6 groups.

Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator

Histone modification

m6A Regulator: Methyltransferase-like 3 (METTL3)

Regulator Info

In total 5 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03557		Crosstalk Info
Epigenetic Regulator	Histone acetyltransferase p300 (P300)
Regulated Target	Histone H3 lysine 27 acetylation (H3K27ac)
Crosstalk relationship	Histone modification → m6A
Disease	Colorectal cancer	Disease Info
Drug	Oxaliplatin	Drug Info
Crosstalk ID: M6ACROT03558		Crosstalk Info
Epigenetic Regulator	Histone acetyltransferase p300 (P300)
Regulated Target	Histone H3 lysine 27 acetylation (H3K27ac)
Crosstalk relationship	Histone modification → m6A
Disease	Colorectal cancer	Disease Info
Drug	Fluorouracil	Drug Info
Crosstalk ID: M6ACROT03602		Crosstalk Info
Epigenetic Regulator	N-lysine methyltransferase SMYD2 (SMYD2)
Regulated Target	Histone H3 lysine 4 trimethylation (H3K4me3)
Crosstalk relationship	Histone modification → m6A
Disease	Colorectal cancer	Disease Info
Drug	Oxaliplatin	Drug Info
Crosstalk ID: M6ACROT03603		Crosstalk Info
Epigenetic Regulator	N-lysine methyltransferase SMYD2 (SMYD2)
Regulated Target	Histone H3 lysine 4 trimethylation (H3K4me3)
Crosstalk relationship	Histone modification → m6A
Disease	Colorectal cancer	Disease Info
Drug	Fluorouracil	Drug Info
Crosstalk ID: M6ACROT03644		Crosstalk Info
Epigenetic Regulator	Histone-lysine N-methyltransferase EZH2 (EZH2)
Regulated Target	Histone H3 lysine 27 trimethylation (H3K27me3)
Crosstalk relationship	Histone modification → m6A
Disease	Gastric cancer	Disease Info

Non-coding RNA

m6A Regulator: Methyltransferase-like 3 (METTL3)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05312		Crosstalk Info
Epigenetic Regulator	hsa-miR-4429
Regulated Target	Methyltransferase-like protein 3 (METTL3)
Crosstalk relationship	ncRNA → m6A
Disease	Gastric cancer	Disease Info

m6A Regulator: Insulin-like growth factor 2 mRNA-binding protein 1 (IGF2BP1)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05313		Crosstalk Info
Epigenetic Regulator	hsa-miR-4429
Regulated Target	Methyltransferase-like protein 3 (METTL3)
Crosstalk relationship	ncRNA → m6A
Disease	Gastric cancer	Disease Info

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00389)

Translocation protein SEC62 (SEC62)

Adenosine-to-Inosine editing (A-to-I)

In total 21 m6A sequence/site(s) in this target gene
mod ID: A2ISITE000097		Click to Show/Hide the Full List
mod site	chr3:169969557-169969558:+		[3]
Sequence	AACATGAAAGCAGAGTGGTGATCCTACAGCTGACTGATCTC
Transcript ID List	ENST00000480708.5; ENST00000337002.9; ENST00000469515.6; ENST00000460513.5; ENST00000481435.5; ENST00000487736.5
External Link	RMBase: RNA-editing_site_101021
mod ID: A2ISITE000098		Click to Show/Hide the Full List
mod site	chr3:169970246-169970247:+		[3]
Sequence	TAGTGTTATTTGTGTAGCACATATTGTTACTAATGATTAAG
Transcript ID List	ENST00000481435.5; ENST00000480708.5; ENST00000337002.9; ENST00000460513.5; ENST00000487736.5; ENST00000469515.6
External Link	RMBase: RNA-editing_site_101022
mod ID: A2ISITE000099		Click to Show/Hide the Full List
mod site	chr3:169971121-169971122:+		[3]
Sequence	ACTGTGGTGCCCAGGCTGGAATGCAGTGATGGCATCATAGC
Transcript ID List	ENST00000481435.5; ENST00000480708.5; ENST00000337002.9; ENST00000469515.6; ENST00000460513.5; ENST00000487736.5
External Link	RMBase: RNA-editing_site_101023
mod ID: A2ISITE000100		Click to Show/Hide the Full List
mod site	chr3:169971147-169971148:+		[3]
Sequence	TGATGGCATCATAGCTCACTAGAGACTCAAACTCCTGGTCT
Transcript ID List	ENST00000481435.5; ENST00000480708.5; ENST00000487736.5; ENST00000337002.9; ENST00000460513.5; ENST00000469515.6
External Link	RMBase: RNA-editing_site_101024
mod ID: A2ISITE000101		Click to Show/Hide the Full List
mod site	chr3:169971209-169971210:+		[3]
Sequence	CCTCCCAACTAGCTGGGACTACAAGTGTGTGCACCACCTCA
Transcript ID List	ENST00000337002.9; ENST00000481435.5; ENST00000480708.5; ENST00000487736.5; ENST00000460513.5; ENST00000469515.6
External Link	RMBase: RNA-editing_site_101025
mod ID: A2ISITE000102		Click to Show/Hide the Full List
mod site	chr3:169971212-169971213:+		[3]
Sequence	CCCAACTAGCTGGGACTACAAGTGTGTGCACCACCTCACCT
Transcript ID List	ENST00000469515.6; ENST00000337002.9; ENST00000487736.5; ENST00000460513.5; ENST00000480708.5; ENST00000481435.5
External Link	RMBase: RNA-editing_site_101026
mod ID: A2ISITE000103		Click to Show/Hide the Full List
mod site	chr3:169971294-169971295:+		[3]
Sequence	AAGTTACCTAGGCTGGTCTTAAACTCCTGGTCTCATGCGAT
Transcript ID List	ENST00000460513.5; ENST00000480708.5; ENST00000487736.5; ENST00000469515.6; ENST00000481435.5; ENST00000337002.9
External Link	RMBase: RNA-editing_site_101027
mod ID: A2ISITE000104		Click to Show/Hide the Full List
mod site	chr3:169972514-169972515:+		[4]
Sequence	GCCTCAACCTACCAGGGCTCAGGTGGTCTTCCTACCTCAGC
Transcript ID List	ENST00000337002.9; ENST00000480708.5; ENST00000469515.6; ENST00000460513.5; ENST00000487736.5; ENST00000481435.5
External Link	RMBase: RNA-editing_site_101028
mod ID: A2ISITE000105		Click to Show/Hide the Full List
mod site	chr3:169972609-169972610:+		[3]
Sequence	TTTTTTTTTTTATGTAGAGAAGGAGTTTCACCATGTTGCCC
Transcript ID List	ENST00000337002.9; ENST00000487736.5; ENST00000480708.5; ENST00000469515.6; ENST00000481435.5; ENST00000460513.5
External Link	RMBase: RNA-editing_site_101029
mod ID: A2ISITE000106		Click to Show/Hide the Full List
mod site	chr3:169972661-169972662:+		[4]
Sequence	AAGCCTGGTTTCCTGGGCTCAAGCAGTCTGCCTGCCTCAGC
Transcript ID List	ENST00000480708.5; ENST00000487736.5; ENST00000469515.6; ENST00000481435.5; ENST00000337002.9; ENST00000460513.5
External Link	RMBase: RNA-editing_site_101030
mod ID: A2ISITE000107		Click to Show/Hide the Full List
mod site	chr3:169972863-169972864:+		[3]
Sequence	AACTGTAGCATCCAAAGATGATAGGGTGAGTACTCTGTAAG
Transcript ID List	ENST00000481435.5; ENST00000460513.5; ENST00000480708.5; ENST00000337002.9; ENST00000487736.5; ENST00000469515.6
External Link	RMBase: RNA-editing_site_101031
mod ID: A2ISITE000108		Click to Show/Hide the Full List
mod site	chr3:169973482-169973483:+		[5]
Sequence	ACCAGCCTGGCTAACATGGTAAAATCCCATCCCTACAAAAA
Transcript ID List	ENST00000480708.5; ENST00000460513.5; ENST00000487736.5; ENST00000469515.6; rmsk_1162923; ENST00000337002.9; ENST00000481435.5
External Link	RMBase: RNA-editing_site_101032
mod ID: A2ISITE000109		Click to Show/Hide the Full List
mod site	chr3:169974997-169974998:+		[6]
Sequence	GGCTTATAAAAAGAGACTATAGGCCGGTGACGATGGCTCAC
Transcript ID List	ENST00000487736.5; ENST00000460513.5; ENST00000337002.9; ENST00000469515.6; ENST00000481435.5; ENST00000480708.5
External Link	RMBase: RNA-editing_site_101033
mod ID: A2ISITE000110		Click to Show/Hide the Full List
mod site	chr3:169975060-169975061:+		[3]
Sequence	GAGGCCTAGGCTGGCGGATCACTTGAGGTCAGGAGTTCAAG
Transcript ID List	ENST00000469515.6; rmsk_1162925; ENST00000487736.5; ENST00000460513.5; ENST00000337002.9; ENST00000481435.5; ENST00000480708.5
External Link	RMBase: RNA-editing_site_101034
mod ID: A2ISITE000111		Click to Show/Hide the Full List
mod site	chr3:169986770-169986771:+		[4]
Sequence	GGGTCTCATTCCTGTCACCCAGGCTGGAATGCAATGGCACA
Transcript ID List	ENST00000337002.9; ENST00000469515.6; ENST00000480708.5; ENST00000470355.1
External Link	RMBase: RNA-editing_site_101035
mod ID: A2ISITE000112		Click to Show/Hide the Full List
mod site	chr3:169986825-169986826:+		[5]
Sequence	CAGCCCGACTTGCTGGGGTCAGGTGATCTCCCACATCAGCC
Transcript ID List	ENST00000470355.1; ENST00000337002.9; ENST00000469515.6; ENST00000480708.5
External Link	RMBase: RNA-editing_site_101036
mod ID: A2ISITE000113		Click to Show/Hide the Full List
mod site	chr3:169986864-169986865:+		[4]
Sequence	CCTACTGAGTAGCTGGAACTATAGGCACACTCCACTACACC
Transcript ID List	ENST00000470355.1; ENST00000469515.6; ENST00000480708.5; ENST00000337002.9
External Link	RMBase: RNA-editing_site_101037
mod ID: A2ISITE000114		Click to Show/Hide the Full List
mod site	chr3:169986866-169986867:+		[4]
Sequence	TACTGAGTAGCTGGAACTATAGGCACACTCCACTACACCCC
Transcript ID List	ENST00000480708.5; ENST00000469515.6; ENST00000470355.1; ENST00000337002.9
External Link	RMBase: RNA-editing_site_101038
mod ID: A2ISITE000115		Click to Show/Hide the Full List
mod site	chr3:169987235-169987236:+		[5]
Sequence	CAAGGGTTCGAAACCAGCCTAGGCAACATGGCGAAACCTCG
Transcript ID List	ENST00000480708.5; ENST00000470355.1; ENST00000469515.6; ENST00000337002.9; rmsk_1162943
External Link	RMBase: RNA-editing_site_101039
mod ID: A2ISITE000116		Click to Show/Hide the Full List
mod site	chr3:169991306-169991307:+		[4]
Sequence	TGACTCACAACTGCGATCCCAACTACTCGGGAGGCTGAGGT
Transcript ID List	rmsk_1162952; ENST00000337002.9; ENST00000480708.5; ENST00000470355.1
External Link	RMBase: RNA-editing_site_101040
mod ID: A2ISITE000117		Click to Show/Hide the Full List
mod site	chr3:169991307-169991308:+		[4]
Sequence	GACTCACAACTGCGATCCCAACTACTCGGGAGGCTGAGGTG
Transcript ID List	ENST00000337002.9; rmsk_1162952; ENST00000480708.5; ENST00000470355.1
External Link	RMBase: RNA-editing_site_101041

