m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00369)
Target Name PI3-kinase subunit beta (PIK3CB)
Synonyms
PI3-kinase subunit beta; PI3K-beta; PI3Kbeta; PtdIns-3-kinase subunit beta; Phosphatidylinositol 4,5-bisphosphate 3-kinase 110 kDa catalytic subunit beta; PtdIns-3-kinase subunit p110-beta; p110beta; PIK3C1
    Click to Show/Hide
Gene Name PIK3CB
Chromosomal Location 3q22.3
Family PI3/PI4-kinase family
Function
Phosphoinositide-3-kinase (PI3K) phosphorylates phosphatidylinositol derivatives at position 3 of the inositol ring to produce 3-phosphoinositides. Uses ATP and PtdIns(4,5)P2 (phosphatidylinositol 4,5-bisphosphate) to generate phosphatidylinositol 3,4,5-trisphosphate (PIP3). PIP3 plays a key role by recruiting PH domain-containing proteins to the membrane, including AKT1 and PDPK1, activating signaling cascades involved in cell growth, survival, proliferation, motility and morphology. Involved in the activation of AKT1 upon stimulation by G-protein coupled receptors (GPCRs) ligands such as CXCL12, sphingosine 1-phosphate, and lysophosphatidic acid. May also act downstream receptor tyrosine kinases. Required in different signaling pathways for stable platelet adhesion and aggregation. Plays a role in platelet activation signaling triggered by GPCRs, alpha-IIb/beta-3 integrins (ITGA2B/ ITGB3) and ITAM (immunoreceptor tyrosine-based activation motif)-bearing receptors such as GP6. Regulates the strength of adhesion of ITGA2B/ ITGB3 activated receptors necessary for the cellular transmission of contractile forces. Required for platelet aggregation induced by F2 (thrombin) and thromboxane A2 (TXA2). Has a role in cell survival. May have a role in cell migration. Involved in the early stage of autophagosome formation. Modulates the intracellular level of PtdIns3P (phosphatidylinositol 3-phosphate) and activates PIK3C3 kinase activity. May act as a scaffold, independently of its lipid kinase activity to positively regulate autophagy. May have a role in insulin signaling as scaffolding protein in which the lipid kinase activity is not required. May have a kinase-independent function in regulating cell proliferation and in clathrin-mediated endocytosis. Mediator of oncogenic signal in cell lines lacking PTEN. The lipid kinase activity is necessary for its role in oncogenic transformation. Required for the growth of ERBB2 and RAS driven tumors.
    Click to Show/Hide
Gene ID 5291
Uniprot ID
PK3CB_HUMAN
HGNC ID
HGNC:8976
KEGG ID
hsa:5291
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
PIK3CB can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Browse Drug
Methyltransferase-like 14 (METTL14) [WRITER]
 Regulator Info 
Representative RNA-seq result indicating the expression of this target gene regulated by METTL14
Cell Line MDA-MB-231 Homo sapiens
Treatment: siMETTL14 MDA-MB-231 cells
Control: MDA-MB-231 cells
 GSE81164
Regulation
logFC: 5.88E-01
p-value: 1.08E-05
More Results Click to View More RNA-seq Results
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary N6-methyladenosine mRNA methylation of PIK3CB regulates AKT signalling to promote PTEN-deficient pancreatic cancer progression. Rs142933486 is significantly associated with the overall survival of PDAC by reducing the PIK3CB m6A level, which facilitated its mRNA and protein expression levels mediated by the m6A 'writer' complex (METTL13/METTL14/WTAP) and the m6A 'reader' YTHDF2. KIN-193, a PI3-kinase subunit beta (PIK3CB)-selective inhibitor, is shown to serve as an effective anticancer agent for blocking PTEN-deficient PDAC.
Target Regulation Up regulation
Responsed Disease Pancreatic cancer ICD-11: 2C10
 Disease Info 
Responsed Drug AZD6482 Terminated
 Drug Info 
Pathway Response PI3K-Akt signaling pathway hsa04151
Glycolysis / Gluconeogenesis hsa00010
Cell Process Glucose metabolism
In-vitro Model BxPC-3 Pancreatic ductal adenocarcinoma Homo sapiens CVCL_0186
PANC-1 Pancreatic ductal adenocarcinoma Homo sapiens CVCL_0480
In-vivo Model Established cohorts of mice bearing tumour xenografts driven by PTEN-deficient BxPC-3 and PANC-1 cells with PIK3CB overexpression. When tumours grew to ~300 mm3, mice were grouped and administered with vehicle (DMSO) or KIN-193 via intraperitoneal injection (20 mg/kg) once daily.
Wilms tumor 1-associating protein (WTAP) [WRITER]
 Regulator Info 
Representative RNA-seq result indicating the expression of this target gene regulated by WTAP
Cell Line mice hepatocyte Mus musculus
Treatment: Wtap Hknockout mice hepatocyte
Control: Wtap flox/flox mice hepatocyte
 GSE168850
Regulation
logFC: 5.88E-01
p-value: 1.20E-03
More Results Click to View More RNA-seq Results
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary N6-methyladenosine mRNA methylation of PIK3CB regulates AKT signalling to promote PTEN-deficient pancreatic cancer progression. Rs142933486 is significantly associated with the overall survival of PDAC by reducing the PIK3CB m6A level, which facilitated its mRNA and protein expression levels mediated by the m6A 'writer' complex (METTL13/METTL14/WTAP) and the m6A 'reader' YTHDF2. KIN-193, a PI3-kinase subunit beta (PIK3CB)-selective inhibitor, is shown to serve as an effective anticancer agent for blocking PTEN-deficient PDAC.
Target Regulation Up regulation
Responsed Disease Pancreatic cancer ICD-11: 2C10
 Disease Info 
Responsed Drug AZD6482 Terminated
 Drug Info 
Pathway Response PI3K-Akt signaling pathway hsa04151
Glycolysis / Gluconeogenesis hsa00010
Cell Process Glucose metabolism
In-vitro Model BxPC-3 Pancreatic ductal adenocarcinoma Homo sapiens CVCL_0186
PANC-1 Pancreatic ductal adenocarcinoma Homo sapiens CVCL_0480
In-vivo Model Established cohorts of mice bearing tumour xenografts driven by PTEN-deficient BxPC-3 and PANC-1 cells with PIK3CB overexpression. When tumours grew to ~300 mm3, mice were grouped and administered with vehicle (DMSO) or KIN-193 via intraperitoneal injection (20 mg/kg) once daily.
YTH domain-containing family protein 2 (YTHDF2) [READER]
 Regulator Info 
Representative RIP-seq result supporting the interaction between PIK3CB and the regulator
Cell Line Hela Homo sapiens
Regulation logFC: 1.28E+00 GSE49339
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary N6-methyladenosine mRNA methylation of PIK3CB regulates AKT signalling to promote PTEN-deficient pancreatic cancer progression. Rs142933486 is significantly associated with the overall survival of PDAC by reducing the PIK3CB m6A level, which facilitated its mRNA and protein expression levels mediated by the m6A 'writer' complex (METTL13/METTL14/WTAP) and the m6A 'reader' YTHDF2. KIN-193, a PI3-kinase subunit beta (PIK3CB)-selective inhibitor, is shown to serve as an effective anticancer agent for blocking PTEN-deficient PDAC.
Target Regulation Down regulation
Responsed Disease Pancreatic cancer ICD-11: 2C10
 Disease Info 
Responsed Drug AZD6482 Terminated
 Drug Info 
Pathway Response PI3K-Akt signaling pathway hsa04151
Glycolysis / Gluconeogenesis hsa00010
Cell Process Glucose metabolism
In-vitro Model BxPC-3 Pancreatic ductal adenocarcinoma Homo sapiens CVCL_0186
PANC-1 Pancreatic ductal adenocarcinoma Homo sapiens CVCL_0480
In-vivo Model Established cohorts of mice bearing tumour xenografts driven by PTEN-deficient BxPC-3 and PANC-1 cells with PIK3CB overexpression. When tumours grew to ~300 mm3, mice were grouped and administered with vehicle (DMSO) or KIN-193 via intraperitoneal injection (20 mg/kg) once daily.
Methyltransferase-like 13 (METTL13) [WRITER]
 Regulator Info 
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary N6-methyladenosine mRNA methylation of PIK3CB regulates AKT signalling to promote PTEN-deficient pancreatic cancer progression. Rs142933486 is significantly associated with the overall survival of PDAC by reducing the PIK3CB m6A level, which facilitated its mRNA and protein expression levels mediated by the m6A 'writer' complex (METTL13/METTL14/WTAP) and the m6A 'reader' YTHDF2. KIN-193, a PI3-kinase subunit beta (PIK3CB)-selective inhibitor, is shown to serve as an effective anticancer agent for blocking PTEN-deficient PDAC.
Target Regulation Up regulation
Responsed Disease Pancreatic cancer ICD-11: 2C10
 Disease Info 
Responsed Drug AZD6482 Terminated
 Drug Info 
Pathway Response PI3K-Akt signaling pathway hsa04151
Glycolysis / Gluconeogenesis hsa00010
Cell Process Glucose metabolism
In-vitro Model BxPC-3 Pancreatic ductal adenocarcinoma Homo sapiens CVCL_0186
PANC-1 Pancreatic ductal adenocarcinoma Homo sapiens CVCL_0480
In-vivo Model Established cohorts of mice bearing tumour xenografts driven by PTEN-deficient BxPC-3 and PANC-1 cells with PIK3CB overexpression. When tumours grew to ~300 mm3, mice were grouped and administered with vehicle (DMSO) or KIN-193 via intraperitoneal injection (20 mg/kg) once daily.
