m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00357)
Target Name Tumor protein 63 (TP63)
Synonyms
p63; Chronic ulcerative stomatitis protein; CUSP; Keratinocyte transcription factor KET; Transformation-related protein 63; TP63; Tumor protein p73-like; p73L; p40; p51; KET; P63; P73H; P73L; TP73L
    Click to Show/Hide
Gene Name TP63
Chromosomal Location 3q28
Family p53 family
Function
Acts as a sequence specific DNA binding transcriptional activator or repressor. The isoforms contain a varying set of transactivation and auto-regulating transactivation inhibiting domains thus showing an isoform specific activity. Isoform 2 activates RIPK4 transcription. May be required in conjunction with TP73/p73 for initiation of p53/TP53 dependent apoptosis in response to genotoxic insults and the presence of activated oncogenes. Involved in Notch signaling by probably inducing JAG1 and JAG2. Plays a role in the regulation of epithelial morphogenesis. The ratio of DeltaN-type and TA*-type isoforms may govern the maintenance of epithelial stem cell compartments and regulate the initiation of epithelial stratification from the undifferentiated embryonal ectoderm. Required for limb formation from the apical ectodermal ridge. Activates transcription of the p21 promoter.
    Click to Show/Hide
Gene ID 8626
Uniprot ID
P63_HUMAN
HGNC ID
HGNC:15979
KEGG ID
hsa:8626
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
TP63 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Methyltransferase-like 3 (METTL3) [WRITER]
 Regulator Info 
Representative RNA-seq result indicating the expression of this target gene regulated by METTL3
Cell Line mouse embryonic stem cells Mus musculus
Treatment: METTL3-/- ESCs
Control: Wild type ESCs
 GSE145309
Regulation
logFC: 4.35E+00
p-value: 1.15E-34
More Results Click to View More RNA-seq Results
Representative RIP-seq result supporting the interaction between TP63 and the regulator
Cell Line MDA-MB-231 Homo sapiens
Regulation logFC: 6.67E+00 GSE60213
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary METTL3 knock down and methylation inhibitor cycloleucine could decrease the m6A levels and the expression of DeltaNp63 in Cutaneous squamous cell carcinoma.
Target Regulation Up regulation
Responsed Disease Cutaneous squamous cell carcinoma ICD-11: 2C31.Z
 Disease Info 
Pathway Response Signaling pathways regulating pluripotency of stem cells hsa04550
Cell Process Cell proliferation
In-vitro Model A-431 Skin squamous cell carcinoma Homo sapiens CVCL_0037
HSC-1 Skin squamous cell carcinoma Homo sapiens CVCL_2807
In-vivo Model 2 × 106 cells were suspended in 150 uL DMEM. The A431 cells (scrambled group and shRNA1 group) were injected subcutaneously into the flanks of nude mice.
Lung cancer [ICD-11: 2C25]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response []
Response Summary In lung squamous cell carcinoma, seven m6A-related autophagy genes were screened to construct a prognostic model: CASP4, CDKN1A, DLC1, ITGB1, PINK1, Tumor protein 63 (TP63), and EIF4EBP1.
Responsed Disease Lung squamous cell carcinoma [ICD-11: 2C25.2]
Pathway Response Autophagy hsa04140
Cell Process Cell proliferation and metastasis
Cell autophagy
Cutaneous squamous cell carcinoma [ICD-11: 2C31]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [1]
Response Summary METTL3 knock down and methylation inhibitor cycloleucine could decrease the m6A levels and the expression of DeltaNp63 in Cutaneous squamous cell carcinoma.
Responsed Disease Cutaneous squamous cell carcinoma [ICD-11: 2C31.Z]
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
 Regulator Info 
Target Regulation Up regulation
Pathway Response Signaling pathways regulating pluripotency of stem cells hsa04550
Cell Process Cell proliferation
In-vitro Model A-431 Skin squamous cell carcinoma Homo sapiens CVCL_0037
HSC-1 Skin squamous cell carcinoma Homo sapiens CVCL_2807
In-vivo Model 2 × 106 cells were suspended in 150 uL DMEM. The A431 cells (scrambled group and shRNA1 group) were injected subcutaneously into the flanks of nude mice.