N6-methyladenosine (m6A)

In total 108 m6A sequence/site(s) in this target gene
mod ID: M6ASITE062975		Click to Show/Hide the Full List
mod site	chr3:169966803-169966804:+		[7]
Sequence	CTCGCTCCACGTCAGAGGGAACCGGGCGGAGCGGCCAACAT
Motif Score	2.930744048
Cell/Tissue List	HeLa; CD34; H1B; hESCs; HEK293A-TOA; MSC; TIME; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000460513.5; ENST00000461933.1
External Link	RMBase: m6A_site_617680
mod ID: M6ASITE062976		Click to Show/Hide the Full List
mod site	chr3:169966839-169966840:+		[7]
Sequence	AACATGGCGGAACGCAGGAGACACAAGAAGCGGATCCAGGT
Motif Score	2.897386905
Cell/Tissue List	HeLa; CD34; H1B; hESCs; HEK293A-TOA; MSC; TIME; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000460513.5; ENST00000469515.6; ENST00000461933.1; ENST00000337002.9; ENST00000481435.5; ENST00000487736.5; ENST00000480708.5
External Link	RMBase: m6A_site_617681
mod ID: M6ASITE062977		Click to Show/Hide the Full List
mod site	chr3:169968421-169968422:+		[7]
Sequence	GACAGTGGCAGAGAGCTAAAACTTGAGCCAAACTGCCTGTT
Motif Score	2.627720238
Cell/Tissue List	HeLa; CD34; H1B; hESCs; HEK293A-TOA; TIME; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000481435.5; ENST00000480708.5; ENST00000337002.9; rmsk_1162917; ENST00000487736.5; ENST00000460513.5; ENST00000469515.6; ENST00000461933.1
External Link	RMBase: m6A_site_617682
mod ID: M6ASITE062978		Click to Show/Hide the Full List
mod site	chr3:169968432-169968433:+		[7]
Sequence	AGAGCTAAAACTTGAGCCAAACTGCCTGTTTGTACCCCACC
Motif Score	2.627720238
Cell/Tissue List	HeLa; CD34; HEK293A-TOA; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000461933.1; ENST00000480708.5; ENST00000337002.9; ENST00000481435.5; ENST00000469515.6; ENST00000487736.5; ENST00000460513.5; rmsk_1162917
External Link	RMBase: m6A_site_617683
mod ID: M6ASITE062979		Click to Show/Hide the Full List
mod site	chr3:169975618-169975619:+		[8]
Sequence	ATGTTGCAGGAAGTTGGTGAACCATCTAAAGAAGAGAAGGC
Motif Score	2.930744048
Cell/Tissue List	CD34; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000480708.5; ENST00000487736.5; ENST00000481435.5; ENST00000497277.1; ENST00000460513.5; ENST00000469515.6; ENST00000337002.9
External Link	RMBase: m6A_site_617684
mod ID: M6ASITE062980		Click to Show/Hide the Full List
mod site	chr3:169975662-169975663:+		[9]
Sequence	GGCCAAGTATCTTCGATTCAACTGTCCAACAAAGTCCACCA
Motif Score	2.595904762
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000480708.5; ENST00000469515.6; ENST00000337002.9; ENST00000497277.1; ENST00000487736.5; ENST00000481435.5; ENST00000460513.5
External Link	RMBase: m6A_site_617685
mod ID: M6ASITE062981		Click to Show/Hide the Full List
mod site	chr3:169975670-169975671:+		[10]
Sequence	ATCTTCGATTCAACTGTCCAACAAAGTCCACCAATATGATG
Motif Score	2.173910714
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000480708.5; ENST00000469515.6; ENST00000460513.5; ENST00000487736.5; ENST00000337002.9; ENST00000497277.1; ENST00000481435.5
External Link	RMBase: m6A_site_617686
mod ID: M6ASITE062982		Click to Show/Hide the Full List
mod site	chr3:169976960-169976961:+		[7]
Sequence	TTTAGCTTCAAAAGCAGTGGACTGTCTTTTGGATTCAAAGT
Motif Score	4.065041667
Cell/Tissue List	HeLa; CD34; BGC823; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000497277.1; ENST00000487736.5; ENST00000469515.6; ENST00000460513.5; ENST00000481435.5; ENST00000480708.5; ENST00000337002.9
External Link	RMBase: m6A_site_617687
mod ID: M6ASITE062983		Click to Show/Hide the Full List
mod site	chr3:169977016-169977017:+		[10]
Sequence	AAGGAGAGGAAGCTTTATTTACAACCAGGGAGTCTGTGGTT
Motif Score	2.07285119
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000460513.5; ENST00000487736.5; ENST00000337002.9; ENST00000480708.5; ENST00000497277.1; ENST00000481435.5; ENST00000469515.6
External Link	RMBase: m6A_site_617688
mod ID: M6ASITE062984		Click to Show/Hide the Full List
mod site	chr3:169977038-169977039:+		[9]
Sequence	AACCAGGGAGTCTGTGGTTGACTACTGCAACAGGTACTGTT
Motif Score	3.28175
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000497277.1; ENST00000481435.5; ENST00000460513.5; ENST00000337002.9; ENST00000487736.5; ENST00000469515.6; ENST00000480708.5
External Link	RMBase: m6A_site_617689
mod ID: M6ASITE062985		Click to Show/Hide the Full List
mod site	chr3:169982768-169982769:+		[7]
Sequence	GAAAATGAAATATGATAAAGACATAAAGAAAGAAAAAGATA
Motif Score	2.897386905
Cell/Tissue List	HeLa; CD34; HEK293T; hESC-HEK293T; BGC823; hNPCs; hESCs; fibroblasts; A549; LCLs; Huh7
Seq Type List	m6A-seq; MeRIP-seq; MAZTER-seq
Transcript ID List	ENST00000480708.5; ENST00000481435.5; ENST00000469515.6; ENST00000460513.5; ENST00000487736.5; ENST00000337002.9; rmsk_1162935; ENST00000497277.1
External Link	RMBase: m6A_site_617690
mod ID: M6ASITE062986		Click to Show/Hide the Full List
mod site	chr3:169982857-169982858:+		[7]
Sequence	AAAATATAAAGGATGAGAAGACAAAAAAAGAAAAAGAGAAA
Motif Score	2.897386905
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; hESC-HEK293T; BGC823; hNPCs; hESCs; fibroblasts; A549; LCLs; MM6; Huh7; Jurkat; GSCs
Seq Type List	m6A-seq; MeRIP-seq; DART-seq; MAZTER-seq
Transcript ID List	ENST00000497277.1; ENST00000460513.5; ENST00000469515.6; ENST00000337002.9; ENST00000480708.5; ENST00000481435.5; rmsk_1162935
External Link	RMBase: m6A_site_617691
mod ID: M6ASITE062987		Click to Show/Hide the Full List
mod site	chr3:169983166-169983167:+		[7]
Sequence	TTGTGTTTTCATAGGAGGAAACTCCAGGAACTCCTAAAAAG
Motif Score	2.627720238
Cell/Tissue List	HeLa; HepG2; HEK293T; hNPCs; fibroblasts; A549; LCLs; MM6; Huh7; Jurkat; endometrial; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000460513.5; ENST00000480708.5; ENST00000481435.5; ENST00000469890.1; ENST00000469515.6; ENST00000337002.9
External Link	RMBase: m6A_site_617692
mod ID: M6ASITE062988		Click to Show/Hide the Full List
mod site	chr3:169983175-169983176:+		[7]
Sequence	CATAGGAGGAAACTCCAGGAACTCCTAAAAAGAAGGAAACT
Motif Score	3.373380952
