m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00335)

Target Name	Matrix metalloproteinase-9 (MMP9)
Synonyms	MMP-9; 92 kDa gelatinase; 92 kDa type IV collagenase; Gelatinase B; GELB; CLG4B Click to Show/Hide
Gene Name	MMP9
Chromosomal Location	20q13.12
Family	peptidase M10A family
Function	Matrix metalloproteinase that plays an essential role in local proteolysis of the extracellular matrix and in leukocyte migration. Could play a role in bone osteoclastic resorption (By similarity). Cleaves KiSS1 at a Gly-\|-Leu bond. Cleaves NINJ1 to generate the Secreted ninjurin-1 form. Cleaves type IV and type V collagen into large C-terminal three quarter fragments and shorter N-terminal one quarter fragments. Click to Show/Hide
Gene ID	4318
Uniprot ID	MMP9_HUMAN
HGNC ID	HGNC:7176
KEGG ID	hsa:4318

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

MMP9 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Methyltransferase-like 3 (METTL3) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by METTL3*
Cell Line	LX2 cell line	Homo sapiens
Treatment: shMETTL3 LX2 cells Control: shLuc LX2 cells		GSE207909
Regulation		logFC: 2.14E+00 p-value: 4.12E-24
More Results	Click to View More RNA-seq Results

In total 2 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene			[1]
Response Summary	METTL3-mediated formation of EV miR-93, facilitated by m6A, is implicated in the aberrant cross-talk of epithelium-macrophages, indicating that this process is involved in the smoking-related emphysema. EV miR-93 was used as a novel risk biomarker for CS-induced emphysema. MiR-93 activated the JNK pathway by targeting dual-specificity phosphatase 2 (DUSP2), which elevated the levels of Matrix metalloproteinase-9 (MMP9) and matrix metalloproteinase 12 (MMP12) and induced elastin degradation, leading to emphysema.
Target Regulation	Down regulation
Responsed Disease	Emphysema	ICD-11: CA21	Disease Info
Pathway Response	MAPK signaling pathway		hsa04010
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene			[2]
Response Summary	METTL3 knockdown suppressed interleukin (IL)-6, matrix metalloproteinase (MMP)-3, and Matrix metalloproteinase-9 (MMP9) levels in human RA-FLSs and rat AIA-FLSs.
Target Regulation	Up regulation
Responsed Disease	Rheumatoid arthritis	ICD-11: FA20	Disease Info
Cell Process	Inflammatory response
In-vitro Model	FLS (Rat fibroblast synovial cell line)
In-vivo Model	To establish the adjuvant-induced arthritis (AIA) model, the rats were given complete Freund's adjuvant (CFA; Chondrex, Inc.) on the left paw of 0.1 ml per 100 g of body weight. Additionally, the rats were injected with normal saline to create the negative control (NC) group.

E3 ubiquitin-protein ligase Hakai (CBLL1) [WRITER]

Regulator Info

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[3]
Response Summary	CBLL1 was frequently upregulated in non-small lung cancer (NSCLC) tissues compared to the adjacent nontumor tissues. CBLL1 knockdown inhibited cell invasion via increased E-cadherin protein expression, and decreased expression of MMP2 and Matrix metalloproteinase-9 (MMP9) in NSCLC cell lines.
Responsed Disease	Non-small-cell lung carcinoma		ICD-11: 2C25.Y	Disease Info
In-vitro Model	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
	NCI-H1299	Lung large cell carcinoma	Homo sapiens	CVCL_0060
	SK-MES-1	Lung squamous cell carcinoma	Homo sapiens	CVCL_0630

Lung cancer [ICD-11: 2C25]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[3]
Response Summary	CBLL1 was frequently upregulated in non-small lung cancer (NSCLC) tissues compared to the adjacent nontumor tissues. CBLL1 knockdown inhibited cell invasion via increased E-cadherin protein expression, and decreased expression of MMP2 and Matrix metalloproteinase-9 (MMP9) in NSCLC cell lines.
Responsed Disease	Non-small-cell lung carcinoma [ICD-11: 2C25.Y]
Target Regulator	E3 ubiquitin-protein ligase Hakai (CBLL1)		WRITER	Regulator Info
In-vitro Model	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
	NCI-H1299	Lung large cell carcinoma	Homo sapiens	CVCL_0060
	SK-MES-1	Lung squamous cell carcinoma	Homo sapiens	CVCL_0630

Emphysema [ICD-11: CA21]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response			[1]
Response Summary	METTL3-mediated formation of EV miR-93, facilitated by m6A, is implicated in the aberrant cross-talk of epithelium-macrophages, indicating that this process is involved in the smoking-related emphysema. EV miR-93 was used as a novel risk biomarker for CS-induced emphysema. MiR-93 activated the JNK pathway by targeting dual-specificity phosphatase 2 (DUSP2), which elevated the levels of Matrix metalloproteinase-9 (MMP9) and matrix metalloproteinase 12 (MMP12) and induced elastin degradation, leading to emphysema.
Responsed Disease	Emphysema [ICD-11: CA21]
Target Regulator	Methyltransferase-like 3 (METTL3)	WRITER	Regulator Info
Target Regulation	Down regulation
Pathway Response	MAPK signaling pathway		hsa04010

