m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00331)
Target Name Microtubule-associated proteins 1A/1B light chain 3B (MAP1LC3B/LC3B-II)
Synonyms
Autophagy-related protein LC3 B; Autophagy-related ubiquitin-like modifier LC3 B; MAP1 light chain 3-like protein 2; MAP1A/MAP1B light chain 3 B; MAP1A/MAP1B LC3 B; Microtubule-associated protein 1 light chain 3 beta; MAP1ALC3
    Click to Show/Hide
Gene Name MAP1LC3B
Chromosomal Location 16q24.2
Family ATG8 family
Function
Ubiquitin-like modifier involved in formation of autophagosomal vacuoles (autophagosomes). Plays a role in mitophagy which contributes to regulate mitochondrial quantity and quality by eliminating the mitochondria to a basal level to fulfill cellular energy requirements and preventing excess ROS production. In response to cellular stress and upon mitochondria fission, binds C-18 ceramides and anchors autophagolysosomes to outer mitochondrial membranes to eliminate damaged mitochondria. While LC3s are involved in elongation of the phagophore membrane, the GABARAP/GATE-16 subfamily is essential for a later stage in autophagosome maturation. Promotes primary ciliogenesis by removing OFD1 from centriolar satellites via the autophagic pathway. Through its interaction with the reticulophagy receptor TEX264, participates in the remodeling of subdomains of the endoplasmic reticulum into autophagosomes upon nutrient stress, which then fuse with lysosomes for endoplasmic reticulum turnover . Upon nutrient stress, directly recruits cofactor JMY to the phagophore membrane surfaces and promotes JMY's actin nucleation activity and autophagosome biogenesis during autophagy .
    Click to Show/Hide
Gene ID 81631
Uniprot ID
MLP3B_HUMAN
HGNC ID
HGNC:13352
KEGG ID
hsa:81631
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
MAP1LC3B can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Browse Drug
Methyltransferase-like 3 (METTL3) [WRITER]
 Regulator Info 
Representative RNA-seq result indicating the expression of this target gene regulated by METTL3
Cell Line LX2 cell line Homo sapiens
Treatment: shMETTL3 LX2 cells
Control: shLuc LX2 cells
 GSE207909
Regulation
logFC: 6.38E-01
p-value: 4.93E-09
More Results Click to View More RNA-seq Results
Representative RIP-seq result supporting the interaction between MAP1LC3B and the regulator
Cell Line MDA-MB-231 Homo sapiens
Regulation logFC: 1.34E+00 GSE60213
In total 4 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary Knocking down METTL3 prevented Enterovirus 71-induced cell death and suppressed Enterovirus 71-induced expression of Bax while rescuing Bcl-2 expression after Enterovirus 71 infection. Knocking down METTL3 inhibited Enterovirus 71-induced expression of Atg5, Atg7 and Microtubule-associated proteins 1A/1B light chain 3B (MAP1LC3B/LC3B-II). Knocking down METTL3 inhibited Enterovirus 71-induced apoptosis and autophagy.
Target Regulation Up regulation
Responsed Disease Enterovirus ICD-11: 1A2Y
 Disease Info 
Pathway Response Autophagy hsa04140
Cell Process Cell proliferation and metastasis
Cell apoptosis
Cell autophagy
In-vitro Model Schwann cells (A type of glial cell that surrounds neurons)
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene [2]
Response Summary METTL3 could positively regulate the autophagy by targeting the autophagy-related genes such as ATG5, ATG7, LC3B, and SQSTM1. beta-elemene inhibited the autophagy flux by preventing autophagic lysosome acidification, resulting in increasing expression of SQSTM1 and Microtubule-associated proteins 1A/1B light chain 3B (MAP1LC3B/LC3B-II). beta-elemene could reverse gefitinib resistance in non-small cell lung cancer cells by inhibiting cell autophagy process in a manner of chloroquine. METTL3-mediated autophagy in reversing gefitinib resistance of NSCLC cells by beta-elemene, which shed light on providing potential molecular-therapy target and clinical-treatment method in NSCLC patients with gefitinib resistance.
Target Regulation Up regulation
Responsed Disease Non-small-cell lung carcinoma ICD-11: 2C25.Y
 Disease Info 
Responsed Drug Chloroquine Approved
 Drug Info 
Pathway Response Autophagy hsa04140
Cell Process Autophagic lysosome acidification
In-vitro Model Gefitinib-resistant cell line HCC827GR (Gefitinib-resistant HCC827 cell line)
Gefitinib-resistant cell line PC9GR (Gefitinib-resistant PC9 cell line)
HCC827 Lung adenocarcinoma Homo sapiens CVCL_2063
PC-9 Lung adenocarcinoma Homo sapiens CVCL_B260
In-vivo Model NSCLC gefitinib-resistant cells (5 × 106 cells in 100 uL PBS) were injected subcutaneously into the lateral surface of the left abdomen of 6-week-old female BALB/c nude mice (at least five mice per group to ensure accuracy).
Experiment 3 Reporting the m6A Methylation Regulator of This Target Gene [2]
Response Summary METTL3 could positively regulate the autophagy by targeting the autophagy-related genes such as ATG5, ATG7, LC3B, and SQSTM1. beta-elemene inhibited the autophagy flux by preventing autophagic lysosome acidification, resulting in increasing expression of SQSTM1 and Microtubule-associated proteins 1A/1B light chain 3B (MAP1LC3B/LC3B-II). beta-elemene could reverse gefitinib resistance in non-small cell lung cancer cells by inhibiting cell autophagy process in a manner of chloroquine. METTL3-mediated autophagy in reversing gefitinib resistance of NSCLC cells by beta-elemene, which shed light on providing potential molecular-therapy target and clinical-treatment method in NSCLC patients with gefitinib resistance.
Target Regulation Up regulation
Responsed Disease Non-small-cell lung carcinoma ICD-11: 2C25.Y
 Disease Info 
Responsed Drug Gefitinib Approved
 Drug Info 
Pathway Response Autophagy hsa04140
Cell Process Autophagic lysosome acidification
In-vitro Model Gefitinib-resistant cell line HCC827GR (Gefitinib-resistant HCC827 cell line)
Gefitinib-resistant cell line PC9GR (Gefitinib-resistant PC9 cell line)
HCC827 Lung adenocarcinoma Homo sapiens CVCL_2063
PC-9 Lung adenocarcinoma Homo sapiens CVCL_B260
In-vivo Model NSCLC gefitinib-resistant cells (5 × 106 cells in 100 uL PBS) were injected subcutaneously into the lateral surface of the left abdomen of 6-week-old female BALB/c nude mice (at least five mice per group to ensure accuracy).
Experiment 4 Reporting the m6A Methylation Regulator of This Target Gene [2]
Response Summary METTL3 could positively regulate the autophagy by targeting the autophagy-related genes such as ATG5, ATG7, LC3B, and SQSTM1. beta-elemene inhibited the autophagy flux by preventing autophagic lysosome acidification, resulting in increasing expression of SQSTM1 and Microtubule-associated proteins 1A/1B light chain 3B (MAP1LC3B/LC3B-II). beta-elemene could reverse gefitinib resistance in non-small cell lung cancer cells by inhibiting cell autophagy process in a manner of chloroquine. METTL3-mediated autophagy in reversing gefitinib resistance of NSCLC cells by beta-elemene, which shed light on providing potential molecular-therapy target and clinical-treatment method in NSCLC patients with gefitinib resistance.