Cell/Tissue List	HeLa; HepG2; HEK293T; hNPCs; fibroblasts; A549; LCLs; MM6; Huh7; Jurkat; endometrial; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000337002.9; ENST00000481435.5; ENST00000469515.6; ENST00000480708.5; ENST00000460513.5; ENST00000469890.1
External Link	RMBase: m6A_site_617693
mod ID: M6ASITE062989		Click to Show/Hide the Full List
mod site	chr3:169983193-169983194:+		[11]
Sequence	GAACTCCTAAAAAGAAGGAAACTAAGAAAAAATTCAAACTT
Motif Score	2.627720238
Cell/Tissue List	HepG2; HEK293T; hNPCs; A549; LCLs; MM6; Huh7; Jurkat; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000469890.1; ENST00000481435.5; ENST00000469515.6; ENST00000337002.9; ENST00000480708.5; ENST00000460513.5
External Link	RMBase: m6A_site_617694
mod ID: M6ASITE062990		Click to Show/Hide the Full List
mod site	chr3:169983210-169983211:+		[11]
Sequence	GAAACTAAGAAAAAATTCAAACTTGAGCCACATGATGATCA
Motif Score	2.627720238
Cell/Tissue List	HepG2; HEK293T; hNPCs; A549; LCLs; MM6; Huh7; Jurkat; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000460513.5; ENST00000469890.1; ENST00000481435.5; ENST00000469515.6; ENST00000480708.5; ENST00000337002.9
External Link	RMBase: m6A_site_617695
mod ID: M6ASITE062991		Click to Show/Hide the Full List
mod site	chr3:169983219-169983220:+		[10]
Sequence	AAAAAATTCAAACTTGAGCCACATGATGATCAGGTTTTTCT
Motif Score	2.053113095
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000469890.1; ENST00000480708.5; ENST00000337002.9; ENST00000460513.5; ENST00000481435.5; ENST00000469515.6
External Link	RMBase: m6A_site_617696
mod ID: M6ASITE062992		Click to Show/Hide the Full List
mod site	chr3:169985158-169985159:+		[7]
Sequence	TAACTGCGCTTTTATCCCAGACTGGTTCATCATTACATTAG
Motif Score	3.319380952
Cell/Tissue List	HeLa; GM12878
Seq Type List	m6A-seq
Transcript ID List	ENST00000480708.5; ENST00000337002.9; ENST00000469515.6; ENST00000481435.5; ENST00000470355.1
External Link	RMBase: m6A_site_617697
mod ID: M6ASITE062993		Click to Show/Hide the Full List
mod site	chr3:169985181-169985182:+		[7]
Sequence	GGTTCATCATTACATTAGGGACAAAAAGGTTGGCAGTTGCT
Motif Score	3.643047619
Cell/Tissue List	HeLa; GM12878
Seq Type List	m6A-seq
Transcript ID List	ENST00000470355.1; ENST00000469515.6; ENST00000337002.9; ENST00000480708.5; ENST00000481435.5
External Link	RMBase: m6A_site_617698
mod ID: M6ASITE062994		Click to Show/Hide the Full List
mod site	chr3:169985840-169985841:+		[7]
Sequence	ATGACCCAGTTCACTTTAAAACATTTGTCATGGGATTAATT
Motif Score	2.20572619
Cell/Tissue List	HeLa; HEK293T; hESC-HEK293T; GM12878; TIME
Seq Type List	m6A-seq; MeRIP-seq; MAZTER-seq
Transcript ID List	ENST00000480708.5; ENST00000469515.6; ENST00000481435.5; ENST00000470355.1; ENST00000337002.9
External Link	RMBase: m6A_site_617699
mod ID: M6ASITE062995		Click to Show/Hide the Full List
mod site	chr3:169992667-169992668:+		[12]
Sequence	TTTGGTTCTTGCCAAATCTGACTGCTGATGTGGGCTTCATT
Motif Score	3.28175
Cell/Tissue List	CD8T
Seq Type List	m6A-CLIP/IP
Transcript ID List	ENST00000337002.9; ENST00000480708.5; ENST00000470355.1
External Link	RMBase: m6A_site_617700
mod ID: M6ASITE062996		Click to Show/Hide the Full List
mod site	chr3:169992689-169992690:+		[13]
Sequence	TGCTGATGTGGGCTTCATTGACTCCTTCAGGCCTCTGTACA
Motif Score	3.28175
Cell/Tissue List	AML
Seq Type List	miCLIP
Transcript ID List	ENST00000480708.5; ENST00000337002.9; ENST00000470355.1
External Link	RMBase: m6A_site_617701
mod ID: M6ASITE062997		Click to Show/Hide the Full List
mod site	chr3:169992719-169992720:+		[10]
Sequence	GCCTCTGTACACACATGAATACAAAGGACCAAAAGCAGACT
Motif Score	2.110482143
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000480708.5; ENST00000337002.9; ENST00000470355.1
External Link	RMBase: m6A_site_617702
mod ID: M6ASITE062998		Click to Show/Hide the Full List
mod site	chr3:169992726-169992727:+		[7]
Sequence	TACACACATGAATACAAAGGACCAAAAGCAGACTTAAAGAA
Motif Score	3.622404762
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; CD8T; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4; AML
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP; miCLIP
Transcript ID List	ENST00000480708.5; ENST00000337002.9
External Link	RMBase: m6A_site_617703
mod ID: M6ASITE062999		Click to Show/Hide the Full List
mod site	chr3:169992737-169992738:+		[7]
Sequence	ATACAAAGGACCAAAAGCAGACTTAAAGAAAGATGAGAAGT
Motif Score	3.319380952
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List	ENST00000480708.5; ENST00000337002.9
External Link	RMBase: m6A_site_617704
mod ID: M6ASITE063000		Click to Show/Hide the Full List
mod site	chr3:169992763-169992764:+		[7]
Sequence	AGAAAGATGAGAAGTCTGAAACCAAAAAGCAACAGAAGTCC
Motif Score	2.185083333
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000337002.9; ENST00000480708.5
External Link	RMBase: m6A_site_617705
mod ID: M6ASITE063001		Click to Show/Hide the Full List
mod site	chr3:169992785-169992786:+		[14]
Sequence	CAAAAAGCAACAGAAGTCCGACAGTGAGGAAAAGTCAGACA
Motif Score	2.865571429
Cell/Tissue List	brain
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000480708.5; ENST00000337002.9
External Link	RMBase: m6A_site_617706
mod ID: M6ASITE063002		Click to Show/Hide the Full List
mod site	chr3:169992803-169992804:+		[7]
Sequence	CGACAGTGAGGAAAAGTCAGACAGTGAGAAAAAGGAAGATG
Motif Score	2.897386905
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; brain; liver; A549; hESC-HEK293T; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq; m6A-REF-seq; MAZTER-seq
Transcript ID List	ENST00000480708.5; ENST00000337002.9
External Link	RMBase: m6A_site_617707
mod ID: M6ASITE063003		Click to Show/Hide the Full List
mod site	chr3:169992840-169992841:+		[7]
Sequence	GATGAGGAGGGGAAAGTAGGACCAGGAAATCATGGAACAGA
Motif Score	3.622404762
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000480708.5; ENST00000337002.9
External Link	RMBase: m6A_site_617708
mod ID: M6ASITE063004		Click to Show/Hide the Full List
mod site	chr3:169992856-169992857:+		[7]
Sequence	TAGGACCAGGAAATCATGGAACAGAAGGCTCGGGGGGAGAA
Motif Score	2.951386905