Pancreatic cancer [ICD-11: 2C10]
 Disease Info 
In total 4 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [1]
Response Summary N6-methyladenosine mRNA methylation of PIK3CB regulates AKT signalling to promote PTEN-deficient pancreatic cancer progression. Rs142933486 is significantly associated with the overall survival of PDAC by reducing the PIK3CB m6A level, which facilitated its mRNA and protein expression levels mediated by the m6A 'writer' complex (METTL13/METTL14/WTAP) and the m6A 'reader' YTHDF2. KIN-193, a PI3-kinase subunit beta (PIK3CB)-selective inhibitor, is shown to serve as an effective anticancer agent for blocking PTEN-deficient PDAC.
Responsed Disease Pancreatic cancer [ICD-11: 2C10]
Target Regulator Methyltransferase-like 13 (METTL13) WRITER
 Regulator Info 
Target Regulation Up regulation
Responsed Drug AZD6482 Terminated
 Drug Info 
Pathway Response PI3K-Akt signaling pathway hsa04151
Glycolysis / Gluconeogenesis hsa00010
Cell Process Glucose metabolism
In-vitro Model BxPC-3 Pancreatic ductal adenocarcinoma Homo sapiens CVCL_0186
PANC-1 Pancreatic ductal adenocarcinoma Homo sapiens CVCL_0480
In-vivo Model Established cohorts of mice bearing tumour xenografts driven by PTEN-deficient BxPC-3 and PANC-1 cells with PIK3CB overexpression. When tumours grew to ~300 mm3, mice were grouped and administered with vehicle (DMSO) or KIN-193 via intraperitoneal injection (20 mg/kg) once daily.
Experiment 2 Reporting the m6A-centered Disease Response [1]
Response Summary N6-methyladenosine mRNA methylation of PIK3CB regulates AKT signalling to promote PTEN-deficient pancreatic cancer progression. Rs142933486 is significantly associated with the overall survival of PDAC by reducing the PIK3CB m6A level, which facilitated its mRNA and protein expression levels mediated by the m6A 'writer' complex (METTL13/METTL14/WTAP) and the m6A 'reader' YTHDF2. KIN-193, a PI3-kinase subunit beta (PIK3CB)-selective inhibitor, is shown to serve as an effective anticancer agent for blocking PTEN-deficient PDAC.
Responsed Disease Pancreatic cancer [ICD-11: 2C10]
Target Regulator Methyltransferase-like 14 (METTL14) WRITER
 Regulator Info 
Target Regulation Up regulation
Responsed Drug AZD6482 Terminated
 Drug Info 
Pathway Response PI3K-Akt signaling pathway hsa04151
Glycolysis / Gluconeogenesis hsa00010
Cell Process Glucose metabolism
In-vitro Model BxPC-3 Pancreatic ductal adenocarcinoma Homo sapiens CVCL_0186
PANC-1 Pancreatic ductal adenocarcinoma Homo sapiens CVCL_0480
In-vivo Model Established cohorts of mice bearing tumour xenografts driven by PTEN-deficient BxPC-3 and PANC-1 cells with PIK3CB overexpression. When tumours grew to ~300 mm3, mice were grouped and administered with vehicle (DMSO) or KIN-193 via intraperitoneal injection (20 mg/kg) once daily.
Experiment 3 Reporting the m6A-centered Disease Response [1]
Response Summary N6-methyladenosine mRNA methylation of PIK3CB regulates AKT signalling to promote PTEN-deficient pancreatic cancer progression. Rs142933486 is significantly associated with the overall survival of PDAC by reducing the PIK3CB m6A level, which facilitated its mRNA and protein expression levels mediated by the m6A 'writer' complex (METTL13/METTL14/WTAP) and the m6A 'reader' YTHDF2. KIN-193, a PI3-kinase subunit beta (PIK3CB)-selective inhibitor, is shown to serve as an effective anticancer agent for blocking PTEN-deficient PDAC.
Responsed Disease Pancreatic cancer [ICD-11: 2C10]
Target Regulator Wilms tumor 1-associating protein (WTAP) WRITER
 Regulator Info 
Target Regulation Up regulation
Responsed Drug AZD6482 Terminated
 Drug Info 
Pathway Response PI3K-Akt signaling pathway hsa04151
Glycolysis / Gluconeogenesis hsa00010
Cell Process Glucose metabolism
In-vitro Model BxPC-3 Pancreatic ductal adenocarcinoma Homo sapiens CVCL_0186
PANC-1 Pancreatic ductal adenocarcinoma Homo sapiens CVCL_0480
In-vivo Model Established cohorts of mice bearing tumour xenografts driven by PTEN-deficient BxPC-3 and PANC-1 cells with PIK3CB overexpression. When tumours grew to ~300 mm3, mice were grouped and administered with vehicle (DMSO) or KIN-193 via intraperitoneal injection (20 mg/kg) once daily.
Experiment 4 Reporting the m6A-centered Disease Response [1]
Response Summary N6-methyladenosine mRNA methylation of PIK3CB regulates AKT signalling to promote PTEN-deficient pancreatic cancer progression. Rs142933486 is significantly associated with the overall survival of PDAC by reducing the PIK3CB m6A level, which facilitated its mRNA and protein expression levels mediated by the m6A 'writer' complex (METTL13/METTL14/WTAP) and the m6A 'reader' YTHDF2. KIN-193, a PI3-kinase subunit beta (PIK3CB)-selective inhibitor, is shown to serve as an effective anticancer agent for blocking PTEN-deficient PDAC.
Responsed Disease Pancreatic cancer [ICD-11: 2C10]
Target Regulator YTH domain-containing family protein 2 (YTHDF2) READER
 Regulator Info 
Target Regulation Down regulation
Responsed Drug AZD6482 Terminated
 Drug Info 
Pathway Response PI3K-Akt signaling pathway hsa04151
Glycolysis / Gluconeogenesis hsa00010
Cell Process Glucose metabolism
In-vitro Model BxPC-3 Pancreatic ductal adenocarcinoma Homo sapiens CVCL_0186
PANC-1 Pancreatic ductal adenocarcinoma Homo sapiens CVCL_0480
In-vivo Model Established cohorts of mice bearing tumour xenografts driven by PTEN-deficient BxPC-3 and PANC-1 cells with PIK3CB overexpression. When tumours grew to ~300 mm3, mice were grouped and administered with vehicle (DMSO) or KIN-193 via intraperitoneal injection (20 mg/kg) once daily.
AZD6482 [Terminated]
 Drug Info 
In total 4 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response [1]
Response Summary N6-methyladenosine mRNA methylation of PIK3CB regulates AKT signalling to promote PTEN-deficient pancreatic cancer progression. Rs142933486 is significantly associated with the overall survival of PDAC by reducing the PIK3CB m6A level, which facilitated its mRNA and protein expression levels mediated by the m6A 'writer' complex (METTL13/METTL14/WTAP) and the m6A 'reader' YTHDF2. KIN-193, a PI3-kinase subunit beta (PIK3CB)-selective inhibitor, is shown to serve as an effective anticancer agent for blocking PTEN-deficient PDAC.
Target Regulator Methyltransferase-like 13 (METTL13) WRITER
 Regulator Info 
Target Regulation Up regulation
Responsed Disease Pancreatic cancer ICD-11: 2C10
 Disease Info 
Pathway Response PI3K-Akt signaling pathway hsa04151
Glycolysis / Gluconeogenesis hsa00010
Cell Process Glucose metabolism
In-vitro Model BxPC-3 Pancreatic ductal adenocarcinoma Homo sapiens CVCL_0186
PANC-1 Pancreatic ductal adenocarcinoma Homo sapiens CVCL_0480
In-vivo Model Established cohorts of mice bearing tumour xenografts driven by PTEN-deficient BxPC-3 and PANC-1 cells with PIK3CB overexpression. When tumours grew to ~300 mm3, mice were grouped and administered with vehicle (DMSO) or KIN-193 via intraperitoneal injection (20 mg/kg) once daily.
Experiment 2 Reporting the m6A-centered Drug Response [1]
Response Summary N6-methyladenosine mRNA methylation of PIK3CB regulates AKT signalling to promote PTEN-deficient pancreatic cancer progression. Rs142933486 is significantly associated with the overall survival of PDAC by reducing the PIK3CB m6A level, which facilitated its mRNA and protein expression levels mediated by the m6A 'writer' complex (METTL13/METTL14/WTAP) and the m6A 'reader' YTHDF2. KIN-193, a PI3-kinase subunit beta (PIK3CB)-selective inhibitor, is shown to serve as an effective anticancer agent for blocking PTEN-deficient PDAC.
Target Regulator Methyltransferase-like 14 (METTL14) WRITER
 Regulator Info 
Target Regulation Up regulation
Responsed Disease Pancreatic cancer ICD-11: 2C10
 Disease Info 
Pathway Response PI3K-Akt signaling pathway hsa04151
Glycolysis / Gluconeogenesis hsa00010
Cell Process Glucose metabolism
In-vitro Model BxPC-3 Pancreatic ductal adenocarcinoma Homo sapiens CVCL_0186
PANC-1 Pancreatic ductal adenocarcinoma Homo sapiens CVCL_0480
In-vivo Model Established cohorts of mice bearing tumour xenografts driven by PTEN-deficient BxPC-3 and PANC-1 cells with PIK3CB overexpression. When tumours grew to ~300 mm3, mice were grouped and administered with vehicle (DMSO) or KIN-193 via intraperitoneal injection (20 mg/kg) once daily.
