m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00325)

Target Name	Hepatocyte growth factor receptor (c-Met/MET)
Synonyms	HGF receptor; HGF/SF receptor; Proto-oncogene c-Met; Scatter factor receptor; SF receptor; Tyrosine-protein kinase Met Click to Show/Hide
Gene Name	MET
Chromosomal Location	7q31
Family	protein kinase superfamily; Tyr protein kinase family
Function	Receptor tyrosine kinase that transduces signals from the extracellular matrix into the cytoplasm by binding to hepatocyte growth factor/HGF ligand. Regulates many physiological processes including proliferation, scattering, morphogenesis and survival. Ligand binding at the cell surface induces autophosphorylation of MET on its intracellular domain that provides docking sites for downstream signaling molecules. Following activation by ligand, interacts with the PI3-kinase subunit PIK3R1, PLCG1, SRC, GRB2, STAT3 or the adapter GAB1. Recruitment of these downstream effectors by MET leads to the activation of several signaling cascades including the RAS-ERK, PI3 kinase-AKT, or PLCgamma-PKC. The RAS-ERK activation is associated with the morphogenetic effects while PI3K/AKT coordinates prosurvival effects. During embryonic development, MET signaling plays a role in gastrulation, development and migration of muscles and neuronal precursors, angiogenesis and kidney formation. In adults, participates in wound healing as well as organ regeneration and tissue remodeling. Promotes also differentiation and proliferation of hematopoietic cells. May regulate cortical bone osteogenesis (By similarity); (Microbial infection) Acts as a receptor for Listeria monocytogenes internalin InlB, mediating entry of the pathogen into cells. Click to Show/Hide
Gene ID	4233
Uniprot ID	MET_HUMAN
HGNC ID	HGNC:7029
KEGG ID	hsa:4233

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

MET can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Browse Drug

Methyltransferase-like 3 (METTL3) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by METTL3*
Cell Line	LX2 cell line	Homo sapiens
Treatment: shMETTL3 LX2 cells Control: shLuc LX2 cells		GSE207909
Regulation		logFC: 6.42E-01 p-value: 3.45E-17
More Results	Click to View More RNA-seq Results

In total 3 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	Chidamide could decrease Hepatocyte growth factor receptor (c-Met/MET) expression by inhibiting mRNA N6-methyladenosine (m6A) modification through the downregulation of METTL3 and WTAP expression, subsequently increasing the crizotinib sensitivity of NSCLC cells in a c-MET-/HGF-dependent manner.
Target Regulation	Up regulation
Responsed Disease	Non-small-cell lung carcinoma		ICD-11: 2C25.Y	Disease Info
Responsed Drug	Crizotinib		Approved	Drug Info
Pathway Response	EGFR tyrosine kinase inhibitor resistance			hsa01521
In-vitro Model	HCC827	Lung adenocarcinoma	Homo sapiens	CVCL_2063
	NCI-H661	Lung large cell carcinoma	Homo sapiens	CVCL_1577
	NCI-H596	Lung adenosquamous carcinoma	Homo sapiens	CVCL_1571
	NCI-H460	Lung large cell carcinoma	Homo sapiens	CVCL_0459
	NCI-H358	Minimally invasive lung adenocarcinoma	Homo sapiens	CVCL_1559
	NCI-H292	Lung mucoepidermoid carcinoma	Homo sapiens	CVCL_0455
	NCI-H1975	Lung adenocarcinoma	Homo sapiens	CVCL_1511
	NCI-H1650	Minimally invasive lung adenocarcinoma	Homo sapiens	CVCL_1483
	NCI-H1395	Lung adenocarcinoma	Homo sapiens	CVCL_1467
	EBC-1	Lung squamous cell carcinoma	Homo sapiens	CVCL_2891
	Calu-3	Lung adenocarcinoma	Homo sapiens	CVCL_0609
	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
In-vivo Model	HCC827 (3×10⁶) cells suspended in 100 uL of PBS were injected into the left inguen of female Balb/c nude mice (body weight 18-20 g; age 6 weeks; Beijing Huafukang Bioscience Co., Inc.). When the tumor volumes reached 50-100 mm³ on the 10th posttransplantation day, the mice were randomized into four groups (10 mice per group) and were intragastrically administered vehicle (normal saline), crizotinib (25 mg/kg body weight), chidamide (5 mg/kg), or the combination of the two drugs daily for 21 days. The tumor volumes and body weights of the mice were measured every 3 days.
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene				[2]
Response Summary	METTL3 combines with Hepatocyte growth factor receptor (c-Met/MET) and causes the PI3K/AKT signalling pathway to be manipulated, which affects the sensitivity of lung cancer cells to gefitinib. METTL3 knockdown promotes apoptosis and inhibits proliferation of lung cancer cells.
Target Regulation	Up regulation
Responsed Disease	Lung cancer		ICD-11: 2C25	Disease Info
Responsed Drug	Gefitinib		Approved	Drug Info
Pathway Response	PI3K-Akt signaling pathway			hsa04151
In-vitro Model	PC-9	Lung adenocarcinoma	Homo sapiens	CVCL_B260
In-vitro Model	NCI-H3255	Lung adenocarcinoma	Homo sapiens	CVCL_6831
Experiment 3 Reporting the m6A Methylation Regulator of This Target Gene				[3]
Response Summary	METTL3-mediated m6A RNA methylation modulates uveal melanoma cell proliferation, migration, and invasion by targeting Hepatocyte growth factor receptor (c-Met/MET). Cycloleucine (Cyc) was used to block m6 A methylation in UM cells.
Target Regulation	Up regulation
Responsed Disease	Melanoma of uvea		ICD-11: 2D0Y	Disease Info
Pathway Response	Cell cycle			hsa04110
Cell Process	Cell proliferation
	Cell migration
	Cell invasion
	Arrest cell cycle at G1 phase
In-vitro Model	M17 (Neuroblastoma cells)
	M21	Melanoma	Homo sapiens	CVCL_D031
	M23	Cutaneous melanoma	Homo sapiens	CVCL_RT32
	SP-6.5	Uveal melanoma	Homo sapiens	CVCL_7997

Wilms tumor 1-associating protein (WTAP) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by WTAP*
Cell Line	mouse embryonic stem cells	Mus musculus
Treatment: WTAP-/- ESCs Control: Wild type ESCs		GSE145309
Regulation		logFC: -2.39E+00 p-value: 1.81E-38
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	Chidamide could decrease Hepatocyte growth factor receptor (c-Met/MET) expression by inhibiting mRNA N6-methyladenosine (m6A) modification through the downregulation of METTL3 and WTAP expression, subsequently increasing the crizotinib sensitivity of NSCLC cells in a c-MET-/HGF-dependent manner.
Target Regulation	Up regulation
Responsed Disease	Non-small-cell lung carcinoma		ICD-11: 2C25.Y	Disease Info
Responsed Drug	Crizotinib		Approved	Drug Info
Pathway Response	EGFR tyrosine kinase inhibitor resistance			hsa01521
In-vitro Model	HCC827	Lung adenocarcinoma	Homo sapiens	CVCL_2063
	NCI-H661	Lung large cell carcinoma	Homo sapiens	CVCL_1577
	NCI-H596	Lung adenosquamous carcinoma	Homo sapiens	CVCL_1571
	NCI-H460	Lung large cell carcinoma	Homo sapiens	CVCL_0459
	NCI-H358	Minimally invasive lung adenocarcinoma	Homo sapiens	CVCL_1559
	NCI-H292	Lung mucoepidermoid carcinoma	Homo sapiens	CVCL_0455
	NCI-H1975	Lung adenocarcinoma	Homo sapiens	CVCL_1511
	NCI-H1650	Minimally invasive lung adenocarcinoma	Homo sapiens	CVCL_1483
	NCI-H1395	Lung adenocarcinoma	Homo sapiens	CVCL_1467
	EBC-1	Lung squamous cell carcinoma	Homo sapiens	CVCL_2891
	Calu-3	Lung adenocarcinoma	Homo sapiens	CVCL_0609
	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
In-vivo Model	HCC827 (3×10⁶) cells suspended in 100 uL of PBS were injected into the left inguen of female Balb/c nude mice (body weight 18-20 g; age 6 weeks; Beijing Huafukang Bioscience Co., Inc.). When the tumor volumes reached 50-100 mm³ on the 10th posttransplantation day, the mice were randomized into four groups (10 mice per group) and were intragastrically administered vehicle (normal saline), crizotinib (25 mg/kg body weight), chidamide (5 mg/kg), or the combination of the two drugs daily for 21 days. The tumor volumes and body weights of the mice were measured every 3 days.

Lung cancer [ICD-11: 2C25]