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; brain; kidney; A549; hESC-HEK293T; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq; m6A-REF-seq; DART-seq; MAZTER-seq
Transcript ID List	ENST00000337002.9; ENST00000480708.5
External Link	RMBase: m6A_site_617709
mod ID: M6ASITE063005		Click to Show/Hide the Full List
mod site	chr3:169992887-169992888:+		[7]
Sequence	GGGGGGAGAACGGCATTCAGACACGGACAGTGACAGGAGGG
Motif Score	2.897386905
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; hESC-HEK293T; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq; DART-seq; MAZTER-seq
Transcript ID List	ENST00000337002.9; ENST00000480708.5
External Link	RMBase: m6A_site_617710
mod ID: M6ASITE063006		Click to Show/Hide the Full List
mod site	chr3:169992893-169992894:+		[7]
Sequence	AGAACGGCATTCAGACACGGACAGTGACAGGAGGGAAGATG
Motif Score	3.643047619
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; hESC-HEK293T; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; CD8T; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4; AML
Seq Type List	m6A-seq; MeRIP-seq; MAZTER-seq; m6A-CLIP/IP; miCLIP
Transcript ID List	ENST00000337002.9; ENST00000480708.5
External Link	RMBase: m6A_site_617711
mod ID: M6ASITE063007		Click to Show/Hide the Full List
mod site	chr3:169992899-169992900:+		[9]
Sequence	GCATTCAGACACGGACAGTGACAGGAGGGAAGATGATCGAT
Motif Score	2.859755952
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000337002.9; ENST00000480708.5
External Link	RMBase: m6A_site_617712
mod ID: M6ASITE063008		Click to Show/Hide the Full List
mod site	chr3:169992926-169992927:+		[9]
Sequence	GGAAGATGATCGATCCCAGCACAGTAGTGGAAATGGAAATG
Motif Score	2.830589286
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000337002.9; ENST00000480708.5
External Link	RMBase: m6A_site_617713
mod ID: M6ASITE063009		Click to Show/Hide the Full List
mod site	chr3:169992961-169992962:+		[10]
Sequence	GAAATGATTTTGAAATGATAACAAAAGAGGAACTGGAACAG
Motif Score	2.168095238
Cell/Tissue List	hESC-HEK293T; AML
Seq Type List	MAZTER-seq; miCLIP
Transcript ID List	ENST00000480708.5; ENST00000337002.9
External Link	RMBase: m6A_site_617714
mod ID: M6ASITE063010		Click to Show/Hide the Full List
mod site	chr3:169992972-169992973:+		[7]
Sequence	GAAATGATAACAAAAGAGGAACTGGAACAGCAAACAGATGG
Motif Score	3.373380952
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000480708.5; ENST00000337002.9
External Link	RMBase: m6A_site_617715
mod ID: M6ASITE063011		Click to Show/Hide the Full List
mod site	chr3:169992978-169992979:+		[7]
Sequence	ATAACAAAAGAGGAACTGGAACAGCAAACAGATGGGGATTG
Motif Score	2.951386905
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; hESC-HEK293T; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; CD8T; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq; DART-seq; MAZTER-seq; m6A-CLIP/IP
Transcript ID List	ENST00000337002.9; ENST00000480708.5
External Link	RMBase: m6A_site_617716
mod ID: M6ASITE063012		Click to Show/Hide the Full List
mod site	chr3:169992985-169992986:+		[7]
Sequence	AAGAGGAACTGGAACAGCAAACAGATGGGGATTGTGAAGAG
Motif Score	2.20572619
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; hESC-HEK293T; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; CD8T; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq; MAZTER-seq; m6A-CLIP/IP
Transcript ID List	ENST00000480708.5; ENST00000337002.9
External Link	RMBase: m6A_site_617717
mod ID: M6ASITE063013		Click to Show/Hide the Full List
mod site	chr3:169993033-169993034:+		[7]
Sequence	AAGAGGAAAATGATGGAGAAACACCTAAATCTTCACATGAA
Motif Score	2.20572619
Cell/Tissue List	HeLa; CD34; HepG2; HEK293T; A549; hESC-HEK293T; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq; MAZTER-seq
Transcript ID List	ENST00000337002.9; ENST00000480708.5
External Link	RMBase: m6A_site_617718
mod ID: M6ASITE063014		Click to Show/Hide the Full List
mod site	chr3:169993047-169993048:+		[10]
Sequence	GGAGAAACACCTAAATCTTCACATGAAAAATCATAATCTGA
Motif Score	2.047297619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000337002.9; ENST00000480708.5
External Link	RMBase: m6A_site_617719
mod ID: M6ASITE063015		Click to Show/Hide the Full List
mod site	chr3:169993067-169993068:+		[12]
Sequence	ACATGAAAAATCATAATCTGACTAATTTTGGGACTGAATGA
Motif Score	3.28175
Cell/Tissue List	A549
Seq Type List	m6A-CLIP/IP
Transcript ID List	ENST00000337002.9; ENST00000480708.5
External Link	RMBase: m6A_site_617720
mod ID: M6ASITE063016		Click to Show/Hide the Full List
mod site	chr3:169993079-169993080:+		[7]
Sequence	ATAATCTGACTAATTTTGGGACTGAATGAATAAGTACAAGA
Motif Score	4.065041667
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; CD8T; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4; AML
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP; miCLIP
Transcript ID List	ENST00000480708.5; ENST00000337002.9
External Link	RMBase: m6A_site_617721
mod ID: M6ASITE063017		Click to Show/Hide the Full List
mod site	chr3:169993094-169993095:+		[9]
Sequence	TTGGGACTGAATGAATAAGTACAAGAGGTTGGATTTTCTAT
Motif Score	2.856142857
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000480708.5; ENST00000337002.9
External Link	RMBase: m6A_site_617722
mod ID: M6ASITE063018		Click to Show/Hide the Full List
mod site	chr3:169993136-169993137:+		[7]
Sequence	TTGGCTGATTACCATATTGAACACATGGCATTTGTAGCATT
Motif Score	2.951386905
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; hESC-HEK293T; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4; AML
Seq Type List	m6A-seq; MeRIP-seq; MAZTER-seq; miCLIP
Transcript ID List	ENST00000480708.5; ENST00000337002.9
External Link	RMBase: m6A_site_617723
mod ID: M6ASITE063019		Click to Show/Hide the Full List
mod site	chr3:169993171-169993172:+		[9]
Sequence	AGCATTCTTTAAATCTATCTACTGAAATGTATTTGACATTC
Motif Score	2.500660714
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000480708.5; ENST00000337002.9
External Link	RMBase: m6A_site_617724
mod ID: M6ASITE063020		Click to Show/Hide the Full List
mod site	chr3:169993186-169993187:+		[9]
Sequence	TATCTACTGAAATGTATTTGACATTCAAGCAGTTATATTCG