Rheumatoid arthritis [ICD-11: FA20]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response			[2]
Response Summary	METTL3 knockdown suppressed interleukin (IL)-6, matrix metalloproteinase (MMP)-3, and Matrix metalloproteinase-9 (MMP9) levels in human RA-FLSs and rat AIA-FLSs.
Responsed Disease	Rheumatoid arthritis [ICD-11: FA20]
Target Regulator	Methyltransferase-like 3 (METTL3)	WRITER	Regulator Info
Target Regulation	Up regulation
Cell Process	Inflammatory response
In-vitro Model	FLS (Rat fibroblast synovial cell line)
In-vivo Model	To establish the adjuvant-induced arthritis (AIA) model, the rats were given complete Freund's adjuvant (CFA; Chondrex, Inc.) on the left paw of 0.1 ml per 100 g of body weight. Additionally, the rats were injected with normal saline to create the negative control (NC) group.

Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator

Non-coding RNA

m6A Regulator: RNA demethylase ALKBH5 (ALKBH5)

Regulator Info

In total 2 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05233		Crosstalk Info
Epigenetic Regulator	Metastasis associated lung adenocarcinoma transcript 1 (MALAT1)
Regulated Target	hsa-miR-141-3p
Crosstalk relationship	ncRNA → m6A
Disease	Cervical cancer	Disease Info
Crosstalk ID: M6ACROT05234		Crosstalk Info
Epigenetic Regulator	hsa-miR-141-3p
Regulated Target	RNA demethylase ALKBH5 (ALKBH5)
Crosstalk relationship	ncRNA → m6A
Disease	Cervical cancer	Disease Info

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00335)

Matrix metalloproteinase-9 (MMP9)

N6-methyladenosine (m6A)

In total 15 m6A sequence/site(s) in this target gene
mod ID: M6ASITE053285		Click to Show/Hide the Full List
mod site	chr20:46008909-46008910:+		[6]
Sequence	ACAACAGCAGCTGCAGTCAGACACCTCTGCCCTCACCATGA
Motif Score	2.897386905
Cell/Tissue List	CD4T; endometrial; NB4
Seq Type List	m6A-seq
Transcript ID List	ENST00000372330.3
External Link	RMBase: m6A_site_534235
mod ID: M6ASITE053286		Click to Show/Hide the Full List
mod site	chr20:46008991-46008992:+		[6]
Sequence	TGCTGCTTTGCTGCCCCCAGACAGCGCCAGTCCACCCTTGT
Motif Score	2.897386905
Cell/Tissue List	CD4T; MSC; endometrial; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000372330.3
External Link	RMBase: m6A_site_534236
mod ID: M6ASITE053287		Click to Show/Hide the Full List
mod site	chr20:46009026-46009027:+		[6]
Sequence	CCTTGTGCTCTTCCCTGGAGACCTGAGAACCAATCTCACCG
Motif Score	2.876744048
Cell/Tissue List	CD4T; endometrial; NB4
Seq Type List	m6A-seq
Transcript ID List	ENST00000372330.3
External Link	RMBase: m6A_site_534237
mod ID: M6ASITE053288		Click to Show/Hide the Full List
mod site	chr20:46009034-46009035:+		[6]
Sequence	TCTTCCCTGGAGACCTGAGAACCAATCTCACCGACAGGCAG
Motif Score	2.930744048
Cell/Tissue List	CD4T; MSC; endometrial; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000372330.3
External Link	RMBase: m6A_site_534238
mod ID: M6ASITE053289		Click to Show/Hide the Full List
mod site	chr20:46009973-46009974:+		[7]
Sequence	AGCAACTGTCCCTGCCCGAGACCGGTGAGCTGGATAGCGCC
Motif Score	2.876744048
Cell/Tissue List	endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000372330.3
External Link	RMBase: m6A_site_534239
mod ID: M6ASITE053290		Click to Show/Hide the Full List
mod site	chr20:46010012-46010013:+		[7]
Sequence	CCACGCTGAAGGCCATGCGAACCCCACGGTGCGGGGTCCCA
Motif Score	2.930744048
Cell/Tissue List	endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000372330.3
External Link	RMBase: m6A_site_534240
mod ID: M6ASITE053291		Click to Show/Hide the Full List
mod site	chr20:46010034-46010035:+		[7]
Sequence	CCCACGGTGCGGGGTCCCAGACCTGGGCAGATTCCAAACCT
Motif Score	2.876744048
Cell/Tissue List	endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000372330.3
External Link	RMBase: m6A_site_534241
mod ID: M6ASITE053292		Click to Show/Hide the Full List
mod site	chr20:46013336-46013337:+		[7]
Sequence	CCGACGGTCTGCCCCACCGGACCCCCCACTGTCCACCCCTC
Motif Score	3.622404762
Cell/Tissue List	endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000372330.3
External Link	RMBase: m6A_site_534242
mod ID: M6ASITE053293		Click to Show/Hide the Full List
mod site	chr20:46013479-46013480:+		[8]
Sequence	GGACGATGCCTGCAACGTGAACATCTTCGACGCCATCGCGG
Motif Score	2.951386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000372330.3
External Link	RMBase: m6A_site_534243
mod ID: M6ASITE053294		Click to Show/Hide the Full List
mod site	chr20:46013509-46013510:+		[8]
Sequence	CGCCATCGCGGAGATTGGGAACCAGCTGTATTTGTTCAAGG
Motif Score	2.930744048
Cell/Tissue List	HeLa; HEK293T; MM6
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000372330.3
External Link	RMBase: m6A_site_534244
mod ID: M6ASITE053295		Click to Show/Hide the Full List
mod site	chr20:46013748-46013749:+		[8]
Sequence	CGCGCTGCCCCGCAAGCTGGACTCGGTCTTTGAGGAGCGGC
Motif Score	4.065041667
Cell/Tissue List	HeLa; HepG2; HEK293T; H1A; H1B; MM6; HEK293A-TOA; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000372330.3
External Link	RMBase: m6A_site_534247
mod ID: M6ASITE053296		Click to Show/Hide the Full List
mod site	chr20:46014177-46014178:+		[8]
Sequence	GCTGGGCCCGAGGCGTCTGGACAAGCTGGGCCTGGGAGCCG
Motif Score	3.643047619
Cell/Tissue List	HeLa; HEK293T; H1A; HEK293A-TOA; TREX
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000372330.3
External Link	RMBase: m6A_site_534251
mod ID: M6ASITE053297		Click to Show/Hide the Full List
mod site	chr20:46014420-46014421:+		[9]
Sequence	CCGGAGCGCCAGCGAGGTGGACCGGATGTTCCCCGGGGTGC
Motif Score	3.622404762
Cell/Tissue List	HEK293T; endometrial; NB4
Seq Type List	m6A-seq
Transcript ID List	ENST00000372330.3
External Link	RMBase: m6A_site_534256
mod ID: M6ASITE053298		Click to Show/Hide the Full List
mod site	chr20:46014447-46014448:+		[8]
Sequence	GTTCCCCGGGGTGCCTTTGGACACGCACGACGTCTTCCAGT
Motif Score	3.643047619
Cell/Tissue List	HeLa; HEK293T; endometrial; NB4
Seq Type List	m6A-seq
Transcript ID List	ENST00000372330.3
External Link	RMBase: m6A_site_534258
mod ID: M6ASITE053299		Click to Show/Hide the Full List
mod site	chr20:46016270-46016271:+		[8]
Sequence	GAAAGCCTATTTCTGCCAGGACCGCTTCTACTGGCGCGTGA
Motif Score	3.622404762
Cell/Tissue List	HeLa; HEK293T
Seq Type List	m6A-seq
Transcript ID List	ENST00000372330.3
External Link	RMBase: m6A_site_534260