Experiment 3 Reporting the m6A-centered Drug Response [1]
Response Summary N6-methyladenosine mRNA methylation of PIK3CB regulates AKT signalling to promote PTEN-deficient pancreatic cancer progression. Rs142933486 is significantly associated with the overall survival of PDAC by reducing the PIK3CB m6A level, which facilitated its mRNA and protein expression levels mediated by the m6A 'writer' complex (METTL13/METTL14/WTAP) and the m6A 'reader' YTHDF2. KIN-193, a PI3-kinase subunit beta (PIK3CB)-selective inhibitor, is shown to serve as an effective anticancer agent for blocking PTEN-deficient PDAC.
Target Regulator Wilms tumor 1-associating protein (WTAP) WRITER
 Regulator Info 
Target Regulation Up regulation
Responsed Disease Pancreatic cancer ICD-11: 2C10
 Disease Info 
Pathway Response PI3K-Akt signaling pathway hsa04151
Glycolysis / Gluconeogenesis hsa00010
Cell Process Glucose metabolism
In-vitro Model BxPC-3 Pancreatic ductal adenocarcinoma Homo sapiens CVCL_0186
PANC-1 Pancreatic ductal adenocarcinoma Homo sapiens CVCL_0480
In-vivo Model Established cohorts of mice bearing tumour xenografts driven by PTEN-deficient BxPC-3 and PANC-1 cells with PIK3CB overexpression. When tumours grew to ~300 mm3, mice were grouped and administered with vehicle (DMSO) or KIN-193 via intraperitoneal injection (20 mg/kg) once daily.
Experiment 4 Reporting the m6A-centered Drug Response [1]
Response Summary N6-methyladenosine mRNA methylation of PIK3CB regulates AKT signalling to promote PTEN-deficient pancreatic cancer progression. Rs142933486 is significantly associated with the overall survival of PDAC by reducing the PIK3CB m6A level, which facilitated its mRNA and protein expression levels mediated by the m6A 'writer' complex (METTL13/METTL14/WTAP) and the m6A 'reader' YTHDF2. KIN-193, a PI3-kinase subunit beta (PIK3CB)-selective inhibitor, is shown to serve as an effective anticancer agent for blocking PTEN-deficient PDAC.
Target Regulator YTH domain-containing family protein 2 (YTHDF2) READER
 Regulator Info 
Target Regulation Down regulation
Responsed Disease Pancreatic cancer ICD-11: 2C10
 Disease Info 
Pathway Response PI3K-Akt signaling pathway hsa04151
Glycolysis / Gluconeogenesis hsa00010
Cell Process Glucose metabolism
In-vitro Model BxPC-3 Pancreatic ductal adenocarcinoma Homo sapiens CVCL_0186
PANC-1 Pancreatic ductal adenocarcinoma Homo sapiens CVCL_0480
In-vivo Model Established cohorts of mice bearing tumour xenografts driven by PTEN-deficient BxPC-3 and PANC-1 cells with PIK3CB overexpression. When tumours grew to ~300 mm3, mice were grouped and administered with vehicle (DMSO) or KIN-193 via intraperitoneal injection (20 mg/kg) once daily.
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00369)
PI3-kinase subunit beta (PIK3CB)
Adenosine-to-Inosine editing (A-to-I)
In total 45 m6A sequence/site(s) in this target gene
mod ID: A2ISITE000011 Click to Show/Hide the Full List
mod site chr3:138665788-138665789:- [2]
Sequence TCACTTGAACCCAGGAGTTCAAGAGCAGCCTGGGTAACATG
Transcript ID List ENST00000469284.6; ENST00000477593.5; ENST00000462898.5; rmsk_1109893; ENST00000544716.5; ENST00000481749.5; ENST00000289153.6; ENST00000493568.5
External Link RMBase: RNA-editing_site_100125
mod ID: A2ISITE000012 Click to Show/Hide the Full List
mod site chr3:138668083-138668084:- [2]
Sequence AGAACTAGAAAAGTGCTTTTATTATTATTTTTTTCTGAGAT
Transcript ID List ENST00000462898.5; ENST00000469284.6; ENST00000493568.5; ENST00000289153.6; ENST00000544716.5; ENST00000481749.5; ENST00000477593.5
External Link RMBase: RNA-editing_site_100126
mod ID: A2ISITE000013 Click to Show/Hide the Full List
mod site chr3:138687518-138687519:- [2]
Sequence TATGATTTGATTGTACCACTACACCCTAGCCTGGGCAACAG
Transcript ID List ENST00000462898.5; ENST00000544716.5; ENST00000493568.5; ENST00000289153.6; ENST00000481749.5; rmsk_1109942; ENST00000469284.6; ENST00000477593.5; ENST00000473435.1
External Link RMBase: RNA-editing_site_100127
mod ID: A2ISITE000014 Click to Show/Hide the Full List
mod site chr3:138712704-138712705:- [2]
Sequence GTGTGGTGGCGGGTGCCTGTAATTCCAGCTACTCAGGAGGC
Transcript ID List rmsk_1110007; ENST00000493568.5; ENST00000462898.5; ENST00000544716.5; ENST00000289153.6; ENST00000477593.5
External Link RMBase: RNA-editing_site_100128
mod ID: A2ISITE000015 Click to Show/Hide the Full List
mod site chr3:138730809-138730810:- [3]
Sequence CCTCCCAAGTAGCTAGGACTACAGGTATACACCATCACTTC
Transcript ID List ENST00000477593.5; ENST00000462294.1; ENST00000462898.5; ENST00000289153.6
External Link RMBase: RNA-editing_site_100129
mod ID: A2ISITE000016 Click to Show/Hide the Full List
mod site chr3:138731538-138731539:- [2]
Sequence GCAAACAGGCTGGGCGTGGTAGCTCACACCTGTAATCCTAG
Transcript ID List ENST00000462898.5; rmsk_1110039; ENST00000477593.5; ENST00000289153.6; ENST00000462294.1
External Link RMBase: RNA-editing_site_100130
mod ID: A2ISITE000017 Click to Show/Hide the Full List
mod site chr3:138762765-138762766:- [4]
Sequence AAGGTTTCACCATGTTGCCCAGGCTGGTCTCAAACTCCTGG
Transcript ID List ENST00000465581.1; ENST00000477593.5; ENST00000483968.5; ENST00000461451.1; ENST00000462898.5
External Link RMBase: RNA-editing_site_100131
mod ID: A2ISITE000018 Click to Show/Hide the Full List
mod site chr3:138762777-138762778:- [4]
Sequence TTTAGTAGAGACAAGGTTTCACCATGTTGCCCAGGCTGGTC
Transcript ID List ENST00000483968.5; ENST00000461451.1; ENST00000465581.1; ENST00000477593.5; ENST00000462898.5
External Link RMBase: RNA-editing_site_100132
mod ID: A2ISITE000019 Click to Show/Hide the Full List
mod site chr3:138762784-138762785:- [4]
Sequence TTGTATTTTTAGTAGAGACAAGGTTTCACCATGTTGCCCAG
Transcript ID List ENST00000465581.1; ENST00000461451.1; ENST00000462898.5; ENST00000483968.5; ENST00000477593.5
External Link RMBase: RNA-editing_site_100133
mod ID: A2ISITE000020 Click to Show/Hide the Full List
mod site chr3:138762794-138762795:- [4]
Sequence GCTAATTTTTTTGTATTTTTAGTAGAGACAAGGTTTCACCA
Transcript ID List ENST00000461451.1; ENST00000483968.5; ENST00000462898.5; ENST00000465581.1; ENST00000477593.5
External Link RMBase: RNA-editing_site_100134
mod ID: A2ISITE000021 Click to Show/Hide the Full List
mod site chr3:138762811-138762812:- [4]
Sequence GCCTGCCGCCATGCCTGGCTAATTTTTTTGTATTTTTAGTA
Transcript ID List ENST00000483968.5; ENST00000465581.1; ENST00000477593.5; ENST00000461451.1; ENST00000462898.5
External Link RMBase: RNA-editing_site_100135
mod ID: A2ISITE000022 Click to Show/Hide the Full List
mod site chr3:138762837-138762838:- [4]
Sequence CCTCCCTGGTAGCTGGGATTACAGGTGCCTGCCGCCATGCC
Transcript ID List ENST00000462898.5; ENST00000461451.1; ENST00000477593.5; ENST00000465581.1; ENST00000483968.5
External Link RMBase: RNA-editing_site_100136
mod ID: A2ISITE000023 Click to Show/Hide the Full List
mod site chr3:138762872-138762873:- [4]
Sequence CCACCCTCTGGGGTCAAGCAATTCTCCTGACTCAGCCTCCC
Transcript ID List ENST00000465581.1; ENST00000483968.5; ENST00000461451.1; ENST00000477593.5; ENST00000462898.5
External Link RMBase: RNA-editing_site_100137
mod ID: A2ISITE000024 Click to Show/Hide the Full List
mod site chr3:138762876-138762877:- [4]
Sequence ACCTCCACCCTCTGGGGTCAAGCAATTCTCCTGACTCAGCC
Transcript ID List ENST00000465581.1; ENST00000461451.1; ENST00000483968.5; ENST00000477593.5; ENST00000462898.5
External Link RMBase: RNA-editing_site_100138
mod ID: A2ISITE000025 Click to Show/Hide the Full List
mod site chr3:138762890-138762891:- [4]
Sequence CTTGGCCCACTGCAACCTCCACCCTCTGGGGTCAAGCAATT
Transcript ID List ENST00000477593.5; ENST00000465581.1; ENST00000462898.5; ENST00000461451.1; ENST00000483968.5
External Link RMBase: RNA-editing_site_100139
mod ID: A2ISITE000026 Click to Show/Hide the Full List
mod site chr3:138762897-138762898:- [4]