Target Regulation Up regulation
Responsed Disease Non-small-cell lung carcinoma ICD-11: 2C25.Y
 Disease Info 
Responsed Drug Beta-Elemen Phase 3
 Drug Info 
Pathway Response Autophagy hsa04140
Cell Process Autophagic lysosome acidification
In-vitro Model Gefitinib-resistant cell line HCC827GR (Gefitinib-resistant HCC827 cell line)
Gefitinib-resistant cell line PC9GR (Gefitinib-resistant PC9 cell line)
HCC827 Lung adenocarcinoma Homo sapiens CVCL_2063
PC-9 Lung adenocarcinoma Homo sapiens CVCL_B260
In-vivo Model NSCLC gefitinib-resistant cells (5 × 106 cells in 100 uL PBS) were injected subcutaneously into the lateral surface of the left abdomen of 6-week-old female BALB/c nude mice (at least five mice per group to ensure accuracy).
Enterovirus [ICD-11: 1A2Y]
 Disease Info 
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [1]
Response Summary Knocking down METTL3 prevented Enterovirus 71-induced cell death and suppressed Enterovirus 71-induced expression of Bax while rescuing Bcl-2 expression after Enterovirus 71 infection. Knocking down METTL3 inhibited Enterovirus 71-induced expression of Atg5, Atg7 and Microtubule-associated proteins 1A/1B light chain 3B (MAP1LC3B/LC3B-II). Knocking down METTL3 inhibited Enterovirus 71-induced apoptosis and autophagy.
Responsed Disease Enterovirus [ICD-11: 1A2Y]
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
 Regulator Info 
Target Regulation Up regulation
Pathway Response Autophagy hsa04140
Cell Process Cell proliferation and metastasis
Cell apoptosis
Cell autophagy
In-vitro Model Schwann cells (A type of glial cell that surrounds neurons)
Lung cancer [ICD-11: 2C25]
 Disease Info 
In total 3 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [2]
Response Summary METTL3 could positively regulate the autophagy by targeting the autophagy-related genes such as ATG5, ATG7, LC3B, and SQSTM1. beta-elemene inhibited the autophagy flux by preventing autophagic lysosome acidification, resulting in increasing expression of SQSTM1 and Microtubule-associated proteins 1A/1B light chain 3B (MAP1LC3B/LC3B-II). beta-elemene could reverse gefitinib resistance in non-small cell lung cancer cells by inhibiting cell autophagy process in a manner of chloroquine. METTL3-mediated autophagy in reversing gefitinib resistance of NSCLC cells by beta-elemene, which shed light on providing potential molecular-therapy target and clinical-treatment method in NSCLC patients with gefitinib resistance.
Responsed Disease Non-small-cell lung carcinoma [ICD-11: 2C25.Y]
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
 Regulator Info 
Target Regulation Up regulation
Responsed Drug Chloroquine Approved
 Drug Info 
Pathway Response Autophagy hsa04140
Cell Process Autophagic lysosome acidification
In-vitro Model Gefitinib-resistant cell line HCC827GR (Gefitinib-resistant HCC827 cell line)
Gefitinib-resistant cell line PC9GR (Gefitinib-resistant PC9 cell line)
HCC827 Lung adenocarcinoma Homo sapiens CVCL_2063
PC-9 Lung adenocarcinoma Homo sapiens CVCL_B260
In-vivo Model NSCLC gefitinib-resistant cells (5 × 106 cells in 100 uL PBS) were injected subcutaneously into the lateral surface of the left abdomen of 6-week-old female BALB/c nude mice (at least five mice per group to ensure accuracy).
Experiment 2 Reporting the m6A-centered Disease Response [2]
Response Summary METTL3 could positively regulate the autophagy by targeting the autophagy-related genes such as ATG5, ATG7, LC3B, and SQSTM1. beta-elemene inhibited the autophagy flux by preventing autophagic lysosome acidification, resulting in increasing expression of SQSTM1 and Microtubule-associated proteins 1A/1B light chain 3B (MAP1LC3B/LC3B-II). beta-elemene could reverse gefitinib resistance in non-small cell lung cancer cells by inhibiting cell autophagy process in a manner of chloroquine. METTL3-mediated autophagy in reversing gefitinib resistance of NSCLC cells by beta-elemene, which shed light on providing potential molecular-therapy target and clinical-treatment method in NSCLC patients with gefitinib resistance.
Responsed Disease Non-small-cell lung carcinoma [ICD-11: 2C25.Y]
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
 Regulator Info 
Target Regulation Up regulation
Responsed Drug Gefitinib Approved
 Drug Info 
Pathway Response Autophagy hsa04140
Cell Process Autophagic lysosome acidification
In-vitro Model Gefitinib-resistant cell line HCC827GR (Gefitinib-resistant HCC827 cell line)
Gefitinib-resistant cell line PC9GR (Gefitinib-resistant PC9 cell line)
HCC827 Lung adenocarcinoma Homo sapiens CVCL_2063
PC-9 Lung adenocarcinoma Homo sapiens CVCL_B260
In-vivo Model NSCLC gefitinib-resistant cells (5 × 106 cells in 100 uL PBS) were injected subcutaneously into the lateral surface of the left abdomen of 6-week-old female BALB/c nude mice (at least five mice per group to ensure accuracy).
Experiment 3 Reporting the m6A-centered Disease Response [2]
Response Summary METTL3 could positively regulate the autophagy by targeting the autophagy-related genes such as ATG5, ATG7, LC3B, and SQSTM1. beta-elemene inhibited the autophagy flux by preventing autophagic lysosome acidification, resulting in increasing expression of SQSTM1 and Microtubule-associated proteins 1A/1B light chain 3B (MAP1LC3B/LC3B-II). beta-elemene could reverse gefitinib resistance in non-small cell lung cancer cells by inhibiting cell autophagy process in a manner of chloroquine. METTL3-mediated autophagy in reversing gefitinib resistance of NSCLC cells by beta-elemene, which shed light on providing potential molecular-therapy target and clinical-treatment method in NSCLC patients with gefitinib resistance.
Responsed Disease Non-small-cell lung carcinoma [ICD-11: 2C25.Y]
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
 Regulator Info 
Target Regulation Up regulation
Responsed Drug Beta-Elemen Phase 3
 Drug Info 
Pathway Response Autophagy hsa04140
Cell Process Autophagic lysosome acidification
In-vitro Model Gefitinib-resistant cell line HCC827GR (Gefitinib-resistant HCC827 cell line)
Gefitinib-resistant cell line PC9GR (Gefitinib-resistant PC9 cell line)
HCC827 Lung adenocarcinoma Homo sapiens CVCL_2063
PC-9 Lung adenocarcinoma Homo sapiens CVCL_B260
In-vivo Model NSCLC gefitinib-resistant cells (5 × 106 cells in 100 uL PBS) were injected subcutaneously into the lateral surface of the left abdomen of 6-week-old female BALB/c nude mice (at least five mice per group to ensure accuracy).
Chloroquine [Approved]
 Drug Info 
In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response [2]
Response Summary METTL3 could positively regulate the autophagy by targeting the autophagy-related genes such as ATG5, ATG7, LC3B, and SQSTM1. beta-elemene inhibited the autophagy flux by preventing autophagic lysosome acidification, resulting in increasing expression of SQSTM1 and Microtubule-associated proteins 1A/1B light chain 3B (MAP1LC3B/LC3B-II). beta-elemene could reverse gefitinib resistance in non-small cell lung cancer cells by inhibiting cell autophagy process in a manner of chloroquine. METTL3-mediated autophagy in reversing gefitinib resistance of NSCLC cells by beta-elemene, which shed light on providing potential molecular-therapy target and clinical-treatment method in NSCLC patients with gefitinib resistance.