Motif Score	2.859755952
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000337002.9; ENST00000480708.5
External Link	RMBase: m6A_site_617725
mod ID: M6ASITE063021		Click to Show/Hide the Full List
mod site	chr3:169993287-169993288:+		[9]
Sequence	TTTATCCATTTGATAATTTTACAGTAAGTAGGTCTCATTCA
Motif Score	2.07285119
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000480708.5; ENST00000337002.9
External Link	RMBase: m6A_site_617726
mod ID: M6ASITE063022		Click to Show/Hide the Full List
mod site	chr3:169993313-169993314:+		[9]
Sequence	AGTAGGTCTCATTCATTTTGACAGTTATCAAAGATGTACTT
Motif Score	2.859755952
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000480708.5; ENST00000337002.9
External Link	RMBase: m6A_site_617727
mod ID: M6ASITE063023		Click to Show/Hide the Full List
mod site	chr3:169993330-169993331:+		[9]
Sequence	TTGACAGTTATCAAAGATGTACTTTCCACAGTTAAATTTAC
Motif Score	3.278136905
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000480708.5; ENST00000337002.9
External Link	RMBase: m6A_site_617728
mod ID: M6ASITE063024		Click to Show/Hide the Full List
mod site	chr3:169993349-169993350:+		[9]
Sequence	TACTTTCCACAGTTAAATTTACATTAATGGCAATTTTTGAT
Motif Score	2.07285119
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000480708.5; ENST00000337002.9
External Link	RMBase: m6A_site_617729
mod ID: M6ASITE063025		Click to Show/Hide the Full List
mod site	chr3:169993394-169993395:+		[9]
Sequence	TTATGGCTTTTTACTGTTAGACTAATCAAAAATAACTTTAA
Motif Score	3.319380952
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000480708.5; ENST00000337002.9
External Link	RMBase: m6A_site_617730
mod ID: M6ASITE063026		Click to Show/Hide the Full List
mod site	chr3:169993420-169993421:+		[9]
Sequence	CAAAAATAACTTTAAAAGGAACAAAGAAACTCCAACATTTC
Motif Score	2.951386905
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000480708.5; ENST00000337002.9
External Link	RMBase: m6A_site_617731
mod ID: M6ASITE063027		Click to Show/Hide the Full List
mod site	chr3:169993434-169993435:+		[9]
Sequence	AAAGGAACAAAGAAACTCCAACATTTCACATTATGCATAGT
Motif Score	2.173910714
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000337002.9; ENST00000480708.5
External Link	RMBase: m6A_site_617732
mod ID: M6ASITE063028		Click to Show/Hide the Full List
mod site	chr3:169993491-169993492:+		[9]
Sequence	AGTTTCTTTAAGATGTGTAAACTCATTGTCCTTGATAGTTT
Motif Score	2.627720238
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000337002.9; ENST00000480708.5
External Link	RMBase: m6A_site_617733
mod ID: M6ASITE063029		Click to Show/Hide the Full List
mod site	chr3:169993591-169993592:+		[7]
Sequence	TTCAAAACTATTTTGTGGAAACAAGCCAACTAGTAACAATG
Motif Score	2.20572619
Cell/Tissue List	HeLa; hESC-HEK293T
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000480708.5; ENST00000337002.9
External Link	RMBase: m6A_site_617734
mod ID: M6ASITE063030		Click to Show/Hide the Full List
mod site	chr3:169993599-169993600:+		[9]
Sequence	TATTTTGTGGAAACAAGCCAACTAGTAACAATGCAGCAACA
Motif Score	2.595904762
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000337002.9; ENST00000480708.5
External Link	RMBase: m6A_site_617735
mod ID: M6ASITE063031		Click to Show/Hide the Full List
mod site	chr3:169993617-169993618:+		[10]
Sequence	CAACTAGTAACAATGCAGCAACACTTCTGGTTTAGCTAAAT
Motif Score	2.173910714
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000337002.9; ENST00000480708.5
External Link	RMBase: m6A_site_617736
mod ID: M6ASITE063032		Click to Show/Hide the Full List
mod site	chr3:169993619-169993620:+		[9]
Sequence	ACTAGTAACAATGCAGCAACACTTCTGGTTTAGCTAAATTA
Motif Score	2.506922619
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000337002.9; ENST00000480708.5
External Link	RMBase: m6A_site_617737
mod ID: M6ASITE063033		Click to Show/Hide the Full List
mod site	chr3:169993661-169993662:+		[10]
Sequence	TTTTCCAATGTAGGAAATCCACACTGATTTGTACGTCTGAC
Motif Score	2.053113095
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000480708.5; ENST00000337002.9
External Link	RMBase: m6A_site_617738
mod ID: M6ASITE063034		Click to Show/Hide the Full List
mod site	chr3:169993673-169993674:+		[9]
Sequence	GGAAATCCACACTGATTTGTACGTCTGACTGAGAGAAAGAT
Motif Score	2.830077381
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000337002.9; ENST00000480708.5
External Link	RMBase: m6A_site_617739
mod ID: M6ASITE063035		Click to Show/Hide the Full List
mod site	chr3:169993680-169993681:+		[9]
Sequence	CACACTGATTTGTACGTCTGACTGAGAGAAAGATGGTCGTC
Motif Score	3.28175
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000480708.5; ENST00000337002.9
External Link	RMBase: m6A_site_617740
mod ID: M6ASITE063036		Click to Show/Hide the Full List
mod site	chr3:169993718-169993719:+		[7]
Sequence	GTCTCCAGCAGAGAAAGTGAACAGCATTTGTTGGAAGGTGA
Motif Score	2.951386905
Cell/Tissue List	HeLa; HEK293T
Seq Type List	m6A-seq; DART-seq
Transcript ID List	ENST00000337002.9; ENST00000480708.5
External Link	RMBase: m6A_site_617741
mod ID: M6ASITE063037		Click to Show/Hide the Full List
mod site	chr3:169993793-169993794:+		[9]
Sequence	TAACGTAAAGTGTATTCTGTACATAATTTACAAATAAAACA
Motif Score	2.856142857
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000480708.5; ENST00000337002.9
External Link	RMBase: m6A_site_617742
mod ID: M6ASITE063038		Click to Show/Hide the Full List
mod site	chr3:169993802-169993803:+		[9]
Sequence	GTGTATTCTGTACATAATTTACAAATAAAACATTTTATTTT
Motif Score	2.07285119
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000480708.5; ENST00000337002.9
External Link	RMBase: m6A_site_617743
mod ID: M6ASITE063039		Click to Show/Hide the Full List
mod site	chr3:169993855-169993856:+		[9]
Sequence	TTATTTAGATATTTCTCAACACTTAAATTCATAAAATTAAG
Motif Score	2.506922619
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000337002.9
External Link	RMBase: m6A_site_617744
mod ID: M6ASITE063040		Click to Show/Hide the Full List
mod site	chr3:169993876-169993877:+		[9]
Sequence	CTTAAATTCATAAAATTAAGACCATGTAAGGGTATGTTTTT
Motif Score	2.876744048