Disease Info

In total 3 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	Chidamide could decrease Hepatocyte growth factor receptor (c-Met/MET) expression by inhibiting mRNA N6-methyladenosine (m6A) modification through the downregulation of METTL3 and WTAP expression, subsequently increasing the crizotinib sensitivity of NSCLC cells in a c-MET-/HGF-dependent manner.
Responsed Disease	Non-small-cell lung carcinoma [ICD-11: 2C25.Y]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Responsed Drug	Crizotinib		Approved	Drug Info
Pathway Response	EGFR tyrosine kinase inhibitor resistance			hsa01521
In-vitro Model	HCC827	Lung adenocarcinoma	Homo sapiens	CVCL_2063
	NCI-H661	Lung large cell carcinoma	Homo sapiens	CVCL_1577
	NCI-H596	Lung adenosquamous carcinoma	Homo sapiens	CVCL_1571
	NCI-H460	Lung large cell carcinoma	Homo sapiens	CVCL_0459
	NCI-H358	Minimally invasive lung adenocarcinoma	Homo sapiens	CVCL_1559
	NCI-H292	Lung mucoepidermoid carcinoma	Homo sapiens	CVCL_0455
	NCI-H1975	Lung adenocarcinoma	Homo sapiens	CVCL_1511
	NCI-H1650	Minimally invasive lung adenocarcinoma	Homo sapiens	CVCL_1483
	NCI-H1395	Lung adenocarcinoma	Homo sapiens	CVCL_1467
	EBC-1	Lung squamous cell carcinoma	Homo sapiens	CVCL_2891
	Calu-3	Lung adenocarcinoma	Homo sapiens	CVCL_0609
	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
In-vivo Model	HCC827 (3×10⁶) cells suspended in 100 uL of PBS were injected into the left inguen of female Balb/c nude mice (body weight 18-20 g; age 6 weeks; Beijing Huafukang Bioscience Co., Inc.). When the tumor volumes reached 50-100 mm³ on the 10th posttransplantation day, the mice were randomized into four groups (10 mice per group) and were intragastrically administered vehicle (normal saline), crizotinib (25 mg/kg body weight), chidamide (5 mg/kg), or the combination of the two drugs daily for 21 days. The tumor volumes and body weights of the mice were measured every 3 days.
Experiment 2 Reporting the m6A-centered Disease Response				[2]
Response Summary	METTL3 combines with Hepatocyte growth factor receptor (c-Met/MET) and causes the PI3K/AKT signalling pathway to be manipulated, which affects the sensitivity of lung cancer cells to gefitinib. METTL3 knockdown promotes apoptosis and inhibits proliferation of lung cancer cells.
Responsed Disease	Lung cancer [ICD-11: 2C25]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Responsed Drug	Gefitinib		Approved	Drug Info
Pathway Response	PI3K-Akt signaling pathway			hsa04151
In-vitro Model	PC-9	Lung adenocarcinoma	Homo sapiens	CVCL_B260
In-vitro Model	NCI-H3255	Lung adenocarcinoma	Homo sapiens	CVCL_6831
Experiment 3 Reporting the m6A-centered Disease Response				[1]
Response Summary	Chidamide could decrease Hepatocyte growth factor receptor (c-Met/MET) expression by inhibiting mRNA N6-methyladenosine (m6A) modification through the downregulation of METTL3 and WTAP expression, subsequently increasing the crizotinib sensitivity of NSCLC cells in a c-MET-/HGF-dependent manner.
Responsed Disease	Non-small-cell lung carcinoma [ICD-11: 2C25.Y]
Target Regulator	Wilms tumor 1-associating protein (WTAP)		WRITER	Regulator Info
Target Regulation	Up regulation
Responsed Drug	Crizotinib		Approved	Drug Info
Pathway Response	EGFR tyrosine kinase inhibitor resistance			hsa01521
In-vitro Model	HCC827	Lung adenocarcinoma	Homo sapiens	CVCL_2063
	NCI-H661	Lung large cell carcinoma	Homo sapiens	CVCL_1577
	NCI-H596	Lung adenosquamous carcinoma	Homo sapiens	CVCL_1571
	NCI-H460	Lung large cell carcinoma	Homo sapiens	CVCL_0459
	NCI-H358	Minimally invasive lung adenocarcinoma	Homo sapiens	CVCL_1559
	NCI-H292	Lung mucoepidermoid carcinoma	Homo sapiens	CVCL_0455
	NCI-H1975	Lung adenocarcinoma	Homo sapiens	CVCL_1511
	NCI-H1650	Minimally invasive lung adenocarcinoma	Homo sapiens	CVCL_1483
	NCI-H1395	Lung adenocarcinoma	Homo sapiens	CVCL_1467
	EBC-1	Lung squamous cell carcinoma	Homo sapiens	CVCL_2891
	Calu-3	Lung adenocarcinoma	Homo sapiens	CVCL_0609
	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
In-vivo Model	HCC827 (3×10⁶) cells suspended in 100 uL of PBS were injected into the left inguen of female Balb/c nude mice (body weight 18-20 g; age 6 weeks; Beijing Huafukang Bioscience Co., Inc.). When the tumor volumes reached 50-100 mm³ on the 10th posttransplantation day, the mice were randomized into four groups (10 mice per group) and were intragastrically administered vehicle (normal saline), crizotinib (25 mg/kg body weight), chidamide (5 mg/kg), or the combination of the two drugs daily for 21 days. The tumor volumes and body weights of the mice were measured every 3 days.

Melanoma of uvea [ICD-11: 2D0Y]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[3]
Response Summary	METTL3-mediated m6A RNA methylation modulates uveal melanoma cell proliferation, migration, and invasion by targeting Hepatocyte growth factor receptor (c-Met/MET). Cycloleucine (Cyc) was used to block m6 A methylation in UM cells.
Responsed Disease	Melanoma of uvea [ICD-11: 2D0Y]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Pathway Response	Cell cycle			hsa04110
Cell Process	Cell proliferation
	Cell migration
	Cell invasion
	Arrest cell cycle at G1 phase
In-vitro Model	M17 (Neuroblastoma cells)
	M21	Melanoma	Homo sapiens	CVCL_D031
	M23	Cutaneous melanoma	Homo sapiens	CVCL_RT32
	SP-6.5	Uveal melanoma	Homo sapiens	CVCL_7997

Crizotinib [Approved]

Drug Info

In total 2 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response				[1]
Response Summary	Chidamide could decrease Hepatocyte growth factor receptor (c-Met/MET) expression by inhibiting mRNA N6-methyladenosine (m6A) modification through the downregulation of METTL3 and WTAP expression, subsequently increasing the crizotinib sensitivity of NSCLC cells in a c-MET-/HGF-dependent manner.
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Responsed Disease	Non-small-cell lung carcinoma		ICD-11: 2C25.Y	Disease Info
Pathway Response	EGFR tyrosine kinase inhibitor resistance			hsa01521
In-vitro Model	HCC827	Lung adenocarcinoma	Homo sapiens	CVCL_2063
	NCI-H661	Lung large cell carcinoma	Homo sapiens	CVCL_1577
	NCI-H596	Lung adenosquamous carcinoma	Homo sapiens	CVCL_1571
	NCI-H460	Lung large cell carcinoma	Homo sapiens	CVCL_0459
	NCI-H358	Minimally invasive lung adenocarcinoma	Homo sapiens	CVCL_1559
	NCI-H292	Lung mucoepidermoid carcinoma	Homo sapiens	CVCL_0455
	NCI-H1975	Lung adenocarcinoma	Homo sapiens	CVCL_1511
	NCI-H1650	Minimally invasive lung adenocarcinoma	Homo sapiens	CVCL_1483
	NCI-H1395	Lung adenocarcinoma	Homo sapiens	CVCL_1467
	EBC-1	Lung squamous cell carcinoma	Homo sapiens	CVCL_2891
	Calu-3	Lung adenocarcinoma	Homo sapiens	CVCL_0609
	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
In-vivo Model	HCC827 (3×10⁶) cells suspended in 100 uL of PBS were injected into the left inguen of female Balb/c nude mice (body weight 18-20 g; age 6 weeks; Beijing Huafukang Bioscience Co., Inc.). When the tumor volumes reached 50-100 mm³ on the 10th posttransplantation day, the mice were randomized into four groups (10 mice per group) and were intragastrically administered vehicle (normal saline), crizotinib (25 mg/kg body weight), chidamide (5 mg/kg), or the combination of the two drugs daily for 21 days. The tumor volumes and body weights of the mice were measured every 3 days.
Experiment 2 Reporting the m6A-centered Drug Response				[1]
Response Summary	Chidamide could decrease Hepatocyte growth factor receptor (c-Met/MET) expression by inhibiting mRNA N6-methyladenosine (m6A) modification through the downregulation of METTL3 and WTAP expression, subsequently increasing the crizotinib sensitivity of NSCLC cells in a c-MET-/HGF-dependent manner.
Target Regulator	Wilms tumor 1-associating protein (WTAP)		WRITER	Regulator Info
Target Regulation	Up regulation
Responsed Disease	Non-small-cell lung carcinoma		ICD-11: 2C25.Y	Disease Info
Pathway Response	EGFR tyrosine kinase inhibitor resistance			hsa01521
In-vitro Model	HCC827	Lung adenocarcinoma	Homo sapiens	CVCL_2063
	NCI-H661	Lung large cell carcinoma	Homo sapiens	CVCL_1577
	NCI-H596	Lung adenosquamous carcinoma	Homo sapiens	CVCL_1571
	NCI-H460	Lung large cell carcinoma	Homo sapiens	CVCL_0459
	NCI-H358	Minimally invasive lung adenocarcinoma	Homo sapiens	CVCL_1559
	NCI-H292	Lung mucoepidermoid carcinoma	Homo sapiens	CVCL_0455
	NCI-H1975	Lung adenocarcinoma	Homo sapiens	CVCL_1511
	NCI-H1650	Minimally invasive lung adenocarcinoma	Homo sapiens	CVCL_1483
	NCI-H1395	Lung adenocarcinoma	Homo sapiens	CVCL_1467
	EBC-1	Lung squamous cell carcinoma	Homo sapiens	CVCL_2891
	Calu-3	Lung adenocarcinoma	Homo sapiens	CVCL_0609
	A-549	Lung adenocarcinoma	Homo sapiens	CVCL_0023
In-vivo Model	HCC827 (3×10⁶) cells suspended in 100 uL of PBS were injected into the left inguen of female Balb/c nude mice (body weight 18-20 g; age 6 weeks; Beijing Huafukang Bioscience Co., Inc.). When the tumor volumes reached 50-100 mm³ on the 10th posttransplantation day, the mice were randomized into four groups (10 mice per group) and were intragastrically administered vehicle (normal saline), crizotinib (25 mg/kg body weight), chidamide (5 mg/kg), or the combination of the two drugs daily for 21 days. The tumor volumes and body weights of the mice were measured every 3 days.

Gefitinib [Approved]

Drug Info

In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response				[2]
Response Summary	METTL3 combines with Hepatocyte growth factor receptor (c-Met/MET) and causes the PI3K/AKT signalling pathway to be manipulated, which affects the sensitivity of lung cancer cells to gefitinib. METTL3 knockdown promotes apoptosis and inhibits proliferation of lung cancer cells.
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Responsed Disease	Lung cancer		ICD-11: 2C25	Disease Info
Pathway Response	PI3K-Akt signaling pathway			hsa04151
In-vitro Model	PC-9	Lung adenocarcinoma	Homo sapiens	CVCL_B260
In-vitro Model	NCI-H3255	Lung adenocarcinoma	Homo sapiens	CVCL_6831

Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator

DNA modification

m6A Regulator: Methyltransferase-like 3 (METTL3)

Regulator Info

In total 6 item(s) under this m6A regulator
Crosstalk ID: M6ACROT02146		Crosstalk Info
Epigenetic Regulator	Cysteine methyltransferase DNMT3A (DNMT3A)
Regulated Target	Methyltransferase-like protein 3 (METTL3)
Crosstalk relationship	DNA modification → m6A
Disease	Lung cancer	Disease Info
Drug	Metformin	Drug Info
Crosstalk ID: M6ACROT02159		Crosstalk Info
Epigenetic Regulator	DNA (cytosine-5)-methyltransferase 3B (DNMT3B)
Regulated Target	Methyltransferase-like protein 3 (METTL3)
Crosstalk relationship	DNA modification → m6A
Disease	Lung cancer	Disease Info
Drug	Metformin	Drug Info
Crosstalk ID: M6ACROT02172		Crosstalk Info
Epigenetic Regulator	Cysteine methyltransferase DNMT3A (DNMT3A)
Regulated Target	Methyltransferase-like protein 3 (METTL3)
Crosstalk relationship	DNA modification → m6A
Disease	Lung cancer	Disease Info
Drug	Osimertinib	Drug Info
Crosstalk ID: M6ACROT02185		Crosstalk Info
Epigenetic Regulator	DNA (cytosine-5)-methyltransferase 3B (DNMT3B)
Regulated Target	Methyltransferase-like protein 3 (METTL3)
Crosstalk relationship	DNA modification → m6A
Disease	Lung cancer	Disease Info
Drug	Osimertinib	Drug Info
Crosstalk ID: M6ACROT05855		Crosstalk Info
Epigenetic Regulator	Cysteine methyltransferase DNMT3A (DNMT3A)
Regulated Target	Methyltransferase-like protein 3 (METTL3)
Crosstalk relationship	DNA modification → m6A
Disease	Lung cancer	Disease Info
Drug	Gefitinib	Drug Info
Crosstalk ID: M6ACROT05857		Crosstalk Info
Epigenetic Regulator	DNA (cytosine-5)-methyltransferase 3B (DNMT3B)
Regulated Target	Methyltransferase-like protein 3 (METTL3)
Crosstalk relationship	DNA modification → m6A
Disease	Lung cancer	Disease Info
Drug	Gefitinib	Drug Info