Sequence GTGTAATCTTGGCCCACTGCAACCTCCACCCTCTGGGGTCA
Transcript ID List ENST00000477593.5; ENST00000483968.5; ENST00000465581.1; ENST00000462898.5; ENST00000461451.1
External Link RMBase: RNA-editing_site_100140
mod ID: A2ISITE000027 Click to Show/Hide the Full List
mod site chr3:138762913-138762914:- [4]
Sequence AGGCTGGAGTGCAGTGGTGTAATCTTGGCCCACTGCAACCT
Transcript ID List ENST00000461451.1; ENST00000462898.5; ENST00000477593.5; ENST00000483968.5; ENST00000465581.1
External Link RMBase: RNA-editing_site_100141
mod ID: A2ISITE000028 Click to Show/Hide the Full List
mod site chr3:138763192-138763193:- [4]
Sequence TGAGCTGAGATCATGCCACTACACTCCAGCCTGGGTGACAG
Transcript ID List ENST00000462898.5; ENST00000483968.5; ENST00000461451.1; rmsk_1110130; ENST00000477593.5; ENST00000465581.1
External Link RMBase: RNA-editing_site_100142
mod ID: A2ISITE000029 Click to Show/Hide the Full List
mod site chr3:138763220-138763221:- [4]
Sequence GCTTGAACCTGGGAGGCAGAAGTTGCAGTGAGCTGAGATCA
Transcript ID List ENST00000465581.1; rmsk_1110130; ENST00000477593.5; ENST00000483968.5; ENST00000461451.1; ENST00000462898.5
External Link RMBase: RNA-editing_site_100143
mod ID: A2ISITE000030 Click to Show/Hide the Full List
mod site chr3:138763223-138763224:- [4]
Sequence ATTGCTTGAACCTGGGAGGCAGAAGTTGCAGTGAGCTGAGA
Transcript ID List ENST00000477593.5; rmsk_1110130; ENST00000483968.5; ENST00000462898.5; ENST00000461451.1; ENST00000465581.1
External Link RMBase: RNA-editing_site_100144
mod ID: A2ISITE000031 Click to Show/Hide the Full List
mod site chr3:138763249-138763250:- [4]
Sequence GCTACTCAGGAGGCTGAAGCAGGAGAATTGCTTGAACCTGG
Transcript ID List ENST00000462898.5; ENST00000465581.1; ENST00000461451.1; rmsk_1110130; ENST00000483968.5; ENST00000477593.5
External Link RMBase: RNA-editing_site_100145
mod ID: A2ISITE000032 Click to Show/Hide the Full List
mod site chr3:138763262-138763263:- [4]
Sequence GCCTGTAATCCCAGCTACTCAGGAGGCTGAAGCAGGAGAAT
Transcript ID List ENST00000465581.1; ENST00000462898.5; ENST00000483968.5; ENST00000461451.1; ENST00000477593.5; rmsk_1110130
External Link RMBase: RNA-editing_site_100146
mod ID: A2ISITE000033 Click to Show/Hide the Full List
mod site chr3:138763266-138763267:- [4]
Sequence GTGTGCCTGTAATCCCAGCTACTCAGGAGGCTGAAGCAGGA
Transcript ID List ENST00000462898.5; ENST00000477593.5; ENST00000465581.1; rmsk_1110130; ENST00000483968.5; ENST00000461451.1
External Link RMBase: RNA-editing_site_100147
mod ID: A2ISITE000034 Click to Show/Hide the Full List
mod site chr3:138763275-138763276:- [4]
Sequence CATGATGGTGTGTGCCTGTAATCCCAGCTACTCAGGAGGCT
Transcript ID List rmsk_1110130; ENST00000461451.1; ENST00000465581.1; ENST00000477593.5; ENST00000462898.5; ENST00000483968.5
External Link RMBase: RNA-editing_site_100148
mod ID: A2ISITE000035 Click to Show/Hide the Full List
mod site chr3:138763307-138763308:- [4]
Sequence CATCTCTACTAAAAATACAAAAATTAGCCGGGCATGATGGT
Transcript ID List ENST00000483968.5; rmsk_1110130; ENST00000461451.1; ENST00000477593.5; ENST00000462898.5; ENST00000465581.1
External Link RMBase: RNA-editing_site_100149
mod ID: A2ISITE000036 Click to Show/Hide the Full List
mod site chr3:138763331-138763332:- [4]
Sequence AGCCTGACCAACATGGTGAAACCCCATCTCTACTAAAAATA
Transcript ID List ENST00000461451.1; ENST00000483968.5; ENST00000477593.5; ENST00000462898.5; ENST00000465581.1; rmsk_1110130
External Link RMBase: RNA-editing_site_100150
mod ID: A2ISITE000037 Click to Show/Hide the Full List
mod site chr3:138763341-138763342:- [4]
Sequence GTTTGAGACTAGCCTGACCAACATGGTGAAACCCCATCTCT
Transcript ID List ENST00000483968.5; ENST00000465581.1; ENST00000461451.1; ENST00000477593.5; rmsk_1110130; ENST00000462898.5
External Link RMBase: RNA-editing_site_100151
mod ID: A2ISITE000038 Click to Show/Hide the Full List
mod site chr3:138763408-138763409:- [4]
Sequence CACGGTGGCTCATGCCTGTAATCCCAGCACTTTGGGAGGCC
Transcript ID List ENST00000477593.5; ENST00000461451.1; ENST00000465581.1; rmsk_1110130; ENST00000462898.5; ENST00000483968.5
External Link RMBase: RNA-editing_site_100152
mod ID: A2ISITE000039 Click to Show/Hide the Full List
mod site chr3:138776441-138776442:- [2]
Sequence CTGCCTCGCCCTCTCACAGTACTCGAATTACAGGCATAAGC
Transcript ID List ENST00000483968.5; ENST00000461451.1; ENST00000462898.5; ENST00000477593.5
External Link RMBase: RNA-editing_site_100153
mod ID: A2ISITE000040 Click to Show/Hide the Full List
mod site chr3:138781838-138781839:- [5]
Sequence GCCTCGACTGCCTGGCGTCAAGTGATCCTCTTTTACTTCAG
Transcript ID List ENST00000483968.5; ENST00000462898.5; ENST00000461451.1; ENST00000477593.5
External Link RMBase: RNA-editing_site_100154
mod ID: A2ISITE000041 Click to Show/Hide the Full List
mod site chr3:138788880-138788881:- [5]
Sequence ACCTCCGCCTCCCGGGTTCAAGCGATTCTCCTGCCTCAGCC
Transcript ID List ENST00000462898.5; ENST00000461451.1; ENST00000483968.5; ENST00000477593.5
External Link RMBase: RNA-editing_site_100155
mod ID: A2ISITE000042 Click to Show/Hide the Full List
mod site chr3:138789375-138789376:- [2]
Sequence ACCTCCACCTCCTGTGCTCAAGTGATCCTCCCACCTCAGCC
Transcript ID List ENST00000477593.5; ENST00000461451.1; ENST00000462898.5; ENST00000483968.5
External Link RMBase: RNA-editing_site_100156
mod ID: A2ISITE000043 Click to Show/Hide the Full List
mod site chr3:138790361-138790362:- [5]
Sequence CCTTGGCCTCACAAAATGCTAGGATTATAGGTGTGAGCCAC
Transcript ID List ENST00000462898.5; ENST00000483968.5; ENST00000461451.1; ENST00000477593.5
External Link RMBase: RNA-editing_site_100157
mod ID: A2ISITE000044 Click to Show/Hide the Full List
mod site chr3:138790366-138790367:- [2]
Sequence GCCCACCTTGGCCTCACAAAATGCTAGGATTATAGGTGTGA
Transcript ID List ENST00000462898.5; ENST00000461451.1; ENST00000477593.5; ENST00000483968.5
External Link RMBase: RNA-editing_site_100158
mod ID: A2ISITE000045 Click to Show/Hide the Full List
mod site chr3:138792180-138792181:- [5]
Sequence ATTTTTTGAAATGGAGTGTCACTTTGTTGCCCAGGCTGGAG
Transcript ID List ENST00000483968.5; ENST00000461451.1; ENST00000462898.5; ENST00000477593.5
External Link RMBase: RNA-editing_site_100159
mod ID: A2ISITE000046 Click to Show/Hide the Full List
mod site chr3:138793448-138793449:- [5]
Sequence CATGCTCGACTGATTTTTGTATTTTTATTAGAGACGGGGTT
Transcript ID List ENST00000477593.5; ENST00000461451.1; ENST00000483968.5; ENST00000462898.5
External Link RMBase: RNA-editing_site_100160
mod ID: A2ISITE000047 Click to Show/Hide the Full List
mod site chr3:138819875-138819876:- [5]
Sequence TCAAGCGATTCTCCTGCCTCAGCCACCCAAGTAGCCCGAGA
Transcript ID List ENST00000461451.1; ENST00000477593.5; ENST00000462898.5; ENST00000483968.5
External Link RMBase: RNA-editing_site_100161
mod ID: A2ISITE000048 Click to Show/Hide the Full List
mod site chr3:138820553-138820554:- [5]
Sequence TTGCAGTGAGCTGAAATTGCACCACTGCACTCCAGCCTGGG
Transcript ID List ENST00000461451.1; ENST00000462898.5; ENST00000483968.5; ENST00000477593.5; rmsk_1110292
External Link RMBase: RNA-editing_site_100162
mod ID: A2ISITE000049 Click to Show/Hide the Full List
mod site chr3:138820591-138820592:- [5]
Sequence CCGAGGCAGGAGAATTGCTTAAGCCCCGGAGGCAGTGGTTG
Transcript ID List rmsk_1110292; ENST00000461451.1; ENST00000462898.5; ENST00000477593.5; ENST00000483968.5
External Link RMBase: RNA-editing_site_100163
mod ID: A2ISITE000050 Click to Show/Hide the Full List
mod site chr3:138820661-138820662:- [5]
Sequence GTCTCTAATAAAAGTACAAAAATTAGCCAGGTGTGGTGGTG
Transcript ID List ENST00000461451.1; ENST00000483968.5; rmsk_1110292; ENST00000477593.5; ENST00000462898.5
External Link RMBase: RNA-editing_site_100164
mod ID: A2ISITE000051 Click to Show/Hide the Full List
mod site chr3:138820768-138820769:- [5]
Sequence AGGCACGGTGGCTCATGCCTATAATCCCAGCATTCTGAGAG
Transcript ID List ENST00000477593.5; rmsk_1110292; ENST00000461451.1; ENST00000483968.5; ENST00000462898.5