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00357)
Tumor protein 63 (TP63)
Adenosine-to-Inosine editing (A-to-I)
In total 1 m6A sequence/site(s) in this target gene
mod ID: A2ISITE000226 Click to Show/Hide the Full List
mod site chr3:189672464-189672465:+ [2]
Sequence GAACAAAATTAGCTGATCATAGTGGCACATGACTGTAGTCC
Transcript ID List ENST00000440651.6; ENST00000392460.7; rmsk_1200478; ENST00000418709.6; ENST00000320472.9; ENST00000486398.1; ENST00000264731.8
External Link RMBase: RNA-editing_site_101844
N6-methyladenosine (m6A)
In total 20 m6A sequence/site(s) in this target gene
mod ID: M6ASITE064051 Click to Show/Hide the Full List
mod site chr3:189631502-189631503:+ [3]
Sequence TCCGTTCGTTGATATCAAAGACAGTTGAAGGAAATGAATTT
Motif Score 2.897386905
Cell/Tissue List MT4
Seq Type List MeRIP-seq
Transcript ID List ENST00000486398.1; ENST00000320472.9; ENST00000264731.8; ENST00000418709.6
External Link RMBase: m6A_site_622736
mod ID: M6ASITE064052 Click to Show/Hide the Full List
mod site chr3:189631527-189631528:+ [3]
Sequence TGAAGGAAATGAATTTTGAAACTTCACGGTGTGCCACCCTA
Motif Score 2.627720238
Cell/Tissue List MT4
Seq Type List MeRIP-seq
Transcript ID List ENST00000486398.1; ENST00000440651.6; ENST00000320472.9; ENST00000264731.8; ENST00000418709.6; ENST00000392460.7
External Link RMBase: m6A_site_622737
mod ID: M6ASITE064053 Click to Show/Hide the Full List
mod site chr3:189737749-189737750:+ [3]
Sequence TCCTTTTAAGTTTCGTAGAAACCCCAGCTCATTTCTCTTGG
Motif Score 2.185083333
Cell/Tissue List MT4
Seq Type List MeRIP-seq
Transcript ID List ENST00000264731.8; ENST00000392460.7; ENST00000320472.9; ENST00000486398.1; ENST00000418709.6; ENST00000440651.6
External Link RMBase: m6A_site_622738
mod ID: M6ASITE064054 Click to Show/Hide the Full List
mod site chr3:189737812-189737813:+ [3]
Sequence CCATGTCCCAGAGCACACAGACAAATGAATTCCTCAGTCCA
Motif Score 2.897386905
Cell/Tissue List MT4
Seq Type List MeRIP-seq
Transcript ID List ENST00000392460.7; ENST00000264731.8; ENST00000418709.6; ENST00000440651.6; ENST00000320472.9; ENST00000486398.1
External Link RMBase: m6A_site_622739
mod ID: M6ASITE064055 Click to Show/Hide the Full List
mod site chr3:189789816-189789817:+ [3]
Sequence TAACATGTTGTACCTGGAAAACAATGCCCAGACTCAATTTA
Motif Score 2.20572619
Cell/Tissue List MT4
Seq Type List MeRIP-seq
Transcript ID List ENST00000392461.7; ENST00000434928.5; ENST00000264731.8; ENST00000320472.9; ENST00000456148.1; ENST00000460036.1; ENST00000418709.6; ENST00000437221.5; ENST00000440651.6; ENST00000449992.5; ENST00000354600.9; ENST00000392460.7; ENST00000392463.6
External Link RMBase: m6A_site_622740
mod ID: M6ASITE064056 Click to Show/Hide the Full List
mod site chr3:189789827-189789828:+ [3]
Sequence ACCTGGAAAACAATGCCCAGACTCAATTTAGTGAGGTAAGG
Motif Score 3.319380952
Cell/Tissue List MT4
Seq Type List MeRIP-seq
Transcript ID List ENST00000392460.7; ENST00000320472.9; ENST00000418709.6; ENST00000456148.1; ENST00000392463.6; ENST00000354600.9; ENST00000449992.5; ENST00000460036.1; ENST00000392461.7; ENST00000264731.8; ENST00000437221.5; ENST00000440651.6; ENST00000434928.5
External Link RMBase: m6A_site_622741
mod ID: M6ASITE064057 Click to Show/Hide the Full List
mod site chr3:189808284-189808285:+ [3]
Sequence CTTGCAGCCACAGTACACGAACCTGGGGCTCCTGAACAGCA