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
 Regulator Info 
Target Regulation Up regulation
Responsed Disease Non-small-cell lung carcinoma ICD-11: 2C25.Y
 Disease Info 
Pathway Response Autophagy hsa04140
Cell Process Autophagic lysosome acidification
In-vitro Model Gefitinib-resistant cell line HCC827GR (Gefitinib-resistant HCC827 cell line)
Gefitinib-resistant cell line PC9GR (Gefitinib-resistant PC9 cell line)
HCC827 Lung adenocarcinoma Homo sapiens CVCL_2063
PC-9 Lung adenocarcinoma Homo sapiens CVCL_B260
In-vivo Model NSCLC gefitinib-resistant cells (5 × 106 cells in 100 uL PBS) were injected subcutaneously into the lateral surface of the left abdomen of 6-week-old female BALB/c nude mice (at least five mice per group to ensure accuracy).
Gefitinib [Approved]
 Drug Info 
In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response [2]
Response Summary METTL3 could positively regulate the autophagy by targeting the autophagy-related genes such as ATG5, ATG7, LC3B, and SQSTM1. beta-elemene inhibited the autophagy flux by preventing autophagic lysosome acidification, resulting in increasing expression of SQSTM1 and Microtubule-associated proteins 1A/1B light chain 3B (MAP1LC3B/LC3B-II). beta-elemene could reverse gefitinib resistance in non-small cell lung cancer cells by inhibiting cell autophagy process in a manner of chloroquine. METTL3-mediated autophagy in reversing gefitinib resistance of NSCLC cells by beta-elemene, which shed light on providing potential molecular-therapy target and clinical-treatment method in NSCLC patients with gefitinib resistance.
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
 Regulator Info 
Target Regulation Up regulation
Responsed Disease Non-small-cell lung carcinoma ICD-11: 2C25.Y
 Disease Info 
Pathway Response Autophagy hsa04140
Cell Process Autophagic lysosome acidification
In-vitro Model Gefitinib-resistant cell line HCC827GR (Gefitinib-resistant HCC827 cell line)
Gefitinib-resistant cell line PC9GR (Gefitinib-resistant PC9 cell line)
HCC827 Lung adenocarcinoma Homo sapiens CVCL_2063
PC-9 Lung adenocarcinoma Homo sapiens CVCL_B260
In-vivo Model NSCLC gefitinib-resistant cells (5 × 106 cells in 100 uL PBS) were injected subcutaneously into the lateral surface of the left abdomen of 6-week-old female BALB/c nude mice (at least five mice per group to ensure accuracy).
Beta-Elemen [Phase 3]
 Drug Info 
In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response [2]
Response Summary METTL3 could positively regulate the autophagy by targeting the autophagy-related genes such as ATG5, ATG7, LC3B, and SQSTM1. beta-elemene inhibited the autophagy flux by preventing autophagic lysosome acidification, resulting in increasing expression of SQSTM1 and Microtubule-associated proteins 1A/1B light chain 3B (MAP1LC3B/LC3B-II). beta-elemene could reverse gefitinib resistance in non-small cell lung cancer cells by inhibiting cell autophagy process in a manner of chloroquine. METTL3-mediated autophagy in reversing gefitinib resistance of NSCLC cells by beta-elemene, which shed light on providing potential molecular-therapy target and clinical-treatment method in NSCLC patients with gefitinib resistance.
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
 Regulator Info 
Target Regulation Up regulation
Responsed Disease Non-small-cell lung carcinoma ICD-11: 2C25.Y
 Disease Info 
Pathway Response Autophagy hsa04140
Cell Process Autophagic lysosome acidification
In-vitro Model Gefitinib-resistant cell line HCC827GR (Gefitinib-resistant HCC827 cell line)
Gefitinib-resistant cell line PC9GR (Gefitinib-resistant PC9 cell line)
HCC827 Lung adenocarcinoma Homo sapiens CVCL_2063
PC-9 Lung adenocarcinoma Homo sapiens CVCL_B260
In-vivo Model NSCLC gefitinib-resistant cells (5 × 106 cells in 100 uL PBS) were injected subcutaneously into the lateral surface of the left abdomen of 6-week-old female BALB/c nude mice (at least five mice per group to ensure accuracy).
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00331)
Microtubule-associated proteins 1A/1B light chain 3B (MAP1LC3B/LC3B-II)
Adenosine-to-Inosine editing (A-to-I)
In total 39 m6A sequence/site(s) in this target gene
mod ID: A2ISITE007568 Click to Show/Hide the Full List
mod site chr16:87394522-87394523:+ [4]
Sequence CAGGATTGACAGGGTTCTCAAAGTTGAAATGGATTTTAAGG
Transcript ID List ENST00000268607.9; ENST00000650688.1; ENST00000564638.1; ENST00000564844.1; ENST00000565788.1; ENST00000570189.5
External Link RMBase: RNA-editing_site_53352
mod ID: A2ISITE007569 Click to Show/Hide the Full List
mod site chr16:87396181-87396182:+ [5]
Sequence AACCTAGTTTCCTATATTAAAAAAATGTTTCCAGCCGGGTG
Transcript ID List ENST00000564638.1; ENST00000564844.1; ENST00000650688.1; ENST00000268607.9; ENST00000570189.5; ENST00000565788.1
External Link RMBase: RNA-editing_site_53353
mod ID: A2ISITE007570 Click to Show/Hide the Full List
mod site chr16:87396219-87396220:+ [5]
Sequence GTGTGGTGGCACATGCCTGTAATCCCAACATTTTGGTAGGC
Transcript ID List ENST00000564844.1; ENST00000565788.1; ENST00000564638.1; rmsk_4605686; ENST00000650688.1; ENST00000268607.9; ENST00000570189.5
External Link RMBase: RNA-editing_site_53354
mod ID: A2ISITE007571 Click to Show/Hide the Full List
mod site chr16:87396220-87396221:+ [5]
Sequence TGTGGTGGCACATGCCTGTAATCCCAACATTTTGGTAGGCC
Transcript ID List ENST00000565788.1; ENST00000570189.5; ENST00000564638.1; rmsk_4605686; ENST00000650688.1; ENST00000564844.1; ENST00000268607.9
External Link RMBase: RNA-editing_site_53355
mod ID: A2ISITE007572 Click to Show/Hide the Full List
mod site chr16:87396226-87396227:+ [5]
Sequence GGCACATGCCTGTAATCCCAACATTTTGGTAGGCCAAGGTG
Transcript ID List ENST00000564638.1; ENST00000650688.1; ENST00000268607.9; rmsk_4605686; ENST00000564844.1; ENST00000570189.5; ENST00000565788.1
External Link RMBase: RNA-editing_site_53356
mod ID: A2ISITE007573 Click to Show/Hide the Full List
mod site chr16:87396236-87396237:+ [5]
Sequence TGTAATCCCAACATTTTGGTAGGCCAAGGTGGGCGGATCAC