Histone modification

m6A Regulator: Methyltransferase-like 3 (METTL3)

Regulator Info

In total 2 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03382		Crosstalk Info
Regulated Target	Histone H3 lysine 27 acetylation (H3K27ac)
Crosstalk relationship	Histone modification → m6A
Disease	Lung cancer	Disease Info
Drug	Gefitinib	Drug Info
Crosstalk ID: M6ACROT03395		Crosstalk Info
Regulated Target	Histone H3 lysine 4 monomethylation (H3K4me1)
Crosstalk relationship	Histone modification → m6A
Disease	Lung cancer	Disease Info
Drug	Gefitinib	Drug Info

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00325)

Hepatocyte growth factor receptor (c-Met/MET)

Adenosine-to-Inosine editing (A-to-I)

In total 1 m6A sequence/site(s) in this target gene
mod ID: A2ISITE002306		Click to Show/Hide the Full List
mod site	chr7:116753928-116753929:+		[5]
Sequence	AGGAGGTGCTTTATTAAGAAATAATTAATGAAACCTGGGCA
Transcript ID List	ENST00000495962.1; ENST00000436117.2; ENST00000397752.7; ENST00000318493.11
External Link	RMBase: RNA-editing_site_126692

5-methylcytidine (m5C)

In total 3 m6A sequence/site(s) in this target gene
mod ID: M5CSITE004210		Click to Show/Hide the Full List
mod site	chr7:116699926-116699927:+		[6]
Sequence	CACACAAGAATAATCAGGTTCTGTTCCATAAACTCTGGATT
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000436117.2; ENST00000397752.7; ENST00000318493.11
External Link	RMBase: m5C_site_40324
mod ID: M5CSITE004211		Click to Show/Hide the Full List
mod site	chr7:116796912-116796913:+		[6]
Sequence	ACAGGCATGAGCCACTGCGCCCAGCCCTTATAAATTTTTGT
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000397752.7; ENST00000318493.11
External Link	RMBase: m5C_site_40325
mod ID: M5CSITE004212		Click to Show/Hide the Full List
mod site	chr7:116796917-116796918:+		[6]
Sequence	CATGAGCCACTGCGCCCAGCCCTTATAAATTTTTGTATAGA
Seq Type List	Bisulfite-seq
Transcript ID List	ENST00000397752.7; ENST00000318493.11
External Link	RMBase: m5C_site_40326

N6-methyladenosine (m6A)