Motif Score 2.930744048
Cell/Tissue List MT4
Seq Type List MeRIP-seq
Transcript ID List ENST00000354600.9; ENST00000449992.5; ENST00000418709.6; ENST00000434928.5; ENST00000264731.8; ENST00000437221.5; ENST00000440651.6; ENST00000460036.1; ENST00000392461.7; ENST00000320472.9; ENST00000392460.7; ENST00000392463.6; ENST00000456148.1
External Link RMBase: m6A_site_622742
mod ID: M6ASITE064058 Click to Show/Hide the Full List
mod site chr3:189808299-189808300:+ [3]
Sequence CACGAACCTGGGGCTCCTGAACAGCATGGACCAGCAGATTC
Motif Score 2.951386905
Cell/Tissue List MT4
Seq Type List MeRIP-seq
Transcript ID List ENST00000434928.5; ENST00000449992.5; ENST00000264731.8; ENST00000460036.1; ENST00000392463.6; ENST00000440651.6; ENST00000392461.7; ENST00000456148.1; ENST00000437221.5; ENST00000354600.9; ENST00000320472.9; ENST00000418709.6; ENST00000392460.7
External Link RMBase: m6A_site_622743
mod ID: M6ASITE064059 Click to Show/Hide the Full List
mod site chr3:189808308-189808309:+ [3]
Sequence GGGGCTCCTGAACAGCATGGACCAGCAGATTCAGAACGGCT
Motif Score 3.622404762
Cell/Tissue List MT4
Seq Type List MeRIP-seq
Transcript ID List ENST00000434928.5; ENST00000456148.1; ENST00000392463.6; ENST00000449992.5; ENST00000418709.6; ENST00000264731.8; ENST00000354600.9; ENST00000437221.5; ENST00000440651.6; ENST00000460036.1; ENST00000392461.7; ENST00000392460.7; ENST00000320472.9
External Link RMBase: m6A_site_622744
mod ID: M6ASITE064060 Click to Show/Hide the Full List
mod site chr3:189808356-189808357:+ [3]
Sequence CACCAGTCCCTATAACACAGACCACGCGCAGAACAGCGTCA
Motif Score 2.876744048
Cell/Tissue List MT4
Seq Type List MeRIP-seq
Transcript ID List ENST00000418709.6; ENST00000460036.1; ENST00000440651.6; ENST00000392461.7; ENST00000392463.6; ENST00000449992.5; ENST00000456148.1; ENST00000320472.9; ENST00000264731.8; ENST00000354600.9; ENST00000392460.7; ENST00000437221.5; ENST00000434928.5
External Link RMBase: m6A_site_622745
mod ID: M6ASITE064061 Click to Show/Hide the Full List
mod site chr3:189808368-189808369:+ [3]
Sequence TAACACAGACCACGCGCAGAACAGCGTCACGGCGCCCTCGC
Motif Score 2.951386905
Cell/Tissue List MT4
Seq Type List MeRIP-seq
Transcript ID List ENST00000392463.6; ENST00000392460.7; ENST00000320472.9; ENST00000392461.7; ENST00000434928.5; ENST00000354600.9; ENST00000456148.1; ENST00000437221.5; ENST00000440651.6; ENST00000460036.1; ENST00000418709.6; ENST00000449992.5; ENST00000264731.8
External Link RMBase: m6A_site_622746
mod ID: M6ASITE064062 Click to Show/Hide the Full List
mod site chr3:189872873-189872874:+ [3]
Sequence CATAGGTGAGGGGCCGTGAGACTTATGAAATGCTGTTGAAG
Motif Score 3.319380952
Cell/Tissue List MT4
Seq Type List MeRIP-seq
Transcript ID List ENST00000418709.6; ENST00000456148.1; ENST00000437221.5; ENST00000354600.9; ENST00000392461.7; ENST00000460036.1; ENST00000440651.6; ENST00000264731.8; ENST00000392460.7; ENST00000449992.5; ENST00000392463.6; ENST00000320472.9
External Link RMBase: m6A_site_622747
mod ID: M6ASITE064063 Click to Show/Hide the Full List
mod site chr3:189872911-189872912:+ [3]
Sequence AAGATCAAAGAGTCCCTGGAACTCATGCAGTACCTTCCTCA
Motif Score 3.373380952
Cell/Tissue List MT4
Seq Type List MeRIP-seq
