m6A Target Gene Information
General Information of the m6A Target Gene (ID: M6ATAR00319)
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
LAMTOR5
can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Methyltransferase-like 3 (METTL3) [WRITER]
| Representative RNA-seq result indicating the expression of this target gene regulated by METTL3 | ||
| Cell Line | Th1 cell line | Mus musculus |
|
Treatment: METTL3 knockout splenic Th1 cells
Control: Wild type splenic Th1 cells
|
GSE129648 | |
| Regulation |
![]() ![]() |
logFC: -6.20E-01 p-value: 1.93E-04 |
| More Results | Click to View More RNA-seq Results | |
| In total 1 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [1] | |||
| Response Summary | Ragulator complex protein LAMTOR5 (LAMTOR5/HBXIP) up-regulates METTL3 by suppressing let-7g, in which METTL3 increased HBXIP expression forming a positive feedback loop of HBXIP/let-7g/METTL3/HBXIP, leading to accelerated cell proliferation in breast cancer. | |||
| Target Regulation | Up regulation | |||
| Responsed Disease | Breast cancer | ICD-11: 2C60 | ||
| Cell Process | Cell differentiation and apoptosis | |||
| Glutamine metabolism | ||||
| Apoptosis (hsa04210) | ||||
Breast cancer [ICD-11: 2C60]
| In total 1 item(s) under this disease | ||||
| Experiment 1 Reporting the m6A-centered Disease Response | [1] | |||
| Response Summary | Ragulator complex protein LAMTOR5 (LAMTOR5/HBXIP) up-regulates METTL3 by suppressing let-7g, in which METTL3 increased HBXIP expression forming a positive feedback loop of HBXIP/let-7g/METTL3/HBXIP, leading to accelerated cell proliferation in breast cancer. | |||
| Responsed Disease | Breast cancer [ICD-11: 2C60] | |||
| Target Regulator | Methyltransferase-like 3 (METTL3) | WRITER | ||
| Target Regulation | Up regulation | |||
| Cell Process | Cell differentiation and apoptosis | |||
| Glutamine metabolism | ||||
| Apoptosis (hsa04210) | ||||
Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator
Non-coding RNA
m6A Regulator: Methyltransferase-like 3 (METTL3)
| In total 2 item(s) under this m6A regulator | ||
| Crosstalk ID: M6ACROT05036 | ||
| Epigenetic Regulator | MicroRNA let-7g (MIRLET7G) | |
| Regulated Target | Methyltransferase-like protein 3 (METTL3) | |
| Crosstalk relationship | ncRNA → m6A | |
| Disease | Breast cancer | |
| Crosstalk ID: M6ACROT05375 | ||
| Epigenetic Regulator | MicroRNA let-7g (MIRLET7G) | |
| Regulated Target | Methyltransferase-like protein 3 (METTL3) | |
| Crosstalk relationship | m6A → ncRNA | |
| Disease | Breast cancer | |
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00319)
| In total 1 m6A sequence/site(s) in this target gene | |||
| mod ID: A2ISITE009677 | Click to Show/Hide the Full List | ||
| mod site | chr1:110405311-110405312:- | [2] | |
| Sequence | AAAAATTAGCCAGGCATGGTAGCAGGTGCTAGTAATCCCAG | ||
| Transcript ID List | ENST00000531779.1; ENST00000614544.1; rmsk_227760; ENST00000602318.5; ENST00000474861.6; ENST00000483260.5; ENST00000256644.8; ENST00000464240.1; ENST00000602858.5 | ||
| External Link | RMBase: RNA-editing_site_7678 | ||
5-methylcytidine (m5C)
N6-methyladenosine (m6A)
| In total 15 m6A sequence/site(s) in this target gene | |||
| mod ID: M6ASITE041752 | Click to Show/Hide the Full List | ||
| mod site | chr1:110401301-110401302:- | [3] | |
| Sequence | TGAAGCAGCAGGTCCAGGTCACTTTGTATATAGAATTTTGC | ||
| Motif Score | 2.469291667 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000602858.5; ENST00000474861.6; ENST00000602318.5; ENST00000483260.5; ENST00000614544.1; ENST00000256644.8; ENST00000464240.1 | ||