External Link RMBase: RNA-editing_site_100165
mod ID: A2ISITE000052 Click to Show/Hide the Full List
mod site chr3:138820788-138820789:- [5]
Sequence CAGAATGAAGAAAGTGGACCAGGCACGGTGGCTCATGCCTA
Transcript ID List ENST00000477593.5; ENST00000461451.1; ENST00000483968.5; ENST00000462898.5; rmsk_1110292
External Link RMBase: RNA-editing_site_100166
mod ID: A2ISITE000053 Click to Show/Hide the Full List
mod site chr3:138827021-138827022:- [5]
Sequence GGCTGGAGTGCAATGGTGCAATCTCGGTTCACTGCAACCTC
Transcript ID List ENST00000477593.5; ENST00000483968.5; ENST00000462898.5; ENST00000461451.1
External Link RMBase: RNA-editing_site_100167
mod ID: A2ISITE000054 Click to Show/Hide the Full List
mod site chr3:138827935-138827936:- [5]
Sequence GAGTGCAGTGGCGCGATCTCAGTTTACTTCAAGCTCCGCCT
Transcript ID List ENST00000462898.5; ENST00000477593.5; ENST00000483968.5; ENST00000461451.1
External Link RMBase: RNA-editing_site_100168
mod ID: A2ISITE000055 Click to Show/Hide the Full List
mod site chr3:138833230-138833231:- [2]
Sequence CTACCAAAAACACAAAAATTAGCAGGGCGTGGTGGCGGGCG
Transcript ID List ENST00000462898.5; rmsk_1110331; ENST00000477593.5; ENST00000461451.1; ENST00000483968.5
External Link RMBase: RNA-editing_site_100169
N6-methyladenosine (m6A)
In total 75 m6A sequence/site(s) in this target gene
mod ID: M6ASITE062456 Click to Show/Hide the Full List
mod site chr3:138654142-138654143:- [6]
Sequence TCGGTGATATGGGAAAGAGAACTGAGTATTTGCCCTATGAC
Motif Score 3.373380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000477593.5; ENST00000289153.6; ENST00000469284.6; ENST00000544716.5; ENST00000462898.5
External Link RMBase: m6A_site_611932
mod ID: M6ASITE062457 Click to Show/Hide the Full List
mod site chr3:138654204-138654205:- [6]
Sequence TCCTGGCAACATCCAGCAAAACTACTGCTTATTCTCCAAAG
Motif Score 2.627720238
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000462898.5; ENST00000289153.6; ENST00000469284.6; ENST00000544716.5; ENST00000477593.5
External Link RMBase: m6A_site_611933
mod ID: M6ASITE062458 Click to Show/Hide the Full List
mod site chr3:138654263-138654264:- [6]
Sequence TGTTAATATGTGCAATAGGAACTACTGGTTTGAATGTGTAA
Motif Score 3.373380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000544716.5; ENST00000462898.5; ENST00000289153.6; ENST00000477593.5; ENST00000469284.6
External Link RMBase: m6A_site_611934
mod ID: M6ASITE062459 Click to Show/Hide the Full List
mod site chr3:138654404-138654405:- [6]
Sequence TTCTTACTGTATTTATTAAAACTTGTAATAATGTGATTTTT
Motif Score 2.627720238
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000289153.6; ENST00000477593.5; ENST00000462898.5; ENST00000544716.5; ENST00000469284.6
External Link RMBase: m6A_site_611935
mod ID: M6ASITE062460 Click to Show/Hide the Full List
mod site chr3:138654466-138654467:- [6]
Sequence GAAACCTATTTATGGAATAAACTCCAGATCTGAAATTCAGT
Motif Score 2.627720238
Cell/Tissue List HeLa; HEK293T
Seq Type List m6A-seq; DART-seq
Transcript ID List ENST00000477593.5; ENST00000544716.5; ENST00000289153.6; ENST00000462898.5; ENST00000469284.6
External Link RMBase: m6A_site_611936
mod ID: M6ASITE062461 Click to Show/Hide the Full List
mod site chr3:138654483-138654484:- [6]
Sequence AAGCAAGCAAATGAAAAGAAACCTATTTATGGAATAAACTC
Motif Score 2.185083333
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000477593.5; ENST00000469284.6; ENST00000544716.5; ENST00000462898.5; ENST00000289153.6
External Link RMBase: m6A_site_611937
mod ID: M6ASITE062462 Click to Show/Hide the Full List
mod site chr3:138655143-138655144:- [7]
Sequence TGGATAATCATTTCCTGCTGACTTTGCACGCCAAGGAATGC
Motif Score 3.28175
Cell/Tissue List A549
Seq Type List m6A-CLIP/IP
Transcript ID List ENST00000544716.5; ENST00000462898.5; ENST00000469284.6; ENST00000481749.5; ENST00000289153.6; ENST00000477593.5
External Link RMBase: m6A_site_611938
mod ID: M6ASITE062463 Click to Show/Hide the Full List
mod site chr3:138655171-138655172:- [6]
Sequence TTCCAAGACTTATCATGAAAACTGTCAATGGATAATCATTT
Motif Score 2.627720238
Cell/Tissue List HeLa; HepG2; HEK293T; A549; H1A; hNPCs; hESCs; fibroblasts; GM12878; MM6; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000481749.5; ENST00000477593.5; ENST00000289153.6; ENST00000544716.5; ENST00000469284.6; ENST00000462898.5; ENST00000493568.5
External Link RMBase: m6A_site_611939
mod ID: M6ASITE062464 Click to Show/Hide the Full List
mod site chr3:138655184-138655185:- [6]
Sequence GCTTTTTGAATGCTTCCAAGACTTATCATGAAAACTGTCAA
Motif Score 3.319380952
Cell/Tissue List HeLa; HepG2; HEK293T; A549; H1A; hNPCs; hESCs; fibroblasts; GM12878; MM6; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX
Seq Type List m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List ENST00000481749.5; ENST00000469284.6; ENST00000289153.6; ENST00000544716.5; ENST00000493568.5; ENST00000462898.5; ENST00000477593.5
External Link RMBase: m6A_site_611940
mod ID: M6ASITE062465 Click to Show/Hide the Full List
mod site chr3:138655226-138655227:- [6]
Sequence TCCCACAGAACCTAATCTGAACAATCCCCGATGATTCCCTC
Motif Score 2.951386905
Cell/Tissue List HeLa; HepG2; HEK293T; A549; U2OS; H1A; hNPCs; hESCs; fibroblasts; GM12878; MM6; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000462898.5; ENST00000544716.5; ENST00000481749.5; ENST00000289153.6; ENST00000477593.5; ENST00000469284.6; ENST00000493568.5
External Link RMBase: m6A_site_611941
mod ID: M6ASITE062466 Click to Show/Hide the Full List
mod site chr3:138655237-138655238:- [6]
Sequence AGAACAAGGCATCCCACAGAACCTAATCTGAACAATCCCCG
Motif Score 2.930744048
Cell/Tissue List HeLa; HepG2; HEK293T; A549; U2OS; H1A; hNPCs; hESCs; fibroblasts; GM12878; MM6; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000469284.6; ENST00000481749.5; ENST00000493568.5; ENST00000544716.5; ENST00000462898.5; ENST00000289153.6; ENST00000477593.5
External Link RMBase: m6A_site_611942
mod ID: M6ASITE062467 Click to Show/Hide the Full List
mod site chr3:138655254-138655255:- [6]
Sequence AACTCAGAGTTAAATTAAGAACAAGGCATCCCACAGAACCT
Motif Score 2.951386905
Cell/Tissue List HeLa; HepG2; HEK293T; A549; U2OS; hNPCs; hESCs; fibroblasts; GM12878; CD8T; MM6; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX
Seq Type List m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List ENST00000544716.5; ENST00000469284.6; ENST00000481749.5; ENST00000493568.5; ENST00000289153.6; ENST00000462898.5; ENST00000477593.5
External Link RMBase: m6A_site_611943
mod ID: M6ASITE062468 Click to Show/Hide the Full List
mod site chr3:138655273-138655274:- [6]
Sequence AAAGGGAATGAAATCCTGGAACTCAGAGTTAAATTAAGAAC
Motif Score 3.373380952
Cell/Tissue List HeLa; HepG2; HEK293T; A549; U2OS; hNPCs; hESCs; fibroblasts; GM12878; MM6; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX; AML
Seq Type List m6A-seq; MeRIP-seq; miCLIP
Transcript ID List ENST00000289153.6; ENST00000469284.6; ENST00000477593.5; ENST00000462898.5; ENST00000481749.5; ENST00000544716.5; ENST00000493568.5
External Link RMBase: m6A_site_611944
mod ID: M6ASITE062469 Click to Show/Hide the Full List
mod site chr3:138655317-138655318:- [6]
Sequence TTGCACTTGCACTAAATTGAACATGACCCTGTTAGAGATGT
Motif Score 2.951386905
Cell/Tissue List HeLa; HepG2; HEK293T; A549; U2OS; hNPCs; hESCs; fibroblasts; GM12878; LCLs; MM6; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000481749.5; ENST00000462898.5; ENST00000289153.6; ENST00000469284.6; ENST00000493568.5; ENST00000477593.5; ENST00000544716.5
External Link RMBase: m6A_site_611945
mod ID: M6ASITE062470 Click to Show/Hide the Full List
mod site chr3:138655401-138655402:- [6]
Sequence GGCCCACACAGTTCGGAAAGACTACAGATCTTAACGATCAG
Motif Score 3.319380952
Cell/Tissue List HeLa; HepG2; HEK293T; A549; U2OS; H1B; hNPCs; hESCs; fibroblasts; GM12878; MM6; Huh7; HEK293A-TOA; iSLK; MSC; TIME; AML