In total 145 m6A sequence/site(s) in this target gene
mod ID: M6ASITE081926		Click to Show/Hide the Full List
mod site	chr7:116672197-116672198:+		[7]
Sequence	ACAGCACGCGAGGCAGACAGACACGTGCTGGGGCGGGCAGG
Motif Score	2.897386905
Cell/Tissue List	HepG2; A549; HEK293T; iSLK; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000318493.11
External Link	RMBase: m6A_site_773696
mod ID: M6ASITE081927		Click to Show/Hide the Full List
mod site	chr7:116699074-116699075:+		[8]
Sequence	GAACCTGTTTTGGCAGATAAACCTCTCATAATGAAGGCCCC
Motif Score	2.185083333
Cell/Tissue List	HeLa; HepG2; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000456159.1; ENST00000318493.11; ENST00000397752.7
External Link	RMBase: m6A_site_773697
mod ID: M6ASITE081928		Click to Show/Hide the Full List
mod site	chr7:116699231-116699232:+		[8]
Sequence	TTCCCAACTTCACCGCGGAAACACCCATCCAGAATGTCATT
Motif Score	2.20572619
Cell/Tissue List	HeLa; HEK293T; HepG2; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000456159.1; ENST00000318493.11; ENST00000397752.7; ENST00000436117.2
External Link	RMBase: m6A_site_773698
mod ID: M6ASITE081929		Click to Show/Hide the Full List
mod site	chr7:116699313-116699314:+		[8]
Sequence	TTATGTTTTAAATGAGGAAGACCTTCAGAAGGTTGCTGAGT
Motif Score	2.876744048
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; fibroblasts; HEK293A-TOA; iSLK; MSC; TIME; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000397752.7; ENST00000436117.2; ENST00000456159.1; ENST00000318493.11
External Link	RMBase: m6A_site_773699
mod ID: M6ASITE081930		Click to Show/Hide the Full List
mod site	chr7:116699339-116699340:+		[8]
Sequence	AGAAGGTTGCTGAGTACAAGACTGGGCCTGTGCTGGAACAC
Motif Score	3.319380952
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; fibroblasts; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000456159.1; ENST00000436117.2; ENST00000318493.11; ENST00000397752.7
External Link	RMBase: m6A_site_773700
mod ID: M6ASITE081931		Click to Show/Hide the Full List
mod site	chr7:116699356-116699357:+		[8]
Sequence	AAGACTGGGCCTGTGCTGGAACACCCAGATTGTTTCCCATG
Motif Score	2.951386905
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; fibroblasts; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000318493.11; ENST00000436117.2; ENST00000456159.1; ENST00000397752.7
External Link	RMBase: m6A_site_773701
mod ID: M6ASITE081932		Click to Show/Hide the Full List
mod site	chr7:116699382-116699383:+		[8]
Sequence	AGATTGTTTCCCATGTCAGGACTGCAGCAGCAAAGCCAATT
Motif Score	4.065041667
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; hESCs; fibroblasts; H1299; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List	ENST00000436117.2; ENST00000456159.1; ENST00000318493.11; ENST00000397752.7
External Link	RMBase: m6A_site_773702
mod ID: M6ASITE081933		Click to Show/Hide the Full List
mod site	chr7:116699501-116699502:+		[8]
Sequence	GTGGCAGCGTCAACAGAGGGACCTGCCAGCGACATGTCTTT
Motif Score	3.622404762
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; hESCs; fibroblasts; H1299; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000397752.7; ENST00000436117.2; ENST00000318493.11; ENST00000456159.1
External Link	RMBase: m6A_site_773703
mod ID: M6ASITE081934		Click to Show/Hide the Full List
mod site	chr7:116699652-116699653:+		[8]
Sequence	AGTCCTTTCATCTGTAAAGGACCGGTTCATCAACTTCTTTG
Motif Score	3.622404762
Cell/Tissue List	HeLa; HEK293T; A549; HepG2; fibroblasts; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000318493.11; ENST00000397752.7; ENST00000436117.2
External Link	RMBase: m6A_site_773704
mod ID: M6ASITE081935		Click to Show/Hide the Full List
mod site	chr7:116699775-116699776:+		[8]
Sequence	TGGTTTTATGTTTTTGACGGACCAGTCCTACATTGATGTTT
Motif Score	3.622404762
Cell/Tissue List	HeLa; HEK293T; HepG2; fibroblasts; A549; Huh7; HEK293A-TOA; iSLK; TIME; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List	ENST00000318493.11; ENST00000436117.2; ENST00000397752.7
External Link	RMBase: m6A_site_773705
mod ID: M6ASITE081936		Click to Show/Hide the Full List
mod site	chr7:116699850-116699851:+		[9]
Sequence	TGTCCATGCCTTTGAAAGCAACAATTTTATTTACTTCTTGA
Motif Score	2.173910714
Cell/Tissue List	hESC-HEK293T; A549
Seq Type List	MAZTER-seq; m6A-CLIP/IP
Transcript ID List	ENST00000436117.2; ENST00000318493.11; ENST00000397752.7
External Link	RMBase: m6A_site_773706
mod ID: M6ASITE081937		Click to Show/Hide the Full List
mod site	chr7:116699885-116699886:+		[8]
Sequence	TCTTGACGGTCCAAAGGGAAACTCTAGATGCTCAGACTTTT
Motif Score	2.627720238
Cell/Tissue List	HeLa; HEK293T; HepG2; fibroblasts; A549; Huh7; HEK293A-TOA; iSLK; MSC; TIME; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List	ENST00000318493.11; ENST00000397752.7; ENST00000436117.2
External Link	RMBase: m6A_site_773707
mod ID: M6ASITE081938		Click to Show/Hide the Full List
mod site	chr7:116699900-116699901:+		[8]
Sequence	GGGAAACTCTAGATGCTCAGACTTTTCACACAAGAATAATC
Motif Score	3.319380952
Cell/Tissue List	HeLa; HEK293T; A549; HepG2; fibroblasts; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List	ENST00000397752.7; ENST00000436117.2; ENST00000318493.11
External Link	RMBase: m6A_site_773708
mod ID: M6ASITE081939		Click to Show/Hide the Full List
mod site	chr7:116699937-116699938:+		[8]
Sequence	AATCAGGTTCTGTTCCATAAACTCTGGATTGCATTCCTACA
Motif Score	2.627720238
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; fibroblasts; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000436117.2; ENST00000318493.11; ENST00000397752.7
External Link	RMBase: m6A_site_773709
mod ID: M6ASITE081940		Click to Show/Hide the Full List
mod site	chr7:116699955-116699956:+		[9]
Sequence	AAACTCTGGATTGCATTCCTACATGGAAATGCCTCTGGAGT
Motif Score	2.078666667
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000436117.2; ENST00000397752.7; ENST00000318493.11
External Link	RMBase: m6A_site_773710
mod ID: M6ASITE081941		Click to Show/Hide the Full List
mod site	chr7:116700008-116700009:+		[9]
Sequence	AAAAGAGAAAAAAGAGATCCACAAAGAAGGAAGTGTTTAAT
Motif Score	2.053113095
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000397752.7; ENST00000318493.11; ENST00000436117.2
External Link	RMBase: m6A_site_773711
mod ID: M6ASITE081942		Click to Show/Hide the Full List
mod site	chr7:116700076-116700077:+		[8]
Sequence	CCTGGGGCCCAGCTTGCTAGACAAATAGGAGCCAGCCTGAA
Motif Score	2.897386905
Cell/Tissue List	HeLa; HEK293T; A549; hESC-HEK293T; HepG2; fibroblasts; iSLK; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq; MAZTER-seq
Transcript ID List	ENST00000397752.7; ENST00000318493.11; ENST00000436117.2
External Link	RMBase: m6A_site_773712
mod ID: M6ASITE081943		Click to Show/Hide the Full List
mod site	chr7:116700102-116700103:+		[9]
Sequence	AGGAGCCAGCCTGAATGATGACATTCTTTTCGGGGTGTTCG
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T; A549
Seq Type List	MAZTER-seq; m6A-CLIP/IP
Transcript ID List	ENST00000436117.2; ENST00000397752.7; ENST00000318493.11
External Link	RMBase: m6A_site_773713
mod ID: M6ASITE081944		Click to Show/Hide the Full List
mod site	chr7:116700148-116700149:+		[8]
Sequence	AGCAAGCCAGATTCTGCCGAACCAATGGATCGATCTGCCAT
Motif Score	2.930744048
Cell/Tissue List	HeLa; HEK293T; A549; HepG2; fibroblasts; H1299; iSLK; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000436117.2; ENST00000318493.11; ENST00000397752.7
External Link	RMBase: m6A_site_773714
mod ID: M6ASITE081945		Click to Show/Hide the Full List
mod site	chr7:116700225-116700226:+		[8]
Sequence	CAACAAGATCGTCAACAAAAACAATGTGAGATGTCTCCAGC
Motif Score	2.20572619
Cell/Tissue List	HeLa; A549; H1299; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000318493.11; ENST00000397752.7; ENST00000436117.2
External Link	RMBase: m6A_site_773715
mod ID: M6ASITE081946		Click to Show/Hide the Full List
mod site	chr7:116700256-116700257:+		[8]
Sequence	TGTCTCCAGCATTTTTACGGACCCAATCATGAGCACTGCTT
Motif Score	3.622404762
Cell/Tissue List	HeLa; A549; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000318493.11; ENST00000436117.2; ENST00000397752.7
External Link	RMBase: m6A_site_773716
mod ID: M6ASITE081947		Click to Show/Hide the Full List
mod site	chr7:116724150-116724151:+		[8]
Sequence	CGGGACTCCGTGGGCGTAGGACCCTCCGAGCCAGGTGAGGG
Motif Score	3.622404762
Cell/Tissue List	HeLa; A549
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000318493.11; ENST00000397752.7; ENST00000436117.2; ENST00000495962.1
External Link	RMBase: m6A_site_773717
mod ID: M6ASITE081948		Click to Show/Hide the Full List
mod site	chr7:116724800-116724801:+		[8]
Sequence	GTGCTAGATTGGAGGTGAAGACCCTGGAGCCAGAGAGCCTA
Motif Score	2.876744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	rmsk_2348879; ENST00000436117.2; ENST00000495962.1; ENST00000318493.11; ENST00000397752.7
External Link	RMBase: m6A_site_773718
mod ID: M6ASITE081949		Click to Show/Hide the Full List
mod site	chr7:116731718-116731719:+		[8]
Sequence	CGCGCCGTGATGAATATCGAACAGAGTTTACCACAGCTTTG
Motif Score	2.951386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000436117.2; ENST00000318493.11; ENST00000495962.1; ENST00000397752.7
External Link	RMBase: m6A_site_773719
mod ID: M6ASITE081950		Click to Show/Hide the Full List
mod site	chr7:116731784-116731785:+		[9]
Sequence	AATTCAGCGAAGTCCTCTTAACATCTATATCCACCTTCATT
Motif Score	2.168095238
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000318493.11; ENST00000436117.2; ENST00000397752.7; ENST00000495962.1
External Link	RMBase: m6A_site_773720
mod ID: M6ASITE081951		Click to Show/Hide the Full List
mod site	chr7:116731812-116731813:+		[8]
Sequence	ATCCACCTTCATTAAAGGAGACCTCACCATAGCTAATCTTG
Motif Score	2.876744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000495962.1; ENST00000436117.2; ENST00000318493.11; ENST00000397752.7
External Link	RMBase: m6A_site_773721
mod ID: M6ASITE081952		Click to Show/Hide the Full List
mod site	chr7:116731835-116731836:+		[8]
Sequence	TCACCATAGCTAATCTTGGGACATCAGAGGGTCGCTTCATG
Motif Score	3.643047619
Cell/Tissue List	HeLa; hESC-HEK293T
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000436117.2; ENST00000397752.7; ENST00000495962.1; ENST00000318493.11
External Link	RMBase: m6A_site_773722
mod ID: M6ASITE081953		Click to Show/Hide the Full List
mod site	chr7:116739969-116739970:+		[8]
Sequence	GTTGTGGTTTCTCGATCAGGACCATCAACCCCTCATGTGAA
Motif Score	3.622404762
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000397752.7; ENST00000318493.11; ENST00000436117.2; ENST00000495962.1
External Link	RMBase: m6A_site_773723
mod ID: M6ASITE081954		Click to Show/Hide the Full List
mod site	chr7:116740001-116740002:+		[8]
Sequence	TCATGTGAATTTTCTCCTGGACTCCCATCCAGTGTCTCCAG
Motif Score	4.065041667
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000495962.1; ENST00000318493.11; ENST00000397752.7; ENST00000436117.2
External Link	RMBase: m6A_site_773724
mod ID: M6ASITE081955		Click to Show/Hide the Full List
mod site	chr7:116740039-116740040:+		[9]
Sequence	CAGAAGTGATTGTGGAGCATACATTAAACCAAAATGGCTAC
Motif Score	2.110482143
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000397752.7; ENST00000436117.2; ENST00000318493.11; ENST00000495962.1
External Link	RMBase: m6A_site_773725
mod ID: M6ASITE081956		Click to Show/Hide the Full List
mod site	chr7:116740046-116740047:+		[8]
Sequence	GATTGTGGAGCATACATTAAACCAAAATGGCTACACACTGG
Motif Score	2.185083333
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000495962.1; ENST00000436117.2; ENST00000397752.7; ENST00000318493.11
External Link	RMBase: m6A_site_773726
mod ID: M6ASITE081957		Click to Show/Hide the Full List
mod site	chr7:116740886-116740887:+		[8]
Sequence	TTGAATGGCTTGGGCTGCAGACATTTCCAGTCCTGCAGTCA
Motif Score	2.897386905
Cell/Tissue List	HeLa; hESC-HEK293T
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000436117.2; ENST00000397752.7; ENST00000495962.1; ENST00000318493.11
External Link	RMBase: m6A_site_773727
mod ID: M6ASITE081958		Click to Show/Hide the Full List
mod site	chr7:116740951-116740952:+		[9]
Sequence	TCAGTGTGGCTGGTGCCACGACAAATGTGTGCGATCGGAGG
Motif Score	2.865571429
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000318493.11; ENST00000495962.1; ENST00000397752.7; ENST00000436117.2
External Link	RMBase: m6A_site_773728
mod ID: M6ASITE081959		Click to Show/Hide the Full List