Transcript ID List rmsk_4605686; ENST00000650688.1; ENST00000564638.1; ENST00000268607.9; ENST00000565788.1; ENST00000570189.5; ENST00000564844.1
External Link RMBase: RNA-editing_site_53357
mod ID: A2ISITE007574 Click to Show/Hide the Full List
mod site chr16:87396257-87396258:+ [5]
Sequence GGCCAAGGTGGGCGGATCACAAGGTCAGGAGATTGAGACCA
Transcript ID List ENST00000268607.9; ENST00000564844.1; ENST00000570189.5; ENST00000564638.1; ENST00000650688.1; ENST00000565788.1; rmsk_4605686
External Link RMBase: RNA-editing_site_53358
mod ID: A2ISITE007575 Click to Show/Hide the Full List
mod site chr16:87396258-87396259:+ [5]
Sequence GCCAAGGTGGGCGGATCACAAGGTCAGGAGATTGAGACCAT
Transcript ID List ENST00000564844.1; ENST00000564638.1; ENST00000650688.1; rmsk_4605686; ENST00000570189.5; ENST00000565788.1; ENST00000268607.9
External Link RMBase: RNA-editing_site_53359
mod ID: A2ISITE007576 Click to Show/Hide the Full List
mod site chr16:87396263-87396264:+ [5]
Sequence GGTGGGCGGATCACAAGGTCAGGAGATTGAGACCATCCTGG
Transcript ID List ENST00000564638.1; ENST00000650688.1; rmsk_4605686; ENST00000564844.1; ENST00000268607.9; ENST00000565788.1; ENST00000570189.5
External Link RMBase: RNA-editing_site_53360
mod ID: A2ISITE007577 Click to Show/Hide the Full List
mod site chr16:87396266-87396267:+ [5]
Sequence GGGCGGATCACAAGGTCAGGAGATTGAGACCATCCTGGCTA
Transcript ID List ENST00000564638.1; ENST00000564844.1; ENST00000650688.1; ENST00000570189.5; ENST00000268607.9; ENST00000565788.1; rmsk_4605686
External Link RMBase: RNA-editing_site_53361
mod ID: A2ISITE007578 Click to Show/Hide the Full List
mod site chr16:87396268-87396269:+ [5]
Sequence GCGGATCACAAGGTCAGGAGATTGAGACCATCCTGGCTAAC
Transcript ID List ENST00000268607.9; rmsk_4605686; ENST00000570189.5; ENST00000564638.1; ENST00000564844.1; ENST00000565788.1; ENST00000650688.1
External Link RMBase: RNA-editing_site_53362
mod ID: A2ISITE007579 Click to Show/Hide the Full List
mod site chr16:87396274-87396275:+ [5]
Sequence CACAAGGTCAGGAGATTGAGACCATCCTGGCTAACATGATG
Transcript ID List rmsk_4605686; ENST00000564844.1; ENST00000650688.1; ENST00000570189.5; ENST00000268607.9; ENST00000564638.1; ENST00000565788.1
External Link RMBase: RNA-editing_site_53363
mod ID: A2ISITE007580 Click to Show/Hide the Full List
mod site chr16:87396286-87396287:+ [5]
Sequence AGATTGAGACCATCCTGGCTAACATGATGAAACCCCGTCTT
Transcript ID List ENST00000565788.1; ENST00000650688.1; ENST00000570189.5; ENST00000564844.1; ENST00000564638.1; ENST00000268607.9; rmsk_4605686
External Link RMBase: RNA-editing_site_53364
mod ID: A2ISITE007581 Click to Show/Hide the Full List
mod site chr16:87396287-87396288:+ [5]
Sequence GATTGAGACCATCCTGGCTAACATGATGAAACCCCGTCTTT
Transcript ID List rmsk_4605686; ENST00000564638.1; ENST00000564844.1; ENST00000565788.1; ENST00000268607.9; ENST00000570189.5; ENST00000650688.1
External Link RMBase: RNA-editing_site_53365
mod ID: A2ISITE007582 Click to Show/Hide the Full List
mod site chr16:87396292-87396293:+ [5]
Sequence AGACCATCCTGGCTAACATGATGAAACCCCGTCTTTACTAA
Transcript ID List ENST00000565788.1; ENST00000268607.9; ENST00000564638.1; ENST00000564844.1; rmsk_4605686; ENST00000650688.1; ENST00000570189.5
External Link RMBase: RNA-editing_site_53366
mod ID: A2ISITE007583 Click to Show/Hide the Full List
mod site chr16:87396295-87396296:+ [5]
Sequence CCATCCTGGCTAACATGATGAAACCCCGTCTTTACTAAAAA
Transcript ID List rmsk_4605686; ENST00000268607.9; ENST00000570189.5; ENST00000565788.1; ENST00000564844.1; ENST00000650688.1; ENST00000564638.1
External Link RMBase: RNA-editing_site_53367
mod ID: A2ISITE007584 Click to Show/Hide the Full List
mod site chr16:87396297-87396298:+ [5]
Sequence ATCCTGGCTAACATGATGAAACCCCGTCTTTACTAAAAATA
Transcript ID List ENST00000268607.9; rmsk_4605686; ENST00000564638.1; ENST00000570189.5; ENST00000564844.1; ENST00000565788.1; ENST00000650688.1
External Link RMBase: RNA-editing_site_53368
mod ID: A2ISITE007585 Click to Show/Hide the Full List
mod site chr16:87396314-87396315:+ [5]
Sequence GAAACCCCGTCTTTACTAAAAATACAAAAAATTAGCCGGGC
Transcript ID List ENST00000650688.1; ENST00000564638.1; ENST00000565788.1; ENST00000564844.1; ENST00000268607.9; ENST00000570189.5; rmsk_4605686
External Link RMBase: RNA-editing_site_53369
mod ID: A2ISITE007586 Click to Show/Hide the Full List
mod site chr16:87396315-87396316:+ [5]
Sequence AAACCCCGTCTTTACTAAAAATACAAAAAATTAGCCGGGCG
Transcript ID List ENST00000564844.1; ENST00000650688.1; ENST00000268607.9; ENST00000570189.5; ENST00000564638.1; ENST00000565788.1; rmsk_4605686
External Link RMBase: RNA-editing_site_53370
mod ID: A2ISITE007587 Click to Show/Hide the Full List
mod site chr16:87396317-87396318:+ [5]
Sequence ACCCCGTCTTTACTAAAAATACAAAAAATTAGCCGGGCGTG
Transcript ID List ENST00000565788.1; ENST00000570189.5; ENST00000650688.1; ENST00000268607.9; rmsk_4605686; ENST00000564844.1; ENST00000564638.1
External Link RMBase: RNA-editing_site_53371
mod ID: A2ISITE007588 Click to Show/Hide the Full List
mod site chr16:87396322-87396323:+ [5]
Sequence GTCTTTACTAAAAATACAAAAAATTAGCCGGGCGTGGTGGC
Transcript ID List ENST00000570189.5; rmsk_4605686; ENST00000565788.1; ENST00000268607.9; ENST00000564844.1; ENST00000564638.1; ENST00000650688.1
External Link RMBase: RNA-editing_site_53372
mod ID: A2ISITE007589 Click to Show/Hide the Full List
mod site chr16:87396323-87396324:+ [5]
Sequence TCTTTACTAAAAATACAAAAAATTAGCCGGGCGTGGTGGCG
Transcript ID List ENST00000565788.1; ENST00000564638.1; rmsk_4605686; ENST00000570189.5; ENST00000268607.9; ENST00000650688.1; ENST00000564844.1
External Link RMBase: RNA-editing_site_53373
mod ID: A2ISITE007590 Click to Show/Hide the Full List
mod site chr16:87396327-87396328:+ [5]
Sequence TACTAAAAATACAAAAAATTAGCCGGGCGTGGTGGCGGGCG
Transcript ID List rmsk_4605686; ENST00000564844.1; ENST00000565788.1; ENST00000570189.5; ENST00000268607.9; ENST00000650688.1; ENST00000564638.1
External Link RMBase: RNA-editing_site_53374
mod ID: A2ISITE007591 Click to Show/Hide the Full List
mod site chr16:87396353-87396354:+ [5]
Sequence GCGTGGTGGCGGGCGCCTGTAGTCCCAGCTACTTGGGATGC