Transcript ID List ENST00000449992.5; ENST00000392460.7; ENST00000264731.8; ENST00000440651.6; ENST00000320472.9; ENST00000437221.5; ENST00000456148.1; ENST00000392463.6; ENST00000354600.9; ENST00000460036.1; ENST00000418709.6; ENST00000392461.7
External Link RMBase: m6A_site_622748
mod ID: M6ASITE064064 Click to Show/Hide the Full List
mod site chr3:189872992-189872993:+ [3]
Sequence CACCAGCACTTACTTCAGAAACAGTGAGTGTATCAACGTGT
Motif Score 2.20572619
Cell/Tissue List MT4
Seq Type List MeRIP-seq
Transcript ID List ENST00000418709.6; ENST00000460036.1; ENST00000440651.6; ENST00000320472.9; ENST00000354600.9; ENST00000392463.6; ENST00000392461.7; ENST00000264731.8; ENST00000437221.5; ENST00000392460.7; ENST00000456148.1; ENST00000449992.5
External Link RMBase: m6A_site_622749
mod ID: M6ASITE064065 Click to Show/Hide the Full List
mod site chr3:189873083-189873084:+ [3]
Sequence TGATTGATGAGCAATGTGGAACATAATGGGAGATAGCAGAT
Motif Score 2.951386905
Cell/Tissue List MT4
Seq Type List MeRIP-seq
Transcript ID List ENST00000320472.9; ENST00000449992.5; ENST00000354600.9; ENST00000264731.8; ENST00000460036.1; ENST00000392463.6; ENST00000440651.6; ENST00000392460.7; ENST00000392461.7; ENST00000418709.6; ENST00000437221.5; ENST00000456148.1
External Link RMBase: m6A_site_622750
mod ID: M6ASITE064066 Click to Show/Hide the Full List
mod site chr3:189889375-189889376:+ [3]
Sequence CCACATGCCAATGGCTGGAGACATGAATGGACTCAGCCCCA
Motif Score 2.897386905
Cell/Tissue List MT4
Seq Type List MeRIP-seq
Transcript ID List ENST00000392461.7; ENST00000392460.7; ENST00000456148.1; ENST00000449992.5; ENST00000320472.9; ENST00000392463.6; ENST00000440651.6; ENST00000264731.8; ENST00000354600.9
External Link RMBase: m6A_site_622751
mod ID: M6ASITE064067 Click to Show/Hide the Full List
mod site chr3:189889385-189889386:+ [3]
Sequence ATGGCTGGAGACATGAATGGACTCAGCCCCACCCAGGCACT
Motif Score 4.065041667
Cell/Tissue List MT4
Seq Type List MeRIP-seq
Transcript ID List ENST00000456148.1; ENST00000449992.5; ENST00000354600.9; ENST00000264731.8; ENST00000392461.7; ENST00000392463.6; ENST00000392460.7; ENST00000320472.9; ENST00000440651.6
External Link RMBase: m6A_site_622752
mod ID: M6ASITE064068 Click to Show/Hide the Full List
mod site chr3:189890823-189890824:+ [3]
Sequence GGGCTGTTCATCATGTCTGGACTATTTCACGACCCAGGGGC
Motif Score 4.065041667
Cell/Tissue List MT4
Seq Type List MeRIP-seq
Transcript ID List ENST00000392461.7; ENST00000392460.7; ENST00000320472.9; ENST00000449992.5; ENST00000392463.6; ENST00000456148.1; ENST00000264731.8; ENST00000440651.6; ENST00000354600.9
External Link RMBase: m6A_site_622753
mod ID: M6ASITE064069 Click to Show/Hide the Full List
mod site chr3:189894266-189894267:+ [3]
Sequence GATCTGGAAGGGCATCCTGGACCACCGGCAGCTCCACGAAT
Motif Score 3.622404762
Cell/Tissue List MT4
Seq Type List MeRIP-seq
Transcript ID List ENST00000354600.9; ENST00000320472.9; ENST00000264731.8; ENST00000440651.6; ENST00000449992.5; ENST00000456148.1
External Link RMBase: m6A_site_622754
mod ID: M6ASITE064070 Click to Show/Hide the Full List
mod site chr3:189894313-189894314:+ [3]
Sequence CCCCTTCTCATCTCCTGCGGACCCCAAGCAGTGCCTCTACA
Motif Score 3.622404762
Cell/Tissue List MT4
Seq Type List MeRIP-seq
Transcript ID List ENST00000456148.1; ENST00000440651.6; ENST00000449992.5; ENST00000320472.9; ENST00000354600.9; ENST00000264731.8
External Link RMBase: m6A_site_622755