mod site	chr7:116740986-116740987:+		[8]
Sequence	CGGAGGAATGCCTGAGCGGGACATGGACTCAACAGATCTGT
Motif Score	3.643047619
Cell/Tissue List	HeLa; liver
Seq Type List	m6A-seq; m6A-REF-seq
Transcript ID List	ENST00000318493.11; ENST00000495962.1; ENST00000397752.7; ENST00000436117.2
External Link	RMBase: m6A_site_773729
mod ID: M6ASITE081960		Click to Show/Hide the Full List
mod site	chr7:116740992-116740993:+		[8]
Sequence	AATGCCTGAGCGGGACATGGACTCAACAGATCTGTCTGCCT
Motif Score	4.065041667
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000495962.1; ENST00000436117.2; ENST00000397752.7; ENST00000318493.11
External Link	RMBase: m6A_site_773730
mod ID: M6ASITE081961		Click to Show/Hide the Full List
mod site	chr7:116740997-116740998:+		[10]
Sequence	CTGAGCGGGACATGGACTCAACAGATCTGTCTGCCTGCAAT
Motif Score	2.173910714
Cell/Tissue List	kidney
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000318493.11; ENST00000436117.2; ENST00000495962.1; ENST00000397752.7
External Link	RMBase: m6A_site_773731
mod ID: M6ASITE081962		Click to Show/Hide the Full List
mod site	chr7:116755387-116755388:+		[8]
Sequence	GTGCACCCCTTGAAGGAGGGACAAGGCTGACCATATGTGGC
Motif Score	3.643047619
Cell/Tissue List	HeLa; hESC-HEK293T
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000495962.1; ENST00000397752.7; ENST00000436117.2; ENST00000318493.11
External Link	RMBase: m6A_site_773732
mod ID: M6ASITE081963		Click to Show/Hide the Full List
mod site	chr7:116755412-116755413:+		[8]
Sequence	GCTGACCATATGTGGCTGGGACTTTGGATTTCGGAGGAATA
Motif Score	4.065041667
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000495962.1; ENST00000436117.2; ENST00000397752.7; ENST00000318493.11
External Link	RMBase: m6A_site_773733
mod ID: M6ASITE081964		Click to Show/Hide the Full List
mod site	chr7:116755453-116755454:+		[8]
Sequence	ATAAATTTGATTTAAAGAAAACTAGAGTTCTCCTTGGAAAT
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000436117.2; ENST00000318493.11; ENST00000397752.7
External Link	RMBase: m6A_site_773734
mod ID: M6ASITE081965		Click to Show/Hide the Full List
mod site	chr7:116755513-116755514:+		[9]
Sequence	TAAGTGAGAGCACGATGAATACGTAAGGATCTTAAAATGCT
Motif Score	2.084416667
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000318493.11; ENST00000436117.2; ENST00000397752.7
External Link	RMBase: m6A_site_773735
mod ID: M6ASITE081966		Click to Show/Hide the Full List
mod site	chr7:116757509-116757510:+		[8]
Sequence	TTATTTCAAATGGCCACGGGACAACACAATACAGTACATTC
Motif Score	3.643047619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000318493.11; ENST00000436117.2; ENST00000397752.7
External Link	RMBase: m6A_site_773736
mod ID: M6ASITE081967		Click to Show/Hide the Full List
mod site	chr7:116757649-116757650:+		[9]
Sequence	CCCTCCAGGATCCTGTAATAACAAGTATTTCGCCGAAATAC
Motif Score	2.168095238
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000436117.2; ENST00000397752.7; ENST00000318493.11
External Link	RMBase: m6A_site_773737
mod ID: M6ASITE081968		Click to Show/Hide the Full List
mod site	chr7:116757719-116757720:+		[8]
Sequence	TTTAACTGGAAATTACCTAAACAGTGGGAATTCTAGACACA
Motif Score	2.20572619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000436117.2; ENST00000318493.11; ENST00000397752.7
External Link	RMBase: m6A_site_773738
mod ID: M6ASITE081969		Click to Show/Hide the Full List
mod site	chr7:116757735-116757736:+		[8]
Sequence	CTAAACAGTGGGAATTCTAGACACATTTCAATTGGTGGAAA
Motif Score	2.897386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000318493.11; ENST00000436117.2; ENST00000397752.7
External Link	RMBase: m6A_site_773739
mod ID: M6ASITE081970		Click to Show/Hide the Full List
mod site	chr7:116757757-116757758:+		[8]
Sequence	ACATTTCAATTGGTGGAAAAACATGTACTTTAAAAAGGTGT
Motif Score	2.20572619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000397752.7; ENST00000318493.11; ENST00000436117.2
External Link	RMBase: m6A_site_773740
mod ID: M6ASITE081971		Click to Show/Hide the Full List
mod site	chr7:116758466-116758467:+		[8]
Sequence	TTTTTTGTTCAGTGTGTCAAACAGTATTCTTGAATGTTATA
Motif Score	2.20572619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000397752.7; ENST00000436117.2; ENST00000318493.11
External Link	RMBase: m6A_site_773741
mod ID: M6ASITE081972		Click to Show/Hide the Full List
mod site	chr7:116758498-116758499:+		[8]
Sequence	AATGTTATACCCCAGCCCAAACCATTTCAACTGAGTTTGCT
Motif Score	2.185083333
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000436117.2; ENST00000397752.7; ENST00000318493.11
External Link	RMBase: m6A_site_773742
mod ID: M6ASITE081973		Click to Show/Hide the Full List
mod site	chr7:116758552-116758553:+		[8]
Sequence	TTGACTTAGCCAACCGAGAGACAAGCATCTTCAGTTACCGT
Motif Score	2.897386905
Cell/Tissue List	HeLa; hESC-HEK293T
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000422097.1; ENST00000397752.7; ENST00000318493.11; ENST00000436117.2
External Link	RMBase: m6A_site_773743
mod ID: M6ASITE081974		Click to Show/Hide the Full List
mod site	chr7:116759351-116759352:+		[8]
Sequence	TACAGTACTTGGTGGAAAGAACCTCTCAACATTGTCAGTTT
Motif Score	2.930744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000422097.1; ENST00000436117.2; ENST00000397752.7; ENST00000318493.11
External Link	RMBase: m6A_site_773744
mod ID: M6ASITE081975		Click to Show/Hide the Full List
mod site	chr7:116759400-116759401:+		[9]
Sequence	GCTTTGCCAGTGGTGGGAGCACAATAACAGGTGTTGGGAAA
Motif Score	2.830589286
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000397752.7; ENST00000436117.2; ENST00000422097.1; ENST00000318493.11
External Link	RMBase: m6A_site_773745
mod ID: M6ASITE081976		Click to Show/Hide the Full List
mod site	chr7:116759422-116759423:+		[8]
Sequence	AATAACAGGTGTTGGGAAAAACCTGAATTCAGTTAGTGTCC
Motif Score	2.185083333
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000436117.2; ENST00000318493.11; ENST00000422097.1; ENST00000397752.7
External Link	RMBase: m6A_site_773746
mod ID: M6ASITE081977		Click to Show/Hide the Full List
mod site	chr7:116759479-116759480:+		[8]
Sequence	TGTGCATGAAGCAGGAAGGAACTTTACAGTGGTAAGTCCTT
Motif Score	3.373380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000422097.1; ENST00000318493.11; ENST00000436117.2; ENST00000397752.7
External Link	RMBase: m6A_site_773747
mod ID: M6ASITE081978		Click to Show/Hide the Full List
mod site	chr7:116763057-116763058:+		[9]
Sequence	GTCTTTCTCTAGGCATGTCAACATCGCTCTAATTCAGAGAT
Motif Score	2.173910714
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000397752.7; ENST00000422097.1; ENST00000436117.2; ENST00000318493.11
External Link	RMBase: m6A_site_773748
mod ID: M6ASITE081979		Click to Show/Hide the Full List
mod site	chr7:116763133-116763134:+		[8]
Sequence	ATCTGCAACTCCCCCTGAAAACCAAAGCCTTTTTCATGTTA
Motif Score	2.185083333
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000422097.1; ENST00000318493.11; ENST00000397752.7
External Link	RMBase: m6A_site_773749
mod ID: M6ASITE081980		Click to Show/Hide the Full List
mod site	chr7:116763192-116763193:+		[9]
Sequence	TACTTTGATCTCATTTATGTACATAATCCTGTGTTTAAGCC
Motif Score	2.856142857
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000318493.11; ENST00000422097.1; ENST00000397752.7
External Link	RMBase: m6A_site_773750
mod ID: M6ASITE081981		Click to Show/Hide the Full List
mod site	chr7:116769715-116769716:+		[9]
Sequence	AATAAGAGCTGTGAGAATATACACTTACATTCTGAAGCCGT
Motif Score	2.110482143
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000422097.1; ENST00000318493.11; ENST00000397752.7; ENST00000454623.1
External Link	RMBase: m6A_site_773751
mod ID: M6ASITE081982		Click to Show/Hide the Full List
mod site	chr7:116769771-116769772:+		[8]
Sequence	CAATGACCTGCTGAAATTGAACAGCGAGCTAAATATAGAGG
Motif Score	2.951386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000318493.11; ENST00000454623.1; ENST00000422097.1; ENST00000397752.7
External Link	RMBase: m6A_site_773752
mod ID: M6ASITE081983		Click to Show/Hide the Full List
mod site	chr7:116771965-116771966:+		[8]
Sequence	GGTTTCAAATGAATCTGTAGACTACCGAGCTACTTTTCCAG
Motif Score	3.319380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000454623.1; ENST00000397752.7; ENST00000318493.11
External Link	RMBase: m6A_site_773753
mod ID: M6ASITE081984		Click to Show/Hide the Full List
mod site	chr7:116774917-116774918:+		[10]
Sequence	TCTCAGAACGGTTCATGCCGACAAGTGCAGTATCCTCTGAC
Motif Score	2.865571429
Cell/Tissue List	HEK293; kidney; hESC-HEK293T
Seq Type List	m6A-REF-seq; MAZTER-seq
Transcript ID List	ENST00000397752.7; ENST00000454623.1; ENST00000318493.11
External Link	RMBase: m6A_site_773754
mod ID: M6ASITE081985		Click to Show/Hide the Full List
mod site	chr7:116774940-116774941:+		[8]
Sequence	AGTGCAGTATCCTCTGACAGACATGTCCCCCATCCTAACTA
Motif Score	2.897386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000397752.7; ENST00000454623.1; ENST00000318493.11
External Link	RMBase: m6A_site_773755
mod ID: M6ASITE081986		Click to Show/Hide the Full List
mod site	chr7:116774957-116774958:+		[11]
Sequence	CAGACATGTCCCCCATCCTAACTAGTGGGGACTCTGATATA
Motif Score	2.590089286
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000397752.7; ENST00000454623.1; ENST00000318493.11
External Link	RMBase: m6A_site_773756
mod ID: M6ASITE081987		Click to Show/Hide the Full List
mod site	chr7:116774967-116774968:+		[8]
Sequence	CCCCATCCTAACTAGTGGGGACTCTGATATATCCAGTCCAT
Motif Score	4.065041667
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000397752.7; ENST00000454623.1; ENST00000318493.11
External Link	RMBase: m6A_site_773757
mod ID: M6ASITE081988		Click to Show/Hide the Full List
mod site	chr7:116777414-116777415:+		[8]
Sequence	TTGGTTGTGTATATCATGGGACTTTGTTGGACAATGATGGC
Motif Score	4.065041667
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000397752.7; ENST00000318493.11
External Link	RMBase: m6A_site_773758
mod ID: M6ASITE081989		Click to Show/Hide the Full List
mod site	chr7:116777424-116777425:+		[8]
Sequence	ATATCATGGGACTTTGTTGGACAATGATGGCAAGAAAATTC
Motif Score	3.643047619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000318493.11; ENST00000397752.7
External Link	RMBase: m6A_site_773759
mod ID: M6ASITE081990		Click to Show/Hide the Full List
mod site	chr7:116777466-116777467:+		[8]
Sequence	CTGTGCTGTGAAATCCTTGAACAGTAAGTGGCATTTTATTT
Motif Score	2.951386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000318493.11; ENST00000397752.7
External Link	RMBase: m6A_site_773760
mod ID: M6ASITE081991		Click to Show/Hide the Full List
mod site	chr7:116778784-116778785:+		[9]
Sequence	GGATTTCTCAGGAATCACTGACATAGGAGAAGTTTCCCAAT
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000318493.11; ENST00000397752.7
External Link	RMBase: m6A_site_773761
mod ID: M6ASITE081992		Click to Show/Hide the Full List
mod site	chr7:116778910-116778911:+		[9]
Sequence	TCCGCTGGTGGTCCTACCATACATGAAACATGGAGATCTTC
Motif Score	2.110482143
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000397752.7; ENST00000318493.11
External Link	RMBase: m6A_site_773762
mod ID: M6ASITE081993		Click to Show/Hide the Full List
mod site	chr7:116778917-116778918:+		[8]
Sequence	GTGGTCCTACCATACATGAAACATGGAGATCTTCGAAATTT
Motif Score	2.20572619
Cell/Tissue List	HeLa; hESC-HEK293T
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000397752.7; ENST00000318493.11
External Link	RMBase: m6A_site_773763
mod ID: M6ASITE081994		Click to Show/Hide the Full List
mod site	chr7:116778951-116778952:+		[8]
Sequence	GAAATTTCATTCGAAATGAGACTCATGTAAGTTGACTGCCA
Motif Score	3.319380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000318493.11; ENST00000397752.7
External Link	RMBase: m6A_site_773764
mod ID: M6ASITE081995		Click to Show/Hide the Full List
mod site	chr7:116782069-116782070:+		[11]
Sequence	TGCAAGCAAAAAGTTTGTCCACAGAGACTTGGCTGCAAGAA
Motif Score	2.053113095
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000397752.7; ENST00000318493.11
External Link	RMBase: m6A_site_773765
mod ID: M6ASITE081996		Click to Show/Hide the Full List
mod site	chr7:116782075-116782076:+		[8]
Sequence	CAAAAAGTTTGTCCACAGAGACTTGGCTGCAAGAAACTGTA
Motif Score	3.319380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000318493.11; ENST00000397752.7
External Link	RMBase: m6A_site_773766
mod ID: M6ASITE081997		Click to Show/Hide the Full List