Transcript ID List ENST00000570189.5; ENST00000564638.1; ENST00000564844.1; ENST00000268607.9; ENST00000650688.1; ENST00000565788.1; rmsk_4605686
External Link RMBase: RNA-editing_site_53375
mod ID: A2ISITE007592 Click to Show/Hide the Full List
mod site chr16:87396363-87396364:+ [5]
Sequence GGGCGCCTGTAGTCCCAGCTACTTGGGATGCTGAGGGAGGA
Transcript ID List ENST00000570189.5; rmsk_4605686; ENST00000650688.1; ENST00000564844.1; ENST00000565788.1; ENST00000268607.9; ENST00000564638.1
External Link RMBase: RNA-editing_site_53376
mod ID: A2ISITE007593 Click to Show/Hide the Full List
mod site chr16:87396380-87396381:+ [5]
Sequence GCTACTTGGGATGCTGAGGGAGGAGAATGGCATGAACCTGG
Transcript ID List ENST00000268607.9; ENST00000565788.1; ENST00000564844.1; ENST00000650688.1; rmsk_4605686; ENST00000564638.1; ENST00000570189.5
External Link RMBase: RNA-editing_site_53377
mod ID: A2ISITE007594 Click to Show/Hide the Full List
mod site chr16:87396394-87396395:+ [5]
Sequence TGAGGGAGGAGAATGGCATGAACCTGGGAGGCGTAGCTTGC
Transcript ID List rmsk_4605686; ENST00000268607.9; ENST00000564638.1; ENST00000650688.1; ENST00000570189.5; ENST00000565788.1; ENST00000564844.1
External Link RMBase: RNA-editing_site_53378
mod ID: A2ISITE007595 Click to Show/Hide the Full List
mod site chr16:87396395-87396396:+ [5]
Sequence GAGGGAGGAGAATGGCATGAACCTGGGAGGCGTAGCTTGCA
Transcript ID List ENST00000650688.1; ENST00000564638.1; ENST00000564844.1; rmsk_4605686; ENST00000565788.1; ENST00000570189.5; ENST00000268607.9
External Link RMBase: RNA-editing_site_53379
mod ID: A2ISITE007596 Click to Show/Hide the Full List
mod site chr16:87396408-87396409:+ [5]
Sequence GGCATGAACCTGGGAGGCGTAGCTTGCAGTGAGCAGAGATC
Transcript ID List ENST00000564638.1; ENST00000650688.1; ENST00000570189.5; ENST00000268607.9; rmsk_4605686; ENST00000564844.1; ENST00000565788.1
External Link RMBase: RNA-editing_site_53380
mod ID: A2ISITE007597 Click to Show/Hide the Full List
mod site chr16:87396419-87396420:+ [5]
Sequence GGGAGGCGTAGCTTGCAGTGAGCAGAGATCGCGCCACTGCA
Transcript ID List ENST00000268607.9; ENST00000565788.1; ENST00000570189.5; rmsk_4605686; ENST00000564638.1; ENST00000564844.1; ENST00000650688.1
External Link RMBase: RNA-editing_site_53381
mod ID: A2ISITE007598 Click to Show/Hide the Full List
mod site chr16:87396422-87396423:+ [5]
Sequence AGGCGTAGCTTGCAGTGAGCAGAGATCGCGCCACTGCACTC
Transcript ID List rmsk_4605686; ENST00000268607.9; ENST00000565788.1; ENST00000564638.1; ENST00000650688.1; ENST00000564844.1; ENST00000570189.5
External Link RMBase: RNA-editing_site_53382
mod ID: A2ISITE007599 Click to Show/Hide the Full List
mod site chr16:87396434-87396435:+ [5]
Sequence CAGTGAGCAGAGATCGCGCCACTGCACTCCAGCCTGAGTGA
Transcript ID List ENST00000564638.1; ENST00000565788.1; rmsk_4605686; ENST00000268607.9; ENST00000650688.1; ENST00000570189.5; ENST00000564844.1
External Link RMBase: RNA-editing_site_53383
mod ID: A2ISITE007600 Click to Show/Hide the Full List
mod site chr16:87396450-87396451:+ [5]
Sequence CGCCACTGCACTCCAGCCTGAGTGACAGAGCAAGACTCCAT
Transcript ID List ENST00000650688.1; ENST00000268607.9; ENST00000564844.1; ENST00000565788.1; ENST00000564638.1; rmsk_4605686; ENST00000570189.5
External Link RMBase: RNA-editing_site_53384
mod ID: A2ISITE007601 Click to Show/Hide the Full List
mod site chr16:87396456-87396457:+ [5]
Sequence TGCACTCCAGCCTGAGTGACAGAGCAAGACTCCATCTCAAA
Transcript ID List ENST00000564638.1; ENST00000650688.1; ENST00000565788.1; ENST00000564844.1; ENST00000570189.5; ENST00000268607.9; rmsk_4605686
External Link RMBase: RNA-editing_site_53385
mod ID: A2ISITE007602 Click to Show/Hide the Full List
mod site chr16:87396461-87396462:+ [5]
Sequence TCCAGCCTGAGTGACAGAGCAAGACTCCATCTCAAAAAAAA
Transcript ID List rmsk_4605686; ENST00000565788.1; ENST00000650688.1; ENST00000564638.1; ENST00000570189.5; ENST00000564844.1; ENST00000268607.9
External Link RMBase: RNA-editing_site_53386
mod ID: A2ISITE007603 Click to Show/Hide the Full List
mod site chr16:87396462-87396463:+ [5]
Sequence CCAGCCTGAGTGACAGAGCAAGACTCCATCTCAAAAAAAAA
Transcript ID List ENST00000650688.1; rmsk_4605686; ENST00000564638.1; ENST00000564844.1; ENST00000570189.5; ENST00000565788.1; ENST00000268607.9
External Link RMBase: RNA-editing_site_53387
mod ID: A2ISITE007604 Click to Show/Hide the Full List
mod site chr16:87396464-87396465:+ [5]
Sequence AGCCTGAGTGACAGAGCAAGACTCCATCTCAAAAAAAAAAA
Transcript ID List ENST00000564638.1; ENST00000570189.5; ENST00000268607.9; rmsk_4605686; ENST00000565788.1; ENST00000564844.1; ENST00000650688.1
External Link RMBase: RNA-editing_site_53388
mod ID: A2ISITE007605 Click to Show/Hide the Full List
mod site chr16:87399145-87399146:+ [6]
Sequence CCTCCTGAGTAGCTCTGACTAGAGGCACACACCACTACACC
Transcript ID List ENST00000650688.1; ENST00000564638.1; ENST00000564844.1; ENST00000565788.1; ENST00000570189.5; ENST00000268607.9
External Link RMBase: RNA-editing_site_53389
mod ID: A2ISITE007606 Click to Show/Hide the Full List
mod site chr16:87401248-87401249:+ [4]
Sequence CCAGCCTCTCTGCCTCGGTAAGGCTTGAGGTCTTTTTCTGA
Transcript ID List ENST00000268607.9; ENST00000570189.5; ENST00000650688.1; ENST00000564844.1; ENST00000565788.1
External Link RMBase: RNA-editing_site_53390
5-methylcytidine (m5C)
In total 2 m6A sequence/site(s) in this target gene
mod ID: M5CSITE000804 Click to Show/Hide the Full List
mod site chr16:87402955-87402956:+ [7]
Sequence CTCAATGCTAATCAGGCCTTCTTCCTGTTGGTGAACGGACA
Seq Type List Bisulfite-seq
Transcript ID List ENST00000650688.1; ENST00000268607.9; ENST00000570189.5; ENST00000564844.1
External Link RMBase: m5C_site_16978
mod ID: M5CSITE000805 Click to Show/Hide the Full List
mod site chr16:87402959-87402960:+ [7]
Sequence ATGCTAATCAGGCCTTCTTCCTGTTGGTGAACGGACACAGC
Seq Type List Bisulfite-seq
Transcript ID List ENST00000564844.1; ENST00000570189.5; ENST00000650688.1; ENST00000268607.9
External Link RMBase: m5C_site_16979
N6-methyladenosine (m6A)
In total 55 m6A sequence/site(s) in this target gene
mod ID: M6ASITE028933 Click to Show/Hide the Full List
mod site chr16:87384019-87384020:+ [8]