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000337002.9
External Link	RMBase: m6A_site_617745
mod ID: M6ASITE063041		Click to Show/Hide the Full List
mod site	chr3:169993927-169993928:+		[7]
Sequence	AAGTTTGAGTAACCCACAGAACATCTGTGATCTTTCTACAG
Motif Score	2.951386905
Cell/Tissue List	HeLa; HEK293T
Seq Type List	m6A-seq; DART-seq
Transcript ID List	ENST00000337002.9
External Link	RMBase: m6A_site_617746
mod ID: M6ASITE063042		Click to Show/Hide the Full List
mod site	chr3:169993967-169993968:+		[14]
Sequence	GCAGCTTCAGTTTTGTGCCAACATTCCATGTATTTTGAATA
Motif Score	2.173910714
Cell/Tissue List	brain; liver; hESC-HEK293T
Seq Type List	m6A-REF-seq; MAZTER-seq
Transcript ID List	ENST00000337002.9
External Link	RMBase: m6A_site_617747
mod ID: M6ASITE063043		Click to Show/Hide the Full List
mod site	chr3:169993997-169993998:+		[7]
Sequence	TATTTTGAATATGAGCAAAAACTGATCTTAAGAGCAGACTT
Motif Score	2.627720238
Cell/Tissue List	HeLa; HEK293T
Seq Type List	m6A-seq; DART-seq
Transcript ID List	ENST00000337002.9
External Link	RMBase: m6A_site_617748
mod ID: M6ASITE063044		Click to Show/Hide the Full List
mod site	chr3:169994014-169994015:+		[7]
Sequence	AAAACTGATCTTAAGAGCAGACTTAAAGTAGCTTTGTACGC
Motif Score	3.319380952
Cell/Tissue List	HeLa; HEK293T
Seq Type List	m6A-seq; DART-seq
Transcript ID List	ENST00000337002.9
External Link	RMBase: m6A_site_617749
mod ID: M6ASITE063045		Click to Show/Hide the Full List
mod site	chr3:169994031-169994032:+		[9]
Sequence	CAGACTTAAAGTAGCTTTGTACGCCTTAATGTTCATTTTGA
Motif Score	2.830077381
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000337002.9
External Link	RMBase: m6A_site_617750
mod ID: M6ASITE063046		Click to Show/Hide the Full List
mod site	chr3:169994068-169994069:+		[9]
Sequence	TTGATTTATTTTAAATCTTTACATTCAGAAATGAGATACTG
Motif Score	2.07285119
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000337002.9
External Link	RMBase: m6A_site_617751
mod ID: M6ASITE063047		Click to Show/Hide the Full List
mod site	chr3:169994172-169994173:+		[10]
Sequence	AATAAAGATAATGAAAGAAAACATAAGAGAACTATTGGACT
Motif Score	2.20572619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	rmsk_1162958; ENST00000337002.9
External Link	RMBase: m6A_site_617752
mod ID: M6ASITE063048		Click to Show/Hide the Full List
mod site	chr3:169994237-169994238:+		[10]
Sequence	AGTTTGACTTTACGTCTTATACATCTTAGTTACAAGTCTTT
Motif Score	2.110482143
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000337002.9
External Link	RMBase: m6A_site_617753
mod ID: M6ASITE063049		Click to Show/Hide the Full List
mod site	chr3:169994307-169994308:+		[9]
Sequence	CATTCCTTGGAGTTATACTAACTAATAATGAATATTAAATG
Motif Score	2.590089286
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000337002.9
External Link	RMBase: m6A_site_617754
mod ID: M6ASITE063050		Click to Show/Hide the Full List
mod site	chr3:169994490-169994491:+		[9]
Sequence	GTATCGACACATTTTATTAAACTTGGCTTGATTGCTTCTTT
Motif Score	2.627720238
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000337002.9
External Link	RMBase: m6A_site_617755
mod ID: M6ASITE063051		Click to Show/Hide the Full List
mod site	chr3:169994531-169994532:+		[14]
Sequence	ATAGTAGTCCCTGTAAGTGGACATAAATGTGGCTATTTGAT
Motif Score	3.643047619
Cell/Tissue List	brain
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000337002.9
External Link	RMBase: m6A_site_617756
mod ID: M6ASITE063052		Click to Show/Hide the Full List
mod site	chr3:169994581-169994582:+		[9]
Sequence	ACTATGTCAAGGCTGCAATCACTTTAATAGTTTCTTTTTAG
Motif Score	2.469291667
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000337002.9
External Link	RMBase: m6A_site_617757
mod ID: M6ASITE063053		Click to Show/Hide the Full List
mod site	chr3:169994661-169994662:+		[9]
Sequence	CGTCCCATTTGCAGAGCTCTACTACTTCATTTCCACAGTAA
Motif Score	2.500660714
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000337002.9
External Link	RMBase: m6A_site_617758
mod ID: M6ASITE063054		Click to Show/Hide the Full List
mod site	chr3:169994664-169994665:+		[9]
Sequence	CCCATTTGCAGAGCTCTACTACTTCATTTCCACAGTAAGCA
Motif Score	2.500660714
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000337002.9
External Link	RMBase: m6A_site_617759
mod ID: M6ASITE063055		Click to Show/Hide the Full List
mod site	chr3:169994747-169994748:+		[10]
Sequence	ATACCTATTTTGGGGTATAAACATGGTGTTTTTCAGAAATA
Motif Score	2.20572619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000337002.9
External Link	RMBase: m6A_site_617760
mod ID: M6ASITE063056		Click to Show/Hide the Full List
mod site	chr3:169994870-169994871:+		[10]
Sequence	TAATTTGTCTAGTCTTAAAGACATTTGGAGCATGGCCAACA
Motif Score	2.897386905
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000337002.9
External Link	RMBase: m6A_site_617761
mod ID: M6ASITE063057		Click to Show/Hide the Full List
mod site	chr3:169994888-169994889:+		[9]
Sequence	AGACATTTGGAGCATGGCCAACAGGAAGGTCAGCTTCTTAC
Motif Score	2.173910714
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000337002.9
External Link	RMBase: m6A_site_617762
mod ID: M6ASITE063058		Click to Show/Hide the Full List
mod site	chr3:169994907-169994908:+		[9]
Sequence	AACAGGAAGGTCAGCTTCTTACTGATGTGTGTGGATTCTTA
Motif Score	2.494845238
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000337002.9
External Link	RMBase: m6A_site_617763
mod ID: M6ASITE063059		Click to Show/Hide the Full List
mod site	chr3:169994927-169994928:+		[9]
Sequence	ACTGATGTGTGTGGATTCTTACAGAATGTTAGTACAAATTT
Motif Score	2.07285119
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000337002.9
External Link	RMBase: m6A_site_617764
mod ID: M6ASITE063060		Click to Show/Hide the Full List
mod site	chr3:169994940-169994941:+		[9]
Sequence	GATTCTTACAGAATGTTAGTACAAATTTTTATAAATATTTG
Motif Score	2.856142857
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000337002.9
External Link	RMBase: m6A_site_617765
mod ID: M6ASITE063061		Click to Show/Hide the Full List
mod site	chr3:169995059-169995060:+		[7]
Sequence	ATTCAAGTTGTGTACTTTAAACAAATATAAAAATCAAAAGG
Motif Score	2.20572619