Ref 1	The aberrant cross-talk of epithelium-macrophages via METTL3-regulated extracellular vesicle miR-93 in smoking-induced emphysema. Cell Biol Toxicol. 2022 Feb;38(1):167-183. doi: 10.1007/s10565-021-09585-1. Epub 2021 Mar 4.
Ref 2	METTL3 Promotes Activation and Inflammation of FLSs Through the NF-KappaB Signaling Pathway in Rheumatoid Arthritis. Front Med (Lausanne). 2021 Jul 6;8:607585. doi: 10.3389/fmed.2021.607585. eCollection 2021.
Ref 3	CBLL1 is highly expressed in non-small cell lung cancer and promotes cell proliferation and invasion. Thorac Cancer. 2019 Jun;10(6):1479-1488. doi: 10.1111/1759-7714.13097. Epub 2019 May 23.
Ref 4	Moxidectin and the avermectins: Consanguinity but not identity. Int J Parasitol Drugs Drug Resist. 2012 Apr 14;2:134-53. doi: 10.1016/j.ijpddr.2012.04.001. eCollection 2012 Dec.
Ref 5	ClinicalTrials.gov (NCT04050709) QUILT 3.064: PD-L1 t-haNK In Subjects With Locally Advanced Or Metastatic Solid Cancers. U.S. National Institutes of Health.
Ref 6	N(6)-methyladenosine of HIV-1 RNA regulates viral infection and HIV-1 Gag protein expression. Elife. 2016 Jul 2;5:e15528. doi: 10.7554/eLife.15528.
Ref 7	m(6)A mRNA methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer. Nat Cell Biol. 2018 Sep;20(9):1074-1083. doi: 10.1038/s41556-018-0174-4. Epub 2018 Aug 27.
Ref 8	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 9	Dynamics of Human and Viral RNA Methylation during Zika Virus Infection. Cell Host Microbe. 2016 Nov 9;20(5):666-673. doi: 10.1016/j.chom.2016.10.002. Epub 2016 Oct 20.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map