Sequence TGCCGAGTGCAAAACGTTAGACTGCCCCGTGTGAGGCTCGA
Motif Score 3.319380952
Cell/Tissue List TREX
Seq Type List MeRIP-seq
Transcript ID List ENST00000650688.1
External Link RMBase: m6A_site_335431
mod ID: M6ASITE028934 Click to Show/Hide the Full List
mod site chr16:87384040-87384041:+ [8]
Sequence CTGCCCCGTGTGAGGCTCGAACTCACGACCTTCAGATTATG
Motif Score 3.373380952
Cell/Tissue List TREX
Seq Type List MeRIP-seq
Transcript ID List ENST00000650688.1
External Link RMBase: m6A_site_335432
mod ID: M6ASITE028935 Click to Show/Hide the Full List
mod site chr16:87391968-87391969:+ [9]
Sequence TCCCTCAAGAGTGCCCCGGGACACCCCGCCTGTGGCTCAGC
Motif Score 3.643047619
Cell/Tissue List HeLa; HEK293T
Seq Type List m6A-seq
Transcript ID List ENST00000650688.1; ENST00000268607.9
External Link RMBase: m6A_site_335435
mod ID: M6ASITE028936 Click to Show/Hide the Full List
mod site chr16:87392050-87392051:+ [9]
Sequence AGGCTCCCGAGCGCCCACAGACCCGGGGTGCGGCCCAGCCC
Motif Score 2.876744048
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000268607.9; ENST00000650688.1
External Link RMBase: m6A_site_335436
mod ID: M6ASITE028937 Click to Show/Hide the Full List
mod site chr16:87392314-87392315:+ [10]
Sequence AGGCTGCGGGCTGAGGAGATACAAGGGAAGTGGCTATCGCC
Motif Score 2.110482143
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000268607.9; ENST00000650688.1
External Link RMBase: m6A_site_335437
mod ID: M6ASITE028938 Click to Show/Hide the Full List
mod site chr16:87392384-87392385:+ [9]
Sequence CGCCCCCGGGAGCCGCCGGGACCCTCGCGTCGTCGCCGCCG
Motif Score 3.622404762
Cell/Tissue List HeLa; HepG2; HEK293T; A549; U2OS; fibroblasts; LCLs; MT4; Huh7; Jurkat; CD4T; GSC-11; HEK293A-TOA; MSC; iSLK; TIME; TREX; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List rmsk_4605680; ENST00000564844.1; ENST00000268607.9; ENST00000650688.1; ENST00000565788.1; ENST00000570189.5
External Link RMBase: m6A_site_335438
mod ID: M6ASITE028939 Click to Show/Hide the Full List
mod site chr16:87392442-87392443:+ [9]
Sequence GCACCATGCCGTCGGAGAAGACCTTCAAGCAGCGCCGCACC
Motif Score 2.876744048
Cell/Tissue List HeLa; HepG2; HEK293T; A549; U2OS; LCLs; MT4; Huh7; Jurkat; CD4T; GSC-11; HEK293A-TOA; MSC; iSLK; TIME; TREX; endometrial; HEC-1-A; GSCs
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000565788.1; ENST00000268607.9; ENST00000564638.1; ENST00000564844.1; ENST00000570189.5; ENST00000650688.1
External Link RMBase: m6A_site_335439
mod ID: M6ASITE028941 Click to Show/Hide the Full List
mod site chr16:87398815-87398816:+ [10]
Sequence TCTCTTCATTTCATTGCAGAACAAAGAGTAGAAGATGTCCG
Motif Score 2.951386905
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000565788.1; ENST00000564638.1; ENST00000268607.9; ENST00000564844.1; ENST00000650688.1; ENST00000570189.5
External Link RMBase: m6A_site_335440
mod ID: M6ASITE028942 Click to Show/Hide the Full List
mod site chr16:87398967-87398968:+ [11]
Sequence GTTTTTACAGGAATCACCAGACAGCCAAACCCTGGGTGTCA
Motif Score 2.897386905
Cell/Tissue List HepG2; A549; Huh7; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000268607.9; ENST00000564638.1; ENST00000564844.1; ENST00000565788.1; ENST00000650688.1; ENST00000570189.5
External Link RMBase: m6A_site_335441
mod ID: M6ASITE028943 Click to Show/Hide the Full List
mod site chr16:87402190-87402191:+ [10]
Sequence CCAGGTGATAATAGAACGATACAAGGGTGAGAAGCAGCTTC
Motif Score 2.110482143
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000570189.5; ENST00000650688.1; ENST00000564844.1; ENST00000268607.9; ENST00000565788.1
External Link RMBase: m6A_site_335442
mod ID: M6ASITE028944 Click to Show/Hide the Full List
mod site chr16:87402973-87402974:+ [10]
Sequence TTCTTCCTGTTGGTGAACGGACACAGCATGGTCAGCGTCTC
Motif Score 3.643047619
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000564844.1; ENST00000570189.5; ENST00000268607.9; ENST00000650688.1
External Link RMBase: m6A_site_335443
mod ID: M6ASITE028945 Click to Show/Hide the Full List
mod site chr16:87402995-87402996:+ [10]
Sequence ACAGCATGGTCAGCGTCTCCACACCAATCTCAGAGGTGTAT
Motif Score 2.053113095
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000564844.1; ENST00000570189.5; ENST00000650688.1; ENST00000268607.9
External Link RMBase: m6A_site_335444
mod ID: M6ASITE028946 Click to Show/Hide the Full List
mod site chr16:87403047-87403048:+ [10]
Sequence AGATGAAGATGGATTCCTGTACATGGTCTATGCCTCCCAGG
Motif Score 2.856142857
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000650688.1; ENST00000570189.5; ENST00000564844.1; ENST00000268607.9
External Link RMBase: m6A_site_335445
mod ID: M6ASITE028947 Click to Show/Hide the Full List
mod site chr16:87403098-87403099:+ [9]
Sequence GATGAAATTGTCAGTGTAAAACCAGAAAAAATGCAGCTCTT
Motif Score 2.185083333
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000650688.1; ENST00000564844.1; ENST00000268607.9; ENST00000570189.5
External Link RMBase: m6A_site_335446
mod ID: M6ASITE028948 Click to Show/Hide the Full List
mod site chr16:87403133-87403134:+ [9]
Sequence GCTCTTCTAGAATTGTTTAAACCCTTACCAAGGAAAAAAAA
Motif Score 2.185083333
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000268607.9; ENST00000650688.1; ENST00000564844.1; ENST00000570189.5
External Link RMBase: m6A_site_335447
mod ID: M6ASITE028949 Click to Show/Hide the Full List
mod site chr16:87403204-87403205:+ [9]
Sequence ATCCAATCACAGATCATGAAACAGTAGTGTTCCCACCTAGG
Motif Score 2.20572619
Cell/Tissue List HeLa; HEK293T
Seq Type List m6A-seq; DART-seq
Transcript ID List ENST00000268607.9; ENST00000570189.5; ENST00000564844.1; ENST00000650688.1
External Link RMBase: m6A_site_335448
mod ID: M6ASITE028950 Click to Show/Hide the Full List
mod site chr16:87403218-87403219:+ [12]
Sequence CATGAAACAGTAGTGTTCCCACCTAGGAGTGTTAGGAAGTT
Motif Score 2.032470238
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000650688.1; ENST00000268607.9; ENST00000570189.5; ENST00000564844.1
External Link RMBase: m6A_site_335449
mod ID: M6ASITE028952 Click to Show/Hide the Full List
mod site chr16:87403280-87403281:+ [10]
Sequence AAACTGAGCTCCAAGTGAGCACATTCAGCTTTGGAAACTAT
Motif Score 2.830589286