Cell/Tissue List	HeLa; hESC-HEK293T
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000337002.9
External Link	RMBase: m6A_site_617766
mod ID: M6ASITE063062		Click to Show/Hide the Full List
mod site	chr3:169995091-169995092:+		[9]
Sequence	ATCAAAAGGCTGCCTCTATTACAATCCTCAGTGGAATAGAT
Motif Score	2.07285119
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000337002.9
External Link	RMBase: m6A_site_617767
mod ID: M6ASITE063063		Click to Show/Hide the Full List
mod site	chr3:169995204-169995205:+		[7]
Sequence	ATGGCGATTTTTTTTTAAGAACTTCAGATTTGCTATGCTGC
Motif Score	3.373380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000337002.9
External Link	RMBase: m6A_site_617768
mod ID: M6ASITE063064		Click to Show/Hide the Full List
mod site	chr3:169995402-169995403:+		[9]
Sequence	TATTTTTCCTTTTCCCTCTTACTGGATTTTTCAATTTTCAA
Motif Score	2.494845238
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000337002.9
External Link	RMBase: m6A_site_617769
mod ID: M6ASITE063065		Click to Show/Hide the Full List
mod site	chr3:169995440-169995441:+		[9]
Sequence	CAAACCATATGGCCTAGGTAACTTTAATTGAAATAATATAG
Motif Score	2.590089286
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000337002.9
External Link	RMBase: m6A_site_617770
mod ID: M6ASITE063066		Click to Show/Hide the Full List
mod site	chr3:169995505-169995506:+		[10]
Sequence	GTAATAAATTTTAATATATCACATTGAAATTATGCAGTGGT
Motif Score	2.047297619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000337002.9
External Link	RMBase: m6A_site_617771
mod ID: M6ASITE063067		Click to Show/Hide the Full List
mod site	chr3:169995562-169995563:+		[10]
Sequence	TCCCCCCTCTTTCTGGTTTTACATCATGAGGATCAGTTAGC
Motif Score	2.07285119
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000337002.9
External Link	RMBase: m6A_site_617772
mod ID: M6ASITE063068		Click to Show/Hide the Full List
mod site	chr3:169995588-169995589:+		[10]
Sequence	TGAGGATCAGTTAGCTGCTGACAAGAAAAGTCATCTTGTGT
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000337002.9
External Link	RMBase: m6A_site_617773
mod ID: M6ASITE063069		Click to Show/Hide the Full List
mod site	chr3:169995647-169995648:+		[9]
Sequence	TTTTTTTAAATCTATTAGGAACTGGAAAACAGCAAGTATGG
Motif Score	3.373380952
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000337002.9
External Link	RMBase: m6A_site_617774
mod ID: M6ASITE063070		Click to Show/Hide the Full List
mod site	chr3:169995823-169995824:+		[7]
Sequence	TGTAAATTTCTGTTGTAAAGACACCTTATTTAATATAATCG
Motif Score	2.897386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000337002.9
External Link	RMBase: m6A_site_617775
mod ID: M6ASITE063071		Click to Show/Hide the Full List
mod site	chr3:169995907-169995908:+		[9]
Sequence	GCCTGAATGAAGCTTATCTGACACATAAGCTTCATAAGGCA
Motif Score	2.859755952
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000337002.9
External Link	RMBase: m6A_site_617776
mod ID: M6ASITE063072		Click to Show/Hide the Full List
mod site	chr3:169995953-169995954:+		[7]
Sequence	CAGCCTTTTTACCCTTAGGAACAGCTTTTTGCCCTTAGCAC
Motif Score	2.951386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000337002.9
External Link	RMBase: m6A_site_617777
mod ID: M6ASITE063073		Click to Show/Hide the Full List
mod site	chr3:169995995-169995996:+		[7]
Sequence	ATGCTTGGGGGCCATTTTAAACAGTGAAATCAAAAAAAGAA
Motif Score	2.20572619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000337002.9
External Link	RMBase: m6A_site_617778
mod ID: M6ASITE063074		Click to Show/Hide the Full List
mod site	chr3:169996015-169996016:+		[7]
Sequence	ACAGTGAAATCAAAAAAAGAACAGAAATGCAAAAACCATGG
Motif Score	2.951386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000337002.9
External Link	RMBase: m6A_site_617779
mod ID: M6ASITE063075		Click to Show/Hide the Full List
mod site	chr3:169996029-169996030:+		[7]
Sequence	AAAAGAACAGAAATGCAAAAACCATGGCATTAGCGTAAAAA
Motif Score	2.185083333
Cell/Tissue List	HeLa; HEK293T
Seq Type List	m6A-seq; DART-seq
Transcript ID List	ENST00000337002.9
External Link	RMBase: m6A_site_617780
mod ID: M6ASITE063076		Click to Show/Hide the Full List
mod site	chr3:169996052-169996053:+		[7]
Sequence	ATGGCATTAGCGTAAAAAGGACACGTTTATAGTATGAAAGC
Motif Score	3.643047619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000337002.9
External Link	RMBase: m6A_site_617781
mod ID: M6ASITE063077		Click to Show/Hide the Full List
mod site	chr3:169996077-169996078:+		[7]
Sequence	TTTATAGTATGAAAGCTGGAACATGGCCTTGTTCAACCTCA
Motif Score	2.951386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000337002.9
External Link	RMBase: m6A_site_617782
mod ID: M6ASITE063078		Click to Show/Hide the Full List
mod site	chr3:169996160-169996161:+		[10]
Sequence	ATTTTAGGTTAGGCAAATTCACAAATACGGAATCCATGAAT
Motif Score	2.047297619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000337002.9
External Link	RMBase: m6A_site_617783
mod ID: M6ASITE063079		Click to Show/Hide the Full List
mod site	chr3:169996192-169996193:+		[9]
Sequence	TCCATGAATAACGAGGATCAACTGTACTTAACTATATTTTA
Motif Score	2.595904762
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000337002.9
External Link	RMBase: m6A_site_617784
mod ID: M6ASITE063080		Click to Show/Hide the Full List
mod site	chr3:169996221-169996222:+		[9]
Sequence	AACTATATTTTAAAGCTGTGACATTTATCTACCTGGTTTAT
Motif Score	2.859755952
Cell/Tissue List	HEK293T; hESC-HEK293T
Seq Type List	DART-seq; MAZTER-seq
Transcript ID List	ENST00000337002.9
External Link	RMBase: m6A_site_617785
mod ID: M6ASITE063081		Click to Show/Hide the Full List
mod site	chr3:169996344-169996345:+		[9]
Sequence	TTGTGTGGTAATTTGCTTTTACTGTTTCCACAGTATTTCAG
Motif Score	2.494845238
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000337002.9
External Link	RMBase: m6A_site_617786
mod ID: M6ASITE063082		Click to Show/Hide the Full List
mod site	chr3:169996379-169996380:+		[9]
Sequence	TTTCAGGTCTTTGCTCATTCACTCAGTAATACTGAGCACTT
Motif Score	2.469291667
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000337002.9
External Link	RMBase: m6A_site_617787