Seq Type List m6A-seq; MeRIP-seq; miCLIP
Transcript ID List ENST00000289153.6; ENST00000462898.5; ENST00000544716.5; ENST00000477593.5; ENST00000469284.6; ENST00000481749.5; ENST00000493568.5
External Link RMBase: m6A_site_611946
mod ID: M6ASITE062471 Click to Show/Hide the Full List
mod site chr3:138655428-138655429:- [6]
Sequence AAGCTGGACTACTAAAGTGAACTGGATGGCCCACACAGTTC
Motif Score 3.373380952
Cell/Tissue List HeLa; HEK293T; A549; HepG2; H1B; hNPCs; hESCs; fibroblasts; GM12878; MM6; Huh7; HEK293A-TOA; iSLK; TIME
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000481749.5; ENST00000493568.5; ENST00000289153.6; ENST00000469284.6; ENST00000462898.5; ENST00000477593.5; ENST00000544716.5
External Link RMBase: m6A_site_611947
mod ID: M6ASITE062472 Click to Show/Hide the Full List
mod site chr3:138655441-138655442:- [6]
Sequence AGGCGCTCAGGGAAAGCTGGACTACTAAAGTGAACTGGATG
Motif Score 4.065041667
Cell/Tissue List HeLa; HEK293T; A549; HepG2; H1B; hNPCs; hESCs; fibroblasts; GM12878; CD8T; MM6; Huh7; HEK293A-TOA; iSLK; TIME
Seq Type List m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List ENST00000477593.5; ENST00000469284.6; ENST00000544716.5; ENST00000462898.5; ENST00000289153.6; ENST00000493568.5; ENST00000481749.5
External Link RMBase: m6A_site_611948
mod ID: M6ASITE062473 Click to Show/Hide the Full List
mod site chr3:138655484-138655485:- [6]
Sequence AGTGAAGAAGAAGCACTCAAACAGTTTAAGCAAAAATTTGA
Motif Score 2.20572619
Cell/Tissue List HeLa; HEK293T; HepG2; H1B; hNPCs; hESCs; fibroblasts; A549; GM12878; MM6; HEK293A-TOA; iSLK
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000544716.5; ENST00000477593.5; ENST00000462898.5; ENST00000481749.5; ENST00000469284.6; ENST00000289153.6; ENST00000493568.5
External Link RMBase: m6A_site_611949
mod ID: M6ASITE062474 Click to Show/Hide the Full List
mod site chr3:138656174-138656175:- [6]
Sequence TTGACTGCAGGGCTTCCTGAACTCACATCAGTCAAAGATAT
Motif Score 3.373380952
Cell/Tissue List HeLa; HEK293T
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000477593.5; ENST00000544716.5; ENST00000481749.5; ENST00000462898.5; ENST00000493568.5; ENST00000469284.6; ENST00000289153.6
External Link RMBase: m6A_site_611950
mod ID: M6ASITE062475 Click to Show/Hide the Full List
mod site chr3:138657714-138657715:- [6]
Sequence ATGTCATTCAACAAGGAAAAACAGGAAATACAGAAAAGTTT
Motif Score 2.20572619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000289153.6; ENST00000462898.5; ENST00000493568.5; ENST00000481749.5; ENST00000487552.1; ENST00000544716.5; ENST00000469284.6; ENST00000477593.5
External Link RMBase: m6A_site_611951
mod ID: M6ASITE062476 Click to Show/Hide the Full List
mod site chr3:138657814-138657815:- [6]
Sequence CTCTTCCACATTGACTTTGGACATATTCTTGGAAATTTCAA
Motif Score 3.643047619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000469284.6; ENST00000462898.5; ENST00000544716.5; ENST00000289153.6; ENST00000481749.5; ENST00000487552.1; ENST00000477593.5; ENST00000493568.5
External Link RMBase: m6A_site_611952
mod ID: M6ASITE062477 Click to Show/Hide the Full List
mod site chr3:138663913-138663914:- [6]
Sequence ACAACATCATGGTCAAAAAAACTGGCCAGGTGAGCTGCTCC
Motif Score 2.627720238
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000477593.5; ENST00000462898.5; ENST00000289153.6; ENST00000469284.6; ENST00000487552.1; ENST00000544716.5; ENST00000493568.5; ENST00000481749.5
External Link RMBase: m6A_site_611953
mod ID: M6ASITE062478 Click to Show/Hide the Full List
mod site chr3:138663941-138663942:- [6]
Sequence GTCCTTGGGATTGGTGACAGACATAGTGACAACATCATGGT
Motif Score 2.897386905
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000289153.6; ENST00000493568.5; ENST00000477593.5; ENST00000469284.6; ENST00000481749.5; ENST00000462898.5; ENST00000544716.5
External Link RMBase: m6A_site_611954
mod ID: M6ASITE062479 Click to Show/Hide the Full List
mod site chr3:138664017-138664018:- [6]
Sequence CTTGTTCAGGGATGACCTGGACCGAGCCATTGAGGAATTTA
Motif Score 3.622404762
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000481749.5; ENST00000462898.5; ENST00000469284.6; ENST00000289153.6; ENST00000493568.5; ENST00000544716.5; ENST00000477593.5
External Link RMBase: m6A_site_611955
mod ID: M6ASITE062480 Click to Show/Hide the Full List
mod site chr3:138665059-138665060:- [6]
Sequence CAACAAAGATGCCCTTCTGAACTGGCTTAAAGAATACAACT
Motif Score 3.373380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000289153.6; ENST00000477593.5; ENST00000544716.5; ENST00000469284.6; ENST00000462898.5; ENST00000493568.5; ENST00000481749.5
External Link RMBase: m6A_site_611956
mod ID: M6ASITE062481 Click to Show/Hide the Full List
mod site chr3:138665110-138665111:- [6]
Sequence AATTGCTGACATTCAGCTGAACAGTAGCAATGTGGCTGCTG
Motif Score 2.951386905
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000481749.5; ENST00000469284.6; ENST00000477593.5; ENST00000462898.5; ENST00000493568.5; ENST00000289153.6; ENST00000544716.5
External Link RMBase: m6A_site_611957
mod ID: M6ASITE062482 Click to Show/Hide the Full List
mod site chr3:138665132-138665133:- [6]
Sequence AAGTTGTGAGCACCTCTGAAACAATTGCTGACATTCAGCTG
Motif Score 2.20572619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000477593.5; ENST00000289153.6; ENST00000481749.5; ENST00000462898.5; ENST00000544716.5; ENST00000469284.6; ENST00000493568.5
External Link RMBase: m6A_site_611958
mod ID: M6ASITE062483 Click to Show/Hide the Full List
mod site chr3:138684629-138684630:- [6]
Sequence CCATGTGTTATCCTCTCAGAACTCTAGTAAGTGACTGTGCT
Motif Score 3.373380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000481749.5; ENST00000477593.5; ENST00000493568.5; ENST00000469284.6; ENST00000289153.6; ENST00000544716.5; ENST00000462898.5; ENST00000473435.1; ENST00000485060.1
External Link RMBase: m6A_site_611959
mod ID: M6ASITE062484 Click to Show/Hide the Full List
mod site chr3:138684651-138684652:- [6]
Sequence TGACCTGCAGTCACCCCTGAACCCATGTGTTATCCTCTCAG
Motif Score 2.930744048
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000462898.5; ENST00000477593.5; ENST00000544716.5; ENST00000493568.5; ENST00000289153.6; ENST00000473435.1; ENST00000481749.5; ENST00000485060.1; ENST00000469284.6
External Link RMBase: m6A_site_611960
mod ID: M6ASITE062485 Click to Show/Hide the Full List
mod site chr3:138684698-138684699:- [6]
Sequence GCCATGCATACCTGTTTAAAACAGAGTGCTTACCGGGAAGC
Motif Score 2.20572619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000473435.1; ENST00000485060.1; ENST00000289153.6; ENST00000477593.5; ENST00000462898.5; ENST00000544716.5; ENST00000493568.5; ENST00000481749.5; ENST00000469284.6
External Link RMBase: m6A_site_611961
mod ID: M6ASITE062486 Click to Show/Hide the Full List
mod site chr3:138684738-138684739:- [6]
Sequence ACTGAATGCCGTGAAGTTAAACAGAGCCAAAGGGAAGGAGG
Motif Score 2.20572619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000462898.5; ENST00000469284.6; ENST00000473435.1; ENST00000544716.5; ENST00000493568.5; ENST00000481749.5; ENST00000289153.6; ENST00000485060.1; ENST00000477593.5
External Link RMBase: m6A_site_611962
mod ID: M6ASITE062487 Click to Show/Hide the Full List
mod site chr3:138684758-138684759:- [6]
Sequence ACTTTAAATAGTTTAATCAAACTGAATGCCGTGAAGTTAAA
Motif Score 2.627720238
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000477593.5; ENST00000469284.6; ENST00000493568.5; ENST00000485060.1; ENST00000544716.5; ENST00000462898.5; ENST00000473435.1; ENST00000289153.6; ENST00000481749.5
External Link RMBase: m6A_site_611963
mod ID: M6ASITE062488 Click to Show/Hide the Full List
mod site chr3:138684778-138684779:- [6]
Sequence AAGCACTCAATAAGTTAAAAACTTTAAATAGTTTAATCAAA
Motif Score 2.627720238