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000570189.5; ENST00000564844.1; ENST00000268607.9; ENST00000650688.1
External Link RMBase: m6A_site_335450
mod ID: M6ASITE028953 Click to Show/Hide the Full List
mod site chr16:87403603-87403604:+ [12]
Sequence CGCAAAACGCATTTGCCATCACAGTTGGCACAAACGCAGGG
Motif Score 2.047297619
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000650688.1; ENST00000570189.5; ENST00000564844.1; ENST00000268607.9
External Link RMBase: m6A_site_335451
mod ID: M6ASITE028954 Click to Show/Hide the Full List
mod site chr16:87403612-87403613:+ [13]
Sequence CATTTGCCATCACAGTTGGCACAAACGCAGGGTAAACGGGC
Motif Score 2.830589286
Cell/Tissue List kidney; hESC-HEK293T
Seq Type List m6A-REF-seq; MAZTER-seq
Transcript ID List ENST00000570189.5; ENST00000650688.1; ENST00000564844.1; ENST00000268607.9
External Link RMBase: m6A_site_335452
mod ID: M6ASITE028955 Click to Show/Hide the Full List
mod site chr16:87403677-87403678:+ [12]
Sequence TAAACTGCTGAAGGTCCCTGACTCCTAAGAGAACCACACCC
Motif Score 3.28175
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000268607.9; ENST00000564844.1; ENST00000650688.1; ENST00000570189.5
External Link RMBase: m6A_site_335453
mod ID: M6ASITE028956 Click to Show/Hide the Full List
mod site chr16:87403692-87403693:+ [10]
Sequence CCCTGACTCCTAAGAGAACCACACCCAAAGTCCTCACTCTT
Motif Score 2.053113095
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000650688.1; ENST00000564844.1; ENST00000570189.5; ENST00000268607.9
External Link RMBase: m6A_site_335454
mod ID: M6ASITE028957 Click to Show/Hide the Full List
mod site chr16:87403760-87403761:+ [12]
Sequence TGTTCTCTAGATAGTTACACACATAAAGACACCACTCAAAA
Motif Score 2.084928571
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000564844.1; ENST00000268607.9; ENST00000650688.1; ENST00000570189.5
External Link RMBase: m6A_site_335455
mod ID: M6ASITE028958 Click to Show/Hide the Full List
mod site chr16:87403768-87403769:+ [10]
Sequence AGATAGTTACACACATAAAGACACCACTCAAAAGGAAACTT
Motif Score 2.897386905
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000570189.5; ENST00000564844.1; ENST00000650688.1; ENST00000268607.9
External Link RMBase: m6A_site_335456
mod ID: M6ASITE028959 Click to Show/Hide the Full List
mod site chr16:87403824-87403825:+ [9]
Sequence TTGATCGAGTTTCTTAAAAGACCCTGGAGAAAGAGTGGCAT
Motif Score 2.876744048
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000564844.1; ENST00000268607.9; ENST00000650688.1
External Link RMBase: m6A_site_335457
mod ID: M6ASITE028960 Click to Show/Hide the Full List
mod site chr16:87403876-87403877:+ [9]
Sequence CAGGTTTTGTCTGAGTTCAAACTAGTGCCTGTGTTGTTACG
Motif Score 2.627720238
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000564844.1; ENST00000268607.9; ENST00000650688.1
External Link RMBase: m6A_site_335458
mod ID: M6ASITE028961 Click to Show/Hide the Full List
mod site chr16:87403942-87403943:+ [9]
Sequence TCTGGAGTACAGCGGGAGAAACACAAAATAGTATAACTGAA
Motif Score 2.20572619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000650688.1; ENST00000564844.1; ENST00000268607.9
External Link RMBase: m6A_site_335459
mod ID: M6ASITE028963 Click to Show/Hide the Full List
mod site chr16:87403964-87403965:+ [9]
Sequence ACAAAATAGTATAACTGAAAACATTAACATTCAGACACACT
Motif Score 2.20572619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000564844.1; ENST00000268607.9; ENST00000650688.1
External Link RMBase: m6A_site_335460
mod ID: M6ASITE028964 Click to Show/Hide the Full List
mod site chr16:87403978-87403979:+ [9]
Sequence CTGAAAACATTAACATTCAGACACACTCCCTTCTGCCTTCC
Motif Score 2.897386905
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000564844.1; ENST00000650688.1; ENST00000268607.9
External Link RMBase: m6A_site_335461
mod ID: M6ASITE028965 Click to Show/Hide the Full List
mod site chr16:87404052-87404053:+ [12]
Sequence TTTTTAATGTTAAATGTGTAACTCAGTATTACTGAAAAGGT
Motif Score 2.590089286
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000650688.1; ENST00000564844.1; ENST00000268607.9
External Link RMBase: m6A_site_335462
mod ID: M6ASITE028966 Click to Show/Hide the Full List
mod site chr16:87404062-87404063:+ [12]
Sequence TAAATGTGTAACTCAGTATTACTGAAAAGGTACCCACATTT
Motif Score 2.494845238
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000564844.1; ENST00000268607.9; ENST00000650688.1
External Link RMBase: m6A_site_335463
mod ID: M6ASITE028967 Click to Show/Hide the Full List
mod site chr16:87404073-87404074:+ [12]
Sequence CTCAGTATTACTGAAAAGGTACCCACATTTTGAATAGTAGT
Motif Score 2.8355
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000564844.1; ENST00000268607.9; ENST00000650688.1
External Link RMBase: m6A_site_335464
mod ID: M6ASITE028968 Click to Show/Hide the Full List
mod site chr16:87404077-87404078:+ [10]
Sequence GTATTACTGAAAAGGTACCCACATTTTGAATAGTAGTTATC
Motif Score 2.053113095
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000564844.1; ENST00000650688.1; ENST00000268607.9
External Link RMBase: m6A_site_335465
mod ID: M6ASITE028969 Click to Show/Hide the Full List
mod site chr16:87404111-87404112:+ [9]
Sequence AGTTATCACTCTTAGGTCAGACAGCCATCAGAATTCTCCCA
Motif Score 2.897386905
Cell/Tissue List HeLa; HEK293T
Seq Type List m6A-seq; DART-seq
Transcript ID List ENST00000650688.1; ENST00000268607.9; ENST00000564844.1
External Link RMBase: m6A_site_335466
mod ID: M6ASITE028970 Click to Show/Hide the Full List
mod site chr16:87404160-87404161:+ [9]
Sequence GCATGTCAGTTGTGGAGAAAACATAGCAAAAAGAGCCGTAC
Motif Score 2.20572619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000564844.1; ENST00000650688.1; ENST00000268607.9
External Link RMBase: m6A_site_335467
mod ID: M6ASITE028971 Click to Show/Hide the Full List
mod site chr16:87404194-87404195:+ [12]
Sequence GCCGTACGCTCTTTACAGATACTAATGTCAAGAGTTAAACC
Motif Score 2.53247619
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000650688.1; ENST00000268607.9; ENST00000564844.1
External Link RMBase: m6A_site_335468
mod ID: M6ASITE028972 Click to Show/Hide the Full List
mod site chr16:87404212-87404213:+ [9]