mod site	chr7:116782090-116782091:+		[8]
Sequence	CAGAGACTTGGCTGCAAGAAACTGTATGTAAGTATCAGAAT
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000397752.7; ENST00000318493.11
External Link	RMBase: m6A_site_773767
mod ID: M6ASITE081998		Click to Show/Hide the Full List
mod site	chr7:116783353-116783354:+		[8]
Sequence	TGATTTTGGTCTTGCCAGAGACATGTATGATAAAGAATACT
Motif Score	2.897386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000318493.11; ENST00000397752.7
External Link	RMBase: m6A_site_773768
mod ID: M6ASITE081999		Click to Show/Hide the Full List
mod site	chr7:116783391-116783392:+		[8]
Sequence	ACTATAGTGTACACAACAAAACAGGTGCAAAGCTGCCAGTG
Motif Score	2.20572619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000318493.11; ENST00000397752.7
External Link	RMBase: m6A_site_773769
mod ID: M6ASITE082000		Click to Show/Hide the Full List
mod site	chr7:116783439-116783440:+		[8]
Sequence	TGGCTTTGGAAAGTCTGCAAACTCAAAAGTTTACCACCAAG
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000318493.11; ENST00000397752.7
External Link	RMBase: m6A_site_773770
mod ID: M6ASITE082001		Click to Show/Hide the Full List
mod site	chr7:116795687-116795688:+		[9]
Sequence	TGCTCCTCTGGGAGCTGATGACAAGAGGAGCCCCACCTTAT
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000397752.7; ENST00000318493.11
External Link	RMBase: m6A_site_773771
mod ID: M6ASITE082002		Click to Show/Hide the Full List
mod site	chr7:116795718-116795719:+		[8]
Sequence	CCCACCTTATCCTGACGTAAACACCTTTGATATAACTGTTT
Motif Score	2.20572619
Cell/Tissue List	HeLa; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000318493.11; ENST00000397752.7
External Link	RMBase: m6A_site_773772
mod ID: M6ASITE082003		Click to Show/Hide the Full List
mod site	chr7:116795739-116795740:+		[11]
Sequence	CACCTTTGATATAACTGTTTACTTGTTGCAAGGGAGAAGAC
Motif Score	2.494845238
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000318493.11; ENST00000397752.7
External Link	RMBase: m6A_site_773773
mod ID: M6ASITE082004		Click to Show/Hide the Full List
mod site	chr7:116795758-116795759:+		[8]
Sequence	TACTTGTTGCAAGGGAGAAGACTCCTACAACCCGAATACTG
Motif Score	3.319380952
Cell/Tissue List	HeLa; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000318493.11; ENST00000397752.7
External Link	RMBase: m6A_site_773774
mod ID: M6ASITE082005		Click to Show/Hide the Full List
mod site	chr7:116795784-116795785:+		[8]
Sequence	ACAACCCGAATACTGCCCAGACCCCTTGTAAGTAGTCTTTC
Motif Score	2.876744048
Cell/Tissue List	HeLa; HEK293T; A549; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000318493.11; ENST00000397752.7
External Link	RMBase: m6A_site_773775
mod ID: M6ASITE082006		Click to Show/Hide the Full List
mod site	chr7:116795946-116795947:+		[8]
Sequence	ATGCGCCCATCCTTTTCTGAACTGGTGTCCCGGATATCAGC
Motif Score	3.373380952
Cell/Tissue List	HeLa; HEK293T; HepG2; U2OS; A549; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000318493.11; ENST00000397752.7
External Link	RMBase: m6A_site_773776
mod ID: M6ASITE082007		Click to Show/Hide the Full List
mod site	chr7:116796089-116796090:+		[8]
Sequence	TAACGCTGATGATGAGGTGGACACACGACCAGCCTCCTTCT
Motif Score	3.643047619
Cell/Tissue List	HeLa; HEK293T; hESC-HEK293T; HepG2; U2OS; A549; HEK293A-TOA; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq; MAZTER-seq
Transcript ID List	ENST00000397752.7; ENST00000318493.11
External Link	RMBase: m6A_site_773777
mod ID: M6ASITE082008		Click to Show/Hide the Full List
mod site	chr7:116796115-116796116:+		[8]
Sequence	GACCAGCCTCCTTCTGGGAGACATCATAGTGCTAGTACTAT
Motif Score	2.897386905
Cell/Tissue List	HeLa; HEK293T; HepG2; A549; HEK293A-TOA; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000318493.11; ENST00000397752.7
External Link	RMBase: m6A_site_773778
mod ID: M6ASITE082009		Click to Show/Hide the Full List
mod site	chr7:116796154-116796155:+		[11]
Sequence	ATGTCAAAGCAACAGTCCACACTTTGTCCAATGGTTTTTTC
Motif Score	2.506922619
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000397752.7; ENST00000318493.11
External Link	RMBase: m6A_site_773779
mod ID: M6ASITE082010		Click to Show/Hide the Full List
mod site	chr7:116796227-116796228:+		[11]
Sequence	TTTGCTCTTGCCAAAATTGCACTATTATAGGACTTGTATTG
Motif Score	3.252583333
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000397752.7; ENST00000318493.11
External Link	RMBase: m6A_site_773780
mod ID: M6ASITE082011		Click to Show/Hide the Full List
mod site	chr7:116796238-116796239:+		[8]
Sequence	CAAAATTGCACTATTATAGGACTTGTATTGTTATTTAAATT
Motif Score	4.065041667
Cell/Tissue List	HeLa; HEK293T; A549; HepG2; fibroblasts; Huh7; HEK293A-TOA; iSLK; MSC; TIME; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List	ENST00000397752.7; ENST00000318493.11
External Link	RMBase: m6A_site_773781
mod ID: M6ASITE082012		Click to Show/Hide the Full List
mod site	chr7:116796286-116796287:+		[9]
Sequence	TCTAAGGAATTTCTTATCTGACAGAGCATCAGAACCAGAGG
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000397752.7; ENST00000318493.11
External Link	RMBase: m6A_site_773782
mod ID: M6ASITE082013		Click to Show/Hide the Full List
mod site	chr7:116796299-116796300:+		[12]
Sequence	TTATCTGACAGAGCATCAGAACCAGAGGCTTGGTCCCACAG
Motif Score	2.930744048
Cell/Tissue List	HEK293T; HeLa; A549; HepG2; fibroblasts; Huh7; HEK293A-TOA; iSLK; MSC; TIME; HEC-1-A
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000397752.7; ENST00000318493.11
External Link	RMBase: m6A_site_773783
mod ID: M6ASITE082014		Click to Show/Hide the Full List
mod site	chr7:116796327-116796328:+		[12]
Sequence	CTTGGTCCCACAGGCCACGGACCAATGGCCTGCAGCCGTGA
Motif Score	3.622404762
Cell/Tissue List	HEK293T; HeLa; A549; HepG2; fibroblasts; HEK293A-TOA; iSLK; MSC; TIME; endometrial; HEC-1-A
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000318493.11; ENST00000397752.7
External Link	RMBase: m6A_site_773784
mod ID: M6ASITE082015		Click to Show/Hide the Full List
mod site	chr7:116796350-116796351:+		[9]
Sequence	AATGGCCTGCAGCCGTGACAACACTCCTGTCATATTGGAGT
Motif Score	2.173910714
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000397752.7; ENST00000318493.11
External Link	RMBase: m6A_site_773785
mod ID: M6ASITE082016		Click to Show/Hide the Full List
mod site	chr7:116796376-116796377:+		[12]
Sequence	CTGTCATATTGGAGTCCAAAACTTGAATTCTGGGTTGAATT
Motif Score	2.627720238
Cell/Tissue List	HEK293T; HeLa; A549; HepG2; fibroblasts; HEK293A-TOA; iSLK; TIME; endometrial; HEC-1-A
Seq Type List	MeRIP-seq; m6A-seq
Transcript ID List	ENST00000318493.11; ENST00000397752.7
External Link	RMBase: m6A_site_773786
mod ID: M6ASITE082017		Click to Show/Hide the Full List
mod site	chr7:116796474-116796475:+		[8]
Sequence	GGGCTTCTTGATCACAGAAAACTCAGAAGAGATAGTAATGC
Motif Score	2.627720238
Cell/Tissue List	HeLa; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000318493.11; ENST00000397752.7
External Link	RMBase: m6A_site_773787
mod ID: M6ASITE082018		Click to Show/Hide the Full List
mod site	chr7:116796500-116796501:+		[8]
Sequence	AAGAGATAGTAATGCTCAGGACAGGAGCGGCAGCCCCAGAA
Motif Score	3.643047619
Cell/Tissue List	HeLa; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000397752.7; ENST00000318493.11
External Link	RMBase: m6A_site_773788
mod ID: M6ASITE082019		Click to Show/Hide the Full List
mod site	chr7:116796520-116796521:+		[8]
Sequence	ACAGGAGCGGCAGCCCCAGAACAGGCCACTCATTTAGAATT
Motif Score	2.951386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000318493.11; ENST00000397752.7
External Link	RMBase: m6A_site_773789
mod ID: M6ASITE082020		Click to Show/Hide the Full List
mod site	chr7:116796554-116796555:+		[8]
Sequence	TAGAATTCTAGTGTTTCAAAACACTTTTGTGTGTTGTATGG
Motif Score	2.20572619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000318493.11; ENST00000397752.7
External Link	RMBase: m6A_site_773790
mod ID: M6ASITE082021		Click to Show/Hide the Full List
mod site	chr7:116796622-116796623:+		[8]
Sequence	GTCATTCACCCATTAGGTAAACATTCCCTTTTAAATGTTTG
Motif Score	2.20572619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000397752.7; ENST00000318493.11
External Link	RMBase: m6A_site_773791
mod ID: M6ASITE082022		Click to Show/Hide the Full List
mod site	chr7:116796656-116796657:+		[8]
Sequence	ATGTTTGTTTGTTTTTTGAGACAGGATCTCACTCTGTTGCC
Motif Score	2.897386905
Cell/Tissue List	HeLa; kidney
Seq Type List	m6A-seq; m6A-REF-seq
Transcript ID List	ENST00000318493.11; ENST00000397752.7
External Link	RMBase: m6A_site_773792
mod ID: M6ASITE082023		Click to Show/Hide the Full List
mod site	chr7:116796754-116796755:+		[8]
Sequence	AAGCCTCCCGAATAGCTGGGACTACAGGCGCACACCACCAT
Motif Score	4.065041667
Cell/Tissue List	HeLa; HEK293T; A549
Seq Type List	m6A-seq; DART-seq
Transcript ID List	ENST00000318493.11; ENST00000397752.7
External Link	RMBase: m6A_site_773793
mod ID: M6ASITE082024		Click to Show/Hide the Full List
mod site	chr7:116796840-116796841:+		[8]
Sequence	GTTGCCAAGGCTGGTTTCAAACTCCTGGACTCAAGAAATCC
Motif Score	2.627720238
Cell/Tissue List	HeLa; A549
Seq Type List	m6A-seq
Transcript ID List	ENST00000397752.7; ENST00000318493.11
External Link	RMBase: m6A_site_773794
mod ID: M6ASITE082025		Click to Show/Hide the Full List
mod site	chr7:116796848-116796849:+		[8]
Sequence	GGCTGGTTTCAAACTCCTGGACTCAAGAAATCCACCCACCT
Motif Score	4.065041667
Cell/Tissue List	HeLa; A549
Seq Type List	m6A-seq
Transcript ID List	ENST00000397752.7; ENST00000318493.11
External Link	RMBase: m6A_site_773795
mod ID: M6ASITE082026		Click to Show/Hide the Full List
mod site	chr7:116796937-116796938:+		[8]
Sequence	CCTTATAAATTTTTGTATAGACATTCCTTTGGTTGGAAGAA
Motif Score	2.897386905
Cell/Tissue List	HeLa; HEK293T
Seq Type List	m6A-seq; DART-seq
Transcript ID List	ENST00000318493.11; ENST00000397752.7
External Link	RMBase: m6A_site_773796
mod ID: M6ASITE082027		Click to Show/Hide the Full List
mod site	chr7:116796972-116796973:+		[11]
Sequence	GAAGAATATTTATAGGCAATACAGTCAAAGTTTCAAAATAG
Motif Score	2.110482143
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000318493.11; ENST00000397752.7
External Link	RMBase: m6A_site_773797
mod ID: M6ASITE082028		Click to Show/Hide the Full List
mod site	chr7:116797004-116797005:+		[8]
Sequence	TCAAAATAGCATCACACAAAACATGTTTATAAATGAACAGG
Motif Score	2.20572619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000397752.7; ENST00000318493.11
External Link	RMBase: m6A_site_773798
mod ID: M6ASITE082029		Click to Show/Hide the Full List
mod site	chr7:116797020-116797021:+		[8]
Sequence	CAAAACATGTTTATAAATGAACAGGATGTAATGTACATAGA
Motif Score	2.951386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000318493.11; ENST00000397752.7
External Link	RMBase: m6A_site_773799
mod ID: M6ASITE082030		Click to Show/Hide the Full List
mod site	chr7:116797128-116797129:+		[11]
Sequence	CACTGTTTGAGAATGATGCTACTCTGATCTAATGAATGTGA
Motif Score	2.500660714
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000318493.11; ENST00000397752.7
External Link	RMBase: m6A_site_773800
mod ID: M6ASITE082031		Click to Show/Hide the Full List
mod site	chr7:116797149-116797150:+		[8]
Sequence	CTCTGATCTAATGAATGTGAACATGTAGATGTTTTGTGTGT
Motif Score	2.951386905
Cell/Tissue List	HeLa; hESC-HEK293T
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000318493.11; ENST00000397752.7
External Link	RMBase: m6A_site_773801
mod ID: M6ASITE082032		Click to Show/Hide the Full List
mod site	chr7:116797186-116797187:+		[8]
Sequence	GTGTATTTTTTTAAATGAAAACTCAAAATAAGACAAGTAAT
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000318493.11; ENST00000397752.7
External Link	RMBase: m6A_site_773802
mod ID: M6ASITE082033		Click to Show/Hide the Full List
mod site	chr7:116797198-116797199:+		[8]
Sequence	AAATGAAAACTCAAAATAAGACAAGTAATTTGTTGATAAAT
Motif Score	2.897386905
Cell/Tissue List	HeLa; HEK293T; hESC-HEK293T
Seq Type List	m6A-seq; DART-seq; MAZTER-seq
Transcript ID List	ENST00000397752.7; ENST00000318493.11
External Link	RMBase: m6A_site_773803
mod ID: M6ASITE082034		Click to Show/Hide the Full List
mod site	chr7:116797232-116797233:+		[11]
Sequence	GATAAATATTTTTAAAGATAACTCAGCATGTTTGTAAAGCA
Motif Score	2.590089286
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000397752.7; ENST00000318493.11
External Link	RMBase: m6A_site_773804
mod ID: M6ASITE082035		Click to Show/Hide the Full List
mod site	chr7:116797381-116797382:+		[8]