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000481749.5; ENST00000289153.6; ENST00000477593.5; ENST00000462898.5; ENST00000485060.1; ENST00000493568.5; ENST00000473435.1; ENST00000469284.6; ENST00000544716.5
External Link RMBase: m6A_site_611964
mod ID: M6ASITE062489 Click to Show/Hide the Full List
mod site chr3:138684815-138684816:- [6]
Sequence ATGAATTTTTGGTGTGGGGAACTTATTTTTCAGGTTGAAGC
Motif Score 3.373380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000473435.1; ENST00000469284.6; ENST00000485060.1; ENST00000462898.5; ENST00000544716.5; ENST00000477593.5; ENST00000493568.5; ENST00000289153.6; ENST00000481749.5
External Link RMBase: m6A_site_611965
mod ID: M6ASITE062490 Click to Show/Hide the Full List
mod site chr3:138694830-138694831:- [6]
Sequence TCTGGATTTCAACTATCCAGACCAGTACGTTCGAGAATATG
Motif Score 2.876744048
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000493568.5; ENST00000289153.6; ENST00000473435.1; ENST00000477593.5; ENST00000544716.5; ENST00000462898.5; ENST00000481749.5; ENST00000469284.6
External Link RMBase: m6A_site_611966
mod ID: M6ASITE062491 Click to Show/Hide the Full List
mod site chr3:138694877-138694878:- [6]
Sequence CTGCTTCAGATTTGGCCTAAACTGCCCCCCCGGGAGGCCCT
Motif Score 2.627720238
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000469284.6; ENST00000493568.5; ENST00000481749.5; ENST00000462898.5; ENST00000289153.6; ENST00000473435.1; ENST00000477593.5; ENST00000544716.5
External Link RMBase: m6A_site_611967
mod ID: M6ASITE062492 Click to Show/Hide the Full List
mod site chr3:138698924-138698925:- [6]
Sequence CTGTCAATCAAGTGGAATAAACTTGAGGATGTTGCTCAGGT
Motif Score 2.627720238
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000477593.5; ENST00000473435.1; ENST00000493568.5; ENST00000462898.5; ENST00000469284.6; ENST00000544716.5; ENST00000289153.6; ENST00000481749.5
External Link RMBase: m6A_site_611968
mod ID: M6ASITE062493 Click to Show/Hide the Full List
mod site chr3:138698985-138698986:- [6]
Sequence TATTTGGACTTTGCGACAAGACTGCCGAGAGATTTTCCCAC
Motif Score 3.319380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000481749.5; ENST00000477593.5; ENST00000473435.1; ENST00000462898.5; ENST00000544716.5; ENST00000469284.6; ENST00000493568.5; ENST00000289153.6
External Link RMBase: m6A_site_611969
mod ID: M6ASITE062494 Click to Show/Hide the Full List
mod site chr3:138698998-138698999:- [6]
Sequence ATGAAATGGATCTTATTTGGACTTTGCGACAAGACTGCCGA
Motif Score 4.065041667
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000469284.6; ENST00000493568.5; ENST00000289153.6; ENST00000477593.5; ENST00000462898.5; ENST00000544716.5; ENST00000473435.1; ENST00000481749.5
External Link RMBase: m6A_site_611970
mod ID: M6ASITE062495 Click to Show/Hide the Full List
mod site chr3:138699048-138699049:- [6]
Sequence TGTATTGAAAGAAATCTTGGACAGGGATCCCTTGTCTCAAC
Motif Score 3.643047619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000473435.1; ENST00000289153.6; ENST00000462898.5; ENST00000544716.5; ENST00000469284.6; ENST00000477593.5; ENST00000493568.5; ENST00000481749.5
External Link RMBase: m6A_site_611971
mod ID: M6ASITE062496 Click to Show/Hide the Full List
mod site chr3:138707188-138707189:- [6]
Sequence AAATTTCCAGAGAATAAAAAACAACCTTATTATTACCCTCC
Motif Score 2.20572619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000544716.5; ENST00000481749.5; ENST00000477593.5; ENST00000469284.6; ENST00000493568.5; ENST00000473435.1; ENST00000289153.6; ENST00000462898.5
External Link RMBase: m6A_site_611972
mod ID: M6ASITE062497 Click to Show/Hide the Full List
mod site chr3:138707247-138707248:- [6]
Sequence ATCCAATGGGAACTGTTCAAACAAATCCATATACTGAAAAT
Motif Score 2.20572619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000477593.5; ENST00000493568.5; ENST00000469284.6; ENST00000462898.5; ENST00000481749.5; ENST00000544716.5; ENST00000473435.1; ENST00000289153.6
External Link RMBase: m6A_site_611973
mod ID: M6ASITE062498 Click to Show/Hide the Full List
mod site chr3:138707256-138707257:- [6]
Sequence AAATGTTGAATCCAATGGGAACTGTTCAAACAAATCCATAT
Motif Score 3.373380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000473435.1; ENST00000481749.5; ENST00000493568.5; ENST00000469284.6; ENST00000477593.5; ENST00000544716.5; ENST00000289153.6; ENST00000462898.5
External Link RMBase: m6A_site_611974
mod ID: M6ASITE062499 Click to Show/Hide the Full List
mod site chr3:138707284-138707285:- [6]
Sequence TATTTGCATGTTTTAGATGAACTCGAAGAAATGTTGAATCC
Motif Score 3.373380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000477593.5; ENST00000493568.5; ENST00000462898.5; ENST00000469284.6; ENST00000289153.6; ENST00000473435.1; ENST00000481749.5; ENST00000544716.5
External Link RMBase: m6A_site_611975
mod ID: M6ASITE062500 Click to Show/Hide the Full List
mod site chr3:138707312-138707313:- [6]
Sequence TTTAAAGACATTTTTTAAGAACCAAAATTATTTGCATGTTT
Motif Score 2.930744048
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000469284.6; ENST00000481749.5; ENST00000462898.5; ENST00000289153.6; ENST00000477593.5; ENST00000493568.5; ENST00000473435.1; ENST00000544716.5
External Link RMBase: m6A_site_611976
mod ID: M6ASITE062501 Click to Show/Hide the Full List
mod site chr3:138707325-138707326:- [6]
Sequence TTTAAAGCCTAGTTTTAAAGACATTTTTTAAGAACCAAAAT
Motif Score 2.897386905
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000544716.5; ENST00000462898.5; ENST00000289153.6; ENST00000493568.5; ENST00000481749.5; ENST00000469284.6; ENST00000477593.5; ENST00000473435.1
External Link RMBase: m6A_site_611977
mod ID: M6ASITE062502 Click to Show/Hide the Full List
mod site chr3:138712239-138712240:- [6]
Sequence AGGACAATTGAGAACTGGAGACATAATATTACACAGCTGGT
Motif Score 2.897386905
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000473435.1; ENST00000493568.5; ENST00000544716.5; ENST00000477593.5; ENST00000462898.5; ENST00000289153.6; ENST00000469284.6
External Link RMBase: m6A_site_611978
mod ID: M6ASITE062503 Click to Show/Hide the Full List
mod site chr3:138712246-138712247:- [6]
Sequence ACTTTAAAGGACAATTGAGAACTGGAGACATAATATTACAC
Motif Score 3.373380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000469284.6; ENST00000473435.1; ENST00000477593.5; ENST00000544716.5; ENST00000289153.6; ENST00000493568.5; ENST00000462898.5
External Link RMBase: m6A_site_611979
mod ID: M6ASITE062504 Click to Show/Hide the Full List
mod site chr3:138712256-138712257:- [6]
Sequence ATGGTTTTTGACTTTAAAGGACAATTGAGAACTGGAGACAT
Motif Score 3.643047619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000544716.5; ENST00000462898.5; ENST00000289153.6; ENST00000477593.5; ENST00000493568.5; ENST00000469284.6
External Link RMBase: m6A_site_611980
mod ID: M6ASITE062505 Click to Show/Hide the Full List
mod site chr3:138714490-138714491:- [6]
Sequence TTAATCCCTCTAAATATCAGACCATCAGGAAAGCTGGAAAA
Motif Score 2.876744048
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000477593.5; ENST00000493568.5; ENST00000462898.5; ENST00000289153.6
External Link RMBase: m6A_site_611981
mod ID: M6ASITE062506 Click to Show/Hide the Full List
mod site chr3:138714514-138714515:- [6]
Sequence AAACGAAGAAATCAACGAAAACTATTAATCCCTCTAAATAT
Motif Score 2.627720238
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000289153.6; ENST00000477593.5; ENST00000462898.5; ENST00000493568.5
External Link RMBase: m6A_site_611982
mod ID: M6ASITE062507 Click to Show/Hide the Full List
mod site chr3:138714620-138714621:- [6]
Sequence AATGATCATATTTGGAATGAACCACTGGAATTTGATATTAA
Motif Score 2.930744048
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000289153.6; ENST00000462898.5; ENST00000477593.5; ENST00000493568.5
External Link RMBase: m6A_site_611983
mod ID: M6ASITE062508 Click to Show/Hide the Full List