Sequence ATACTAATGTCAAGAGTTAAACCTCCTCAGGTTCAACCTGT
Motif Score 2.185083333
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000650688.1; ENST00000268607.9; ENST00000564844.1
External Link RMBase: m6A_site_335469
mod ID: M6ASITE028974 Click to Show/Hide the Full List
mod site chr16:87404241-87404242:+ [9]
Sequence GGTTCAACCTGTGATAAAAGACTAGTGCTTCCCAGTACTTG
Motif Score 3.319380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000564844.1; ENST00000268607.9; ENST00000650688.1
External Link RMBase: m6A_site_335470
mod ID: M6ASITE028975 Click to Show/Hide the Full List
mod site chr16:87404257-87404258:+ [12]
Sequence AAAGACTAGTGCTTCCCAGTACTTGCATGGGGTTCACTATT
Motif Score 3.278136905
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000268607.9; ENST00000564844.1; ENST00000650688.1
External Link RMBase: m6A_site_335471
mod ID: M6ASITE028976 Click to Show/Hide the Full List
mod site chr16:87404316-87404317:+ [12]
Sequence ATCACAGGAAAATCACAATTACACCACTTTAGACCCTATGT
Motif Score 2.07285119
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000650688.1; ENST00000564844.1; ENST00000268607.9
External Link RMBase: m6A_site_335472
mod ID: M6ASITE028977 Click to Show/Hide the Full List
mod site chr16:87404328-87404329:+ [9]
Sequence TCACAATTACACCACTTTAGACCCTATGTGTAGCAGGTCAC
Motif Score 2.876744048
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000650688.1; ENST00000268607.9; ENST00000564844.1
External Link RMBase: m6A_site_335473
mod ID: M6ASITE028978 Click to Show/Hide the Full List
mod site chr16:87404347-87404348:+ [10]
Sequence GACCCTATGTGTAGCAGGTCACAACTTACCCTTGTGTGTTT
Motif Score 2.047297619
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000650688.1; ENST00000268607.9; ENST00000564844.1
External Link RMBase: m6A_site_335474
mod ID: M6ASITE028979 Click to Show/Hide the Full List
mod site chr16:87404391-87404392:+ [12]
Sequence TGTGTATGAAATACCTGTATACGTTAGTGAAAGCTGTTTAC
Motif Score 2.084416667
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000650688.1; ENST00000268607.9; ENST00000564844.1
External Link RMBase: m6A_site_335475
mod ID: M6ASITE028980 Click to Show/Hide the Full List
mod site chr16:87404410-87404411:+ [12]
Sequence TACGTTAGTGAAAGCTGTTTACTGTAACGGGGAAAACCAGA
Motif Score 2.494845238
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000268607.9; ENST00000650688.1; ENST00000564844.1
External Link RMBase: m6A_site_335476
mod ID: M6ASITE028981 Click to Show/Hide the Full List
mod site chr16:87404425-87404426:+ [9]
Sequence TGTTTACTGTAACGGGGAAAACCAGATTCTTTGCATCTGGG
Motif Score 2.185083333
Cell/Tissue List HeLa; MT4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000650688.1; ENST00000564844.1; ENST00000268607.9
External Link RMBase: m6A_site_335477
mod ID: M6ASITE028982 Click to Show/Hide the Full List
mod site chr16:87404510-87404511:+ [12]
Sequence ACCCCCGCATGCGTCTGTCCACTTGGCTAACTTTTAATATG
Motif Score 2.475107143
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000650688.1; ENST00000564844.1; ENST00000268607.9
External Link RMBase: m6A_site_335478
mod ID: M6ASITE028983 Click to Show/Hide the Full List
mod site chr16:87404519-87404520:+ [12]
Sequence TGCGTCTGTCCACTTGGCTAACTTTTAATATGTGTATTTTT
Motif Score 2.590089286
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000268607.9; ENST00000564844.1; ENST00000650688.1
External Link RMBase: m6A_site_335479
mod ID: M6ASITE028985 Click to Show/Hide the Full List
mod site chr16:87404540-87404541:+ [12]
Sequence CTTTTAATATGTGTATTTTTACATTATGTATATTCTTAACT
Motif Score 2.07285119
Cell/Tissue List HEK293T; hESC-HEK293T
Seq Type List DART-seq; MAZTER-seq
Transcript ID List ENST00000650688.1; ENST00000268607.9; ENST00000564844.1
External Link RMBase: m6A_site_335480
mod ID: M6ASITE028986 Click to Show/Hide the Full List
mod site chr16:87404558-87404559:+ [12]
Sequence TTACATTATGTATATTCTTAACTGGACTGTCTCGTTTAGAC
Motif Score 2.590089286
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000268607.9; ENST00000564844.1; ENST00000650688.1
External Link RMBase: m6A_site_335481
mod ID: M6ASITE028987 Click to Show/Hide the Full List
mod site chr16:87404563-87404564:+ [9]
Sequence TTATGTATATTCTTAACTGGACTGTCTCGTTTAGACTGTAT
Motif Score 4.065041667
Cell/Tissue List HeLa; HEK293T
Seq Type List m6A-seq; DART-seq
Transcript ID List ENST00000564844.1; ENST00000650688.1; ENST00000268607.9
External Link RMBase: m6A_site_335482
mod ID: M6ASITE028988 Click to Show/Hide the Full List
mod site chr16:87404577-87404578:+ [9]
Sequence AACTGGACTGTCTCGTTTAGACTGTATACATCATATCTGAC
Motif Score 3.319380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000650688.1; ENST00000564844.1; ENST00000268607.9
External Link RMBase: m6A_site_335483
mod ID: M6ASITE028989 Click to Show/Hide the Full List
mod site chr16:87404596-87404597:+ [12]
Sequence GACTGTATACATCATATCTGACATTATTGTAACTACCGTGT
Motif Score 2.859755952
Cell/Tissue List HEK293T; hESC-HEK293T
Seq Type List DART-seq; MAZTER-seq
Transcript ID List ENST00000268607.9; ENST00000650688.1; ENST00000564844.1
External Link RMBase: m6A_site_335484
mod ID: M6ASITE028990 Click to Show/Hide the Full List
mod site chr16:87404665-87404666:+ [10]
Sequence GCTTTTTAAGAAAAAAAATAACATGCTGAGGGGTGACCTAT
Motif Score 2.168095238
Cell/Tissue List hESC-HEK293T
Seq Type List MAZTER-seq
Transcript ID List ENST00000268607.9; ENST00000650688.1; ENST00000564844.1
External Link RMBase: m6A_site_335485
mod ID: M6ASITE028991 Click to Show/Hide the Full List
mod site chr16:87404726-87404727:+ [9]
Sequence TTATTTATAGGATCTTTAAAACATTTTTAATGAACTAAGTT
Motif Score 2.20572619
Cell/Tissue List HeLa; hESC-HEK293T
Seq Type List m6A-seq; MAZTER-seq
Transcript ID List ENST00000650688.1; ENST00000564844.1; ENST00000268607.9
External Link RMBase: m6A_site_335486
mod ID: M6ASITE028992 Click to Show/Hide the Full List
mod site chr16:87404739-87404740:+ [9]
Sequence CTTTAAAACATTTTTAATGAACTAAGTTGAATAAAGGCACA
Motif Score 3.373380952
Cell/Tissue List HeLa; HEK293T
Seq Type List m6A-seq; DART-seq
Transcript ID List ENST00000564844.1; ENST00000650688.1; ENST00000268607.9
External Link RMBase: m6A_site_335487