Sequence	CACCTCGCAAGCAATTGGAAACAAAACTTTTGGGGAGTTTT
Motif Score	2.20572619
Cell/Tissue List	HeLa; hESC-HEK293T
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000318493.11; ENST00000397752.7
External Link	RMBase: m6A_site_773805
mod ID: M6ASITE082036		Click to Show/Hide the Full List
mod site	chr7:116797386-116797387:+		[8]
Sequence	CGCAAGCAATTGGAAACAAAACTTTTGGGGAGTTTTATTTT
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000397752.7; ENST00000318493.11
External Link	RMBase: m6A_site_773806
mod ID: M6ASITE082037		Click to Show/Hide the Full List
mod site	chr7:116797436-116797437:+		[8]
Sequence	TGTGTTTTATGTTAAGCAAAACATACTTTAGAAACAAATGA
Motif Score	2.20572619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000318493.11; ENST00000397752.7
External Link	RMBase: m6A_site_773807
mod ID: M6ASITE082038		Click to Show/Hide the Full List
mod site	chr7:116797449-116797450:+		[8]
Sequence	AAGCAAAACATACTTTAGAAACAAATGAAAAAGGCAATTGA
Motif Score	2.20572619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000318493.11; ENST00000397752.7
External Link	RMBase: m6A_site_773808
mod ID: M6ASITE082039		Click to Show/Hide the Full List
mod site	chr7:116797515-116797516:+		[8]
Sequence	GAATAGCCACCCTGAGCAGAACTTTGTGATGCTTCATTCTG
Motif Score	3.373380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000397752.7; ENST00000318493.11
External Link	RMBase: m6A_site_773809
mod ID: M6ASITE082040		Click to Show/Hide the Full List
mod site	chr7:116797554-116797555:+		[11]
Sequence	TGTGGAATTTTGTGCTTGCTACTGTATAGTGCATGTGGTGT
Motif Score	2.500660714
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000397752.7; ENST00000318493.11
External Link	RMBase: m6A_site_773810
mod ID: M6ASITE082041		Click to Show/Hide the Full List
mod site	chr7:116797605-116797606:+		[8]
Sequence	AACTGGTTTTGTCGACGTAAACATTTAAAGTGTTATATTTT
Motif Score	2.20572619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000397752.7; ENST00000318493.11
External Link	RMBase: m6A_site_773811
mod ID: M6ASITE082042		Click to Show/Hide the Full List
mod site	chr7:116797680-116797681:+		[8]
Sequence	AATTTTGTTAGGCCACAAAAACACTGCACTGTGAACATTTT
Motif Score	2.20572619
Cell/Tissue List	HeLa; HEK293T; HepG2; fibroblasts; A549; Huh7; HEK293A-TOA; iSLK; TIME; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000318493.11; ENST00000397752.7
External Link	RMBase: m6A_site_773812
mod ID: M6ASITE082043		Click to Show/Hide the Full List
mod site	chr7:116797687-116797688:+		[11]
Sequence	TTAGGCCACAAAAACACTGCACTGTGAACATTTTAGAAAAG
Motif Score	3.252583333
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000397752.7; ENST00000318493.11
External Link	RMBase: m6A_site_773813
mod ID: M6ASITE082044		Click to Show/Hide the Full List
mod site	chr7:116797694-116797695:+		[8]
Sequence	ACAAAAACACTGCACTGTGAACATTTTAGAAAAGGTATGTC
Motif Score	2.951386905
Cell/Tissue List	HeLa; HEK293T; hESC-HEK293T; HepG2; fibroblasts; A549; Huh7; HEK293A-TOA; iSLK; TIME; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq; DART-seq; MAZTER-seq
Transcript ID List	ENST00000397752.7; ENST00000318493.11
External Link	RMBase: m6A_site_773814
mod ID: M6ASITE082045		Click to Show/Hide the Full List
mod site	chr7:116797717-116797718:+		[8]
Sequence	TTTTAGAAAAGGTATGTCAGACTGGGATTAATGACAGCATG
Motif Score	3.319380952
Cell/Tissue List	HeLa; HEK293T; HepG2; fibroblasts; A549; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000318493.11; ENST00000397752.7
External Link	RMBase: m6A_site_773815
mod ID: M6ASITE082046		Click to Show/Hide the Full List
mod site	chr7:116797730-116797731:+		[9]
Sequence	ATGTCAGACTGGGATTAATGACAGCATGATTTTCAATGACT
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000318493.11; ENST00000397752.7
External Link	RMBase: m6A_site_773816
mod ID: M6ASITE082047		Click to Show/Hide the Full List
mod site	chr7:116797748-116797749:+		[11]
Sequence	TGACAGCATGATTTTCAATGACTGTAAATTGCGATAAGGAA
Motif Score	3.28175
Cell/Tissue List	HEK293T; A549
Seq Type List	DART-seq; m6A-CLIP/IP
Transcript ID List	ENST00000397752.7; ENST00000318493.11
External Link	RMBase: m6A_site_773817
mod ID: M6ASITE082048		Click to Show/Hide the Full List
mod site	chr7:116797786-116797787:+		[9]
Sequence	GAAATGTACTGATTGCCAATACACCCCACCCTCATTACATC
Motif Score	2.110482143
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000397752.7; ENST00000318493.11
External Link	RMBase: m6A_site_773818
mod ID: M6ASITE082049		Click to Show/Hide the Full List
mod site	chr7:116797802-116797803:+		[9]
Sequence	CAATACACCCCACCCTCATTACATCATCAGGACTTGAAGCC
Motif Score	2.07285119
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000397752.7; ENST00000318493.11
External Link	RMBase: m6A_site_773819
mod ID: M6ASITE082050		Click to Show/Hide the Full List
mod site	chr7:116797813-116797814:+		[8]
Sequence	ACCCTCATTACATCATCAGGACTTGAAGCCAAGGGTTAACC
Motif Score	4.065041667
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; hESCs; fibroblasts; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List	ENST00000397752.7; ENST00000318493.11
External Link	RMBase: m6A_site_773820
mod ID: M6ASITE082051		Click to Show/Hide the Full List
mod site	chr7:116797843-116797844:+		[9]
Sequence	AAGGGTTAACCCAGCAAGCTACAAAGAGGGTGTGTCACACT
Motif Score	2.078666667
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000318493.11; ENST00000397752.7
External Link	RMBase: m6A_site_773821
mod ID: M6ASITE082052		Click to Show/Hide the Full List
mod site	chr7:116797859-116797860:+		[9]
Sequence	AGCTACAAAGAGGGTGTGTCACACTGAAACTCAATAGTTGA
Motif Score	2.047297619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000397752.7; ENST00000318493.11
External Link	RMBase: m6A_site_773822
mod ID: M6ASITE082053		Click to Show/Hide the Full List
mod site	chr7:116797861-116797862:+		[11]
Sequence	CTACAAAGAGGGTGTGTCACACTGAAACTCAATAGTTGAGT
Motif Score	2.506922619
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000318493.11; ENST00000397752.7
External Link	RMBase: m6A_site_773823
mod ID: M6ASITE082054		Click to Show/Hide the Full List
mod site	chr7:116797867-116797868:+		[8]
Sequence	AGAGGGTGTGTCACACTGAAACTCAATAGTTGAGTTTGGCT
Motif Score	2.627720238
Cell/Tissue List	HeLa; HEK293T; A549; HepG2; hESCs; fibroblasts; Huh7; HEK293A-TOA; iSLK; TIME; TREX; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000318493.11; ENST00000397752.7
External Link	RMBase: m6A_site_773824
mod ID: M6ASITE082055		Click to Show/Hide the Full List
mod site	chr7:116797911-116797912:+		[13]
Sequence	GTTGCAGGAAAATGATTATAACTAAAAGCTCTCTGATAGTG
Motif Score	2.590089286
Cell/Tissue List	A549
Seq Type List	m6A-CLIP/IP
Transcript ID List	ENST00000397752.7; ENST00000318493.11
External Link	RMBase: m6A_site_773825
mod ID: M6ASITE082056		Click to Show/Hide the Full List
mod site	chr7:116797937-116797938:+		[8]
Sequence	AGCTCTCTGATAGTGCAGAGACTTACCAGAAGACACAAGGA
Motif Score	3.319380952
Cell/Tissue List	HeLa; HEK293T; A549; HepG2; fibroblasts; Huh7; HEK293A-TOA; iSLK; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000318493.11; ENST00000397752.7
External Link	RMBase: m6A_site_773826
mod ID: M6ASITE082057		Click to Show/Hide the Full List
mod site	chr7:116797949-116797950:+		[8]
Sequence	GTGCAGAGACTTACCAGAAGACACAAGGAATTGTACTGAAG
Motif Score	2.897386905
Cell/Tissue List	HeLa; HEK293T; A549; hESC-HEK293T; HepG2; fibroblasts; Huh7; HEK293A-TOA; iSLK; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq; MAZTER-seq
Transcript ID List	ENST00000318493.11; ENST00000397752.7
External Link	RMBase: m6A_site_773827
mod ID: M6ASITE082058		Click to Show/Hide the Full List
mod site	chr7:116797963-116797964:+		[11]
Sequence	CAGAAGACACAAGGAATTGTACTGAAGAGCTATTACAATCC
Motif Score	3.278136905
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000397752.7; ENST00000318493.11
External Link	RMBase: m6A_site_773828
mod ID: M6ASITE082059		Click to Show/Hide the Full List
mod site	chr7:116798017-116798018:+		[11]
Sequence	TCATAAATGTAATAAGTAATACTAATTCACAGAGTATTGTA
Motif Score	2.53247619
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000318493.11; ENST00000397752.7
External Link	RMBase: m6A_site_773829
mod ID: M6ASITE082060		Click to Show/Hide the Full List
mod site	chr7:116798049-116798050:+		[9]
Sequence	AGTATTGTAAATGGTGGATGACAAAAGAAAATCTGCTCTGT
Motif Score	2.859755952
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000318493.11; ENST00000397752.7
External Link	RMBase: m6A_site_773830
mod ID: M6ASITE082061		Click to Show/Hide the Full List
mod site	chr7:116798081-116798082:+		[8]
Sequence	CTGCTCTGTGGAAAGAAAGAACTGTCTCTACCAGGGTCAAG
Motif Score	3.373380952
Cell/Tissue List	HeLa; HEK293T; A549; HepG2; U2OS; H1B; hESCs; fibroblasts; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List	ENST00000397752.7; ENST00000318493.11
External Link	RMBase: m6A_site_773831
mod ID: M6ASITE082062		Click to Show/Hide the Full List
mod site	chr7:116798126-116798127:+		[8]
Sequence	TGAACGCATCAATAGAAAGAACTCGGGGAAACATCCCATCA
Motif Score	3.373380952
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; H1B; hESCs; fibroblasts; H1299; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List	ENST00000318493.11; ENST00000397752.7
External Link	RMBase: m6A_site_773832
mod ID: M6ASITE082063		Click to Show/Hide the Full List
mod site	chr7:116798136-116798137:+		[8]
Sequence	AATAGAAAGAACTCGGGGAAACATCCCATCAACAGGACTAC
Motif Score	2.20572619
Cell/Tissue List	HeLa; HepG2; HEK293T; brain; kidney; A549; hESC-HEK293T; U2OS; H1B; hESCs; fibroblasts; H1299; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq; m6A-REF-seq; MAZTER-seq
Transcript ID List	ENST00000397752.7; ENST00000318493.11
External Link	RMBase: m6A_site_773833
mod ID: M6ASITE082064		Click to Show/Hide the Full List
mod site	chr7:116798147-116798148:+		[10]
Sequence	CTCGGGGAAACATCCCATCAACAGGACTACACACTTGTATA
Motif Score	2.173910714
Cell/Tissue List	brain; hESC-HEK293T
Seq Type List	m6A-REF-seq; MAZTER-seq
Transcript ID List	ENST00000397752.7; ENST00000318493.11
External Link	RMBase: m6A_site_773834
mod ID: M6ASITE082065		Click to Show/Hide the Full List
mod site	chr7:116798152-116798153:+		[8]
Sequence	GGAAACATCCCATCAACAGGACTACACACTTGTATATACAT
Motif Score	4.065041667
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; H1B; hESCs; fibroblasts; H1299; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000318493.11; ENST00000397752.7
External Link	RMBase: m6A_site_773835
mod ID: M6ASITE082066		Click to Show/Hide the Full List
mod site	chr7:116798181-116798182:+		[8]
Sequence	TTGTATATACATTCTTGAGAACACTGCAATGTGAAAATCAC
Motif Score	2.951386905
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; H1B; hESCs; fibroblasts; H1299; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000397752.7; ENST00000318493.11
External Link	RMBase: m6A_site_773836
mod ID: M6ASITE082067		Click to Show/Hide the Full List
mod site	chr7:116798217-116798218:+		[8]
Sequence	ATCACGTTTGCTATTTATAAACTTGTCCTTAGATTAATGTG
Motif Score	2.627720238
Cell/Tissue List	HeLa; HEK293T; A549; HepG2; U2OS; hESCs; fibroblasts; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000397752.7; ENST00000318493.11
External Link	RMBase: m6A_site_773837
mod ID: M6ASITE082068		Click to Show/Hide the Full List
mod site	chr7:116798243-116798244:+		[8]
Sequence	CCTTAGATTAATGTGTCTGGACAGATTGTGGGAGTAAGTGA
Motif Score	3.643047619
Cell/Tissue List	HeLa; HEK293T; A549; hESC-HEK293T; HepG2; fibroblasts; Huh7; HEK293A-TOA; iSLK; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq; DART-seq; MAZTER-seq
Transcript ID List	ENST00000318493.11; ENST00000397752.7
External Link	RMBase: m6A_site_773838
mod ID: M6ASITE082069		Click to Show/Hide the Full List
mod site	chr7:116798310-116798311:+		[8]
Sequence	CTGCCTATACCTGCAGCTGAACTGAATGGTACTTCGTATGT
Motif Score	3.373380952
Cell/Tissue List	HeLa; HEK293T; A549; HepG2; Huh7; iSLK; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000318493.11; ENST00000397752.7
External Link	RMBase: m6A_site_773839
mod ID: M6ASITE082070		Click to Show/Hide the Full List
mod site	chr7:116798320-116798321:+		[11]
Sequence	CTGCAGCTGAACTGAATGGTACTTCGTATGTTAATAGTTGT
Motif Score	3.278136905
Cell/Tissue List	HEK293T
Seq Type List	DART-seq
Transcript ID List	ENST00000318493.11; ENST00000397752.7
External Link	RMBase: m6A_site_773840