Pseudouridine (Pseudo)

In total 2 m6A sequence/site(s) in this target gene
mod ID: PSESITE000191		Click to Show/Hide the Full List
mod site	chr3:169993109-169993110:+		[15]
Sequence	TAAGTACAAGAGGTTGGATTTTCTATGTTGGCTGATTACCA
Transcript ID List	ENST00000337002.9; ENST00000480708.5
External Link	RMBase: Pseudo_site_3636
mod ID: PSESITE000192		Click to Show/Hide the Full List
mod site	chr3:169994312-169994313:+		[15]
Sequence	CTTGGAGTTATACTAACTAATAATGAATATTAAATGATTTT
Transcript ID List	ENST00000337002.9
External Link	RMBase: Pseudo_site_3637

Ref 1	MiR-4429 prevented gastric cancer progression through targeting METTL3 to inhibit m(6)A-caused stabilization of SEC62. Biochem Biophys Res Commun. 2019 Oct 1;517(4):581-587. doi: 10.1016/j.bbrc.2019.07.058. Epub 2019 Aug 5.
Ref 2	Sec62 promotes stemness and chemoresistance of human colorectal cancer through activating Wnt/Beta-catenin pathway. J Exp Clin Cancer Res. 2021 Apr 15;40(1):132. doi: 10.1186/s13046-021-01934-6.
Ref 3	Widespread RNA editing of embedded alu elements in the human transcriptome. Genome Res. 2004 Sep;14(9):1719-25. doi: 10.1101/gr.2855504.
Ref 4	Accurate identification of A-to-I RNA editing in human by transcriptome sequencing. Genome Res. 2012 Jan;22(1):142-50. doi: 10.1101/gr.124107.111. Epub 2011 Sep 29.
Ref 5	Comprehensive analysis of RNA-Seq data reveals extensive RNA editing in a human transcriptome. Nat Biotechnol. 2012 Feb 12;30(3):253-60. doi: 10.1038/nbt.2122.
Ref 6	RADAR: a rigorously annotated database of A-to-I RNA editing. Nucleic Acids Res. 2014 Jan;42(Database issue):D109-13. doi: 10.1093/nar/gkt996. Epub 2013 Oct 25.
Ref 7	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 8	Suppression of m(6)A reader Ythdf2 promotes hematopoietic stem cell expansion. Cell Res. 2018 Sep;28(9):904-917. doi: 10.1038/s41422-018-0072-0. Epub 2018 Jul 31.
Ref 9	DART-seq: an antibody-free method for global m(6)A detection. Nat Methods. 2019 Dec;16(12):1275-1280. doi: 10.1038/s41592-019-0570-0. Epub 2019 Sep 23.
Ref 10	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.
Ref 11	Efficacy of MEK inhibition in patients with histiocytic neoplasms. Nature. 2019 Mar;567(7749):521-524. doi: 10.1038/s41586-019-1012-y. Epub 2019 Mar 13.
Ref 12	A majority of m6A residues are in the last exons, allowing the potential for 3' UTR regulation. Genes Dev. 2015 Oct 1;29(19):2037-53. doi: 10.1101/gad.269415.115. Epub 2015 Sep 24.
Ref 13	The N(6)-methyladenosine (m(6)A)-forming enzyme METTL3 controls myeloid differentiation of normal hematopoietic and leukemia cells. Nat Med. 2017 Nov;23(11):1369-1376. doi: 10.1038/nm.4416. Epub 2017 Sep 18.
Ref 14	Single-base mapping of m(6)A by an antibody-independent method. Sci Adv. 2019 Jul 3;5(7):eaax0250. doi: 10.1126/sciadv.aax0250. eCollection 2019 Jul.
Ref 15	Chemical pulldown reveals dynamic pseudouridylation of the mammalian transcriptome. Nat Chem Biol. 2015 Aug;11(8):592-7. doi: 10.1038/nchembio.1836. Epub 2015 Jun 15.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map