mod site chr3:138714670-138714671:- [6]
Sequence GTACTGAGCTCCTGTGTAAAACCATCGTAAGCTCAGAGGTA
Motif Score 2.185083333
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000462898.5; ENST00000289153.6; ENST00000462294.1; ENST00000477593.5; ENST00000493568.5
External Link RMBase: m6A_site_611984
mod ID: M6ASITE062509 Click to Show/Hide the Full List
mod site chr3:138733368-138733369:- [6]
Sequence ATAAACTTAACACAGAGGAAACTGTAAAAGTGAGTACCCAC
Motif Score 2.627720238
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000462294.1; ENST00000462898.5; ENST00000477593.5; ENST00000289153.6
External Link RMBase: m6A_site_611985
mod ID: M6ASITE062510 Click to Show/Hide the Full List
mod site chr3:138733384-138733385:- [6]
Sequence GTCTTGGTTAAGGGAAATAAACTTAACACAGAGGAAACTGT
Motif Score 2.627720238
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000462294.1; ENST00000477593.5; ENST00000462898.5; ENST00000289153.6
External Link RMBase: m6A_site_611986
mod ID: M6ASITE062511 Click to Show/Hide the Full List
mod site chr3:138734647-138734648:- [6]
Sequence TTCCATTACCACCAAAGAAAACACGAATTATTTCTGTAAGT
Motif Score 2.20572619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000462294.1; ENST00000462898.5; ENST00000477593.5; ENST00000289153.6
External Link RMBase: m6A_site_611987
mod ID: M6ASITE062512 Click to Show/Hide the Full List
mod site chr3:138734723-138734724:- [6]
Sequence AAGATCAAGAAAATGTATGAACAAGAAATGATTGCCATAGA
Motif Score 2.951386905
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000289153.6; ENST00000462898.5; ENST00000477593.5; ENST00000462294.1
External Link RMBase: m6A_site_611988
mod ID: M6ASITE062513 Click to Show/Hide the Full List
mod site chr3:138734781-138734782:- [6]
Sequence TATCCGGAACTGTGTGATGAACAGAGCCCTGCCCCATTTTA
Motif Score 2.951386905
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000462294.1; ENST00000289153.6; ENST00000477593.5; ENST00000462898.5
External Link RMBase: m6A_site_611989
mod ID: M6ASITE062514 Click to Show/Hide the Full List
mod site chr3:138734793-138734794:- [6]
Sequence GCCCCTATAGTATATCCGGAACTGTGTGATGAACAGAGCCC
Motif Score 3.373380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000462294.1; ENST00000289153.6; ENST00000462898.5; ENST00000477593.5
External Link RMBase: m6A_site_611990
mod ID: M6ASITE062515 Click to Show/Hide the Full List
mod site chr3:138742564-138742565:- [6]
Sequence CGTAGCTGTTCATTTTGAAAACTGCCAGGTAGGATTATATT
Motif Score 2.627720238
Cell/Tissue List HeLa; CD34
Seq Type List m6A-seq
Transcript ID List ENST00000477593.5; ENST00000289153.6; ENST00000462294.1; ENST00000462898.5
External Link RMBase: m6A_site_611991
mod ID: M6ASITE062516 Click to Show/Hide the Full List
mod site chr3:138742605-138742606:- [6]
Sequence CCTGAAAACTTAGAAGATAAACTTTATGGGGGAAAGCTCAT
Motif Score 2.627720238
Cell/Tissue List HeLa; CD34
Seq Type List m6A-seq
Transcript ID List ENST00000462294.1; ENST00000289153.6; ENST00000477593.5; ENST00000462898.5
External Link RMBase: m6A_site_611992
mod ID: M6ASITE062517 Click to Show/Hide the Full List
mod site chr3:138742618-138742619:- [6]
Sequence TGAACCATCCATCCCTGAAAACTTAGAAGATAAACTTTATG
Motif Score 2.627720238
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000477593.5; ENST00000462898.5; ENST00000462294.1; ENST00000289153.6
External Link RMBase: m6A_site_611993
mod ID: M6ASITE062518 Click to Show/Hide the Full List
mod site chr3:138742635-138742636:- [6]
Sequence ACATATCCACCAGAGCATGAACCATCCATCCCTGAAAACTT
Motif Score 2.930744048
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000477593.5; ENST00000462294.1; ENST00000462898.5; ENST00000289153.6
External Link RMBase: m6A_site_611994
mod ID: M6ASITE062519 Click to Show/Hide the Full List
mod site chr3:138742659-138742660:- [6]
Sequence TCTTGGATGGACTGGCTAAAACAAACATATCCACCAGAGCA
Motif Score 2.20572619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000462898.5; ENST00000289153.6; ENST00000477593.5; ENST00000462294.1
External Link RMBase: m6A_site_611995
mod ID: M6ASITE062520 Click to Show/Hide the Full List
mod site chr3:138742669-138742670:- [6]
Sequence TGTGGGATTGTCTTGGATGGACTGGCTAAAACAAACATATC
Motif Score 4.065041667
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000477593.5; ENST00000462898.5; ENST00000289153.6; ENST00000462294.1
External Link RMBase: m6A_site_611996
mod ID: M6ASITE062521 Click to Show/Hide the Full List
mod site chr3:138755782-138755783:- [6]
Sequence TGACCCAGGGGAAAAATTAGACTCAAAAATTGGAGTCCTTA
Motif Score 3.319380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000483968.5; ENST00000462898.5; ENST00000477593.5; ENST00000289153.6
External Link RMBase: m6A_site_611997
mod ID: M6ASITE062522 Click to Show/Hide the Full List
mod site chr3:138755841-138755842:- [6]
Sequence CGAAGACTCTGTGATGTCAGACCTTTTCTTCCAGTTCTCAA
Motif Score 2.876744048
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000483968.5; ENST00000462898.5; ENST00000477593.5; ENST00000289153.6
External Link RMBase: m6A_site_611998
mod ID: M6ASITE062523 Click to Show/Hide the Full List
mod site chr3:138755856-138755857:- [6]
Sequence CTTGAAGATGAAACACGAAGACTCTGTGATGTCAGACCTTT
Motif Score 3.319380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000289153.6; ENST00000477593.5; ENST00000461451.1; ENST00000462898.5; ENST00000483968.5
External Link RMBase: m6A_site_611999
mod ID: M6ASITE062524 Click to Show/Hide the Full List
mod site chr3:138755864-138755865:- [6]
Sequence ATGAGGAGCTTGAAGATGAAACACGAAGACTCTGTGATGTC
Motif Score 2.20572619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000483968.5; ENST00000461451.1; ENST00000477593.5; ENST00000289153.6; ENST00000462898.5
External Link RMBase: m6A_site_612000
mod ID: M6ASITE062525 Click to Show/Hide the Full List
mod site chr3:138755894-138755895:- [6]
Sequence TGTTTGCATGTGTGAATCAGACTGCTGTATATGAGGAGCTT
Motif Score 3.319380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000289153.6; ENST00000462898.5; ENST00000483968.5; ENST00000461451.1; ENST00000477593.5
External Link RMBase: m6A_site_612001
mod ID: M6ASITE062526 Click to Show/Hide the Full List
mod site chr3:138759305-138759306:- [6]
Sequence AATGCCTCCTGCTATGGCAGACATCCTTGACATCTGGGCGG
Motif Score 2.897386905
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000462898.5; ENST00000483968.5; ENST00000465581.1; ENST00000477593.5; ENST00000461451.1; ENST00000289153.6
External Link RMBase: m6A_site_612002
mod ID: M6ASITE062527 Click to Show/Hide the Full List
mod site chr3:138770071-138770072:- [6]
Sequence AAACAGAAGAATGATACAAGACTGAGGATCTTGCCAGGCAA
Motif Score 3.319380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000483968.5; ENST00000461451.1; ENST00000477593.5; ENST00000465581.1; ENST00000462898.5
External Link RMBase: m6A_site_612003
mod ID: M6ASITE062528 Click to Show/Hide the Full List
mod site chr3:138770089-138770090:- [6]
Sequence TCTCTTGCTTTGATGCTCAAACAGAAGAATGATACAAGACT
Motif Score 2.20572619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000461451.1; ENST00000477593.5; ENST00000462898.5; ENST00000483968.5; ENST00000465581.1
External Link RMBase: m6A_site_612004
mod ID: M6ASITE062529 Click to Show/Hide the Full List
mod site chr3:138770133-138770134:- [6]
Sequence AAAGTTTTCATAGTTTAAAAACTCTGCTTGTCCTTAGCCTT
Motif Score 2.627720238
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000477593.5; ENST00000483968.5; ENST00000462898.5; ENST00000465581.1; ENST00000461451.1
External Link RMBase: m6A_site_612005
mod ID: M6ASITE062530 Click to Show/Hide the Full List
mod site chr3:138796487-138796488:- [6]
Sequence GCCATCTGTTTTCCTAAAAGACTGAAATGGGGGCGACCATT
Motif Score 3.319380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000483968.5; ENST00000477593.5; ENST00000461451.1; ENST00000462898.5
External Link RMBase: m6A_site_612006