2'-O-Methylation (2'-O-Me)

In total 1 m6A sequence/site(s) in this target gene
mod ID: 2OMSITE000464		Click to Show/Hide the Full List
mod site	chr7:116782094-116782095:+		[14]
Sequence	GACTTGGCTGCAAGAAACTGTATGTAAGTATCAGAATCTCT
Cell/Tissue List	HeLa
Seq Type List	Nm-seq
Transcript ID List	ENST00000397752.7; ENST00000318493.11
External Link	RMBase: Nm_site_6221

Ref 1	Chidamide increases the sensitivity of Non-small Cell Lung Cancer to Crizotinib by decreasing c-MET mRNA methylation. Int J Biol Sci. 2020 Jul 19;16(14):2595-2611. doi: 10.7150/ijbs.45886. eCollection 2020.
Ref 2	RNA methyltransferase METTL3 induces intrinsic resistance to gefitinib by combining with MET to regulate PI3K/AKT pathway in lung adenocarcinoma. J Cell Mol Med. 2021 Mar;25(5):2418-2425. doi: 10.1111/jcmm.16114. Epub 2021 Jan 24.
Ref 3	RNA m(6) A methylation regulates uveal melanoma cell proliferation, migration, and invasion by targeting c-Met. J Cell Physiol. 2020 Oct;235(10):7107-7119. doi: 10.1002/jcp.29608. Epub 2020 Feb 4.
Ref 4	URL: http://www.guidetopharmacology.org Nucleic Acids Res. 2015 Oct 12. pii: gkv1037. The IUPHAR/BPS Guide to PHARMACOLOGY in 2016: towards curated quantitative interactions between 1300 protein targets and 6000 ligands. (Target id: 1499).
Ref 5	RADAR: a rigorously annotated database of A-to-I RNA editing. Nucleic Acids Res. 2014 Jan;42(Database issue):D109-13. doi: 10.1093/nar/gkt996. Epub 2013 Oct 25.
Ref 6	5-methylcytosine promotes mRNA export - NSUN2 as the methyltransferase and ALYREF as an m(5)C reader. Cell Res. 2017 May;27(5):606-625. doi: 10.1038/cr.2017.55. Epub 2017 Apr 18.
Ref 7	Topology of the human and mouse m6A RNA methylomes revealed by m6A-seq. Nature. 2012 Apr 29;485(7397):201-6. doi: 10.1038/nature11112.
Ref 8	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 9	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.
Ref 10	Single-base mapping of m(6)A by an antibody-independent method. Sci Adv. 2019 Jul 3;5(7):eaax0250. doi: 10.1126/sciadv.aax0250. eCollection 2019 Jul.
Ref 11	DART-seq: an antibody-free method for global m(6)A detection. Nat Methods. 2019 Dec;16(12):1275-1280. doi: 10.1038/s41592-019-0570-0. Epub 2019 Sep 23.
Ref 12	Viral N(6)-methyladenosine upregulates replication and pathogenesis of human respiratory syncytial virus. Nat Commun. 2019 Oct 9;10(1):4595. doi: 10.1038/s41467-019-12504-y.
Ref 13	A majority of m6A residues are in the last exons, allowing the potential for 3' UTR regulation. Genes Dev. 2015 Oct 1;29(19):2037-53. doi: 10.1101/gad.269415.115. Epub 2015 Sep 24.
Ref 14	Nm-seq maps 2'-O-methylation sites in human mRNA with base precision. Nat Methods. 2017 Jul;14(7):695-698. doi: 10.1038/nmeth.4294. Epub 2017 May 15.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map