| External Link | RMBase: m6A_site_44644 | ||
| mod ID: M6ASITE041753 | Click to Show/Hide the Full List | ||
| mod site | chr1:110401359-110401360:- | [4] | |
| Sequence | TGCTTTCTAATGCTCTATGGACCGACTATCAAGATATTAGT | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000602318.5; ENST00000602858.5; ENST00000614544.1; ENST00000483260.5; ENST00000474861.6; ENST00000464240.1; ENST00000256644.8 | ||
| External Link | RMBase: m6A_site_44645 | ||
| mod ID: M6ASITE041754 | Click to Show/Hide the Full List | ||
| mod site | chr1:110401450-110401451:- | [3] | |
| Sequence | GTTAATTACCTTATAGAACTACTAAAGTTCCAGTAGTTAGG | ||
| Motif Score | 2.500660714 | ||
| Cell/Tissue List | HEK293T | ||
| Seq Type List | DART-seq | ||
| Transcript ID List | ENST00000483260.5; ENST00000474861.6; ENST00000602318.5; ENST00000464240.1; ENST00000256644.8; ENST00000614544.1; ENST00000602858.5 | ||
| External Link | RMBase: m6A_site_44646 | ||
| mod ID: M6ASITE041755 | Click to Show/Hide the Full List | ||
| mod site | chr1:110401453-110401454:- | [4] | |
| Sequence | TATGTTAATTACCTTATAGAACTACTAAAGTTCCAGTAGTT | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000602858.5; ENST00000602318.5; ENST00000256644.8; ENST00000614544.1; ENST00000474861.6; ENST00000464240.1; ENST00000483260.5 | ||
| External Link | RMBase: m6A_site_44647 | ||
| mod ID: M6ASITE041756 | Click to Show/Hide the Full List | ||
| mod site | chr1:110401538-110401539:- | [5] | |
| Sequence | TGGCATCACGGTGGCAGTGCACAAAATGGCCTCTTGATGCT | ||
| Motif Score | 2.830589286 | ||
| Cell/Tissue List | HEK293; HEK293T; hESC-HEK293T | ||
| Seq Type List | m6A-REF-seq; DART-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000256644.8; ENST00000602858.5; ENST00000614544.1; ENST00000464240.1; ENST00000474861.6; ENST00000483260.5; ENST00000602318.5 | ||
| External Link | RMBase: m6A_site_44648 | ||
| mod ID: M6ASITE041757 | Click to Show/Hide the Full List | ||
| mod site | chr1:110404027-110404028:- | [4] | |
| Sequence | TCTATTTTCCAGGCCGCGGGACCCTGTCAGATGAGCATGCT | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa; HepG2; A549; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; TIME; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000614544.1; ENST00000602318.5; ENST00000464240.1; ENST00000602858.5; ENST00000531779.1; ENST00000483260.5; ENST00000256644.8; ENST00000474861.6 | ||
| External Link | RMBase: m6A_site_44649 | ||
| mod ID: M6ASITE041758 | Click to Show/Hide the Full List | ||
| mod site | chr1:110406330-110406331:- | [4] | |
| Sequence | CTGTGCACAGATTCACAAGGACTTAATCTGGGTTGTAAGTA | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa; HepG2; A549; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; TIME; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000256644.8; ENST00000614544.1; ENST00000602858.5; ENST00000474861.6; ENST00000602318.5; ENST00000531779.1; ENST00000483260.5; ENST00000464240.1 | ||
| External Link | RMBase: m6A_site_44650 | ||
| mod ID: M6ASITE041759 | Click to Show/Hide the Full List | ||
| mod site | chr1:110406336-110406337:- | [5] | |
| Sequence | GGAGTCCTGTGCACAGATTCACAAGGACTTAATCTGGGTTG | ||
| Motif Score | 2.047297619 | ||
| Cell/Tissue List | liver; hESC-HEK293T | ||
| Seq Type List | m6A-REF-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000464240.1; ENST00000474861.6; ENST00000531779.1; ENST00000614544.1; ENST00000483260.5; ENST00000602858.5; ENST00000256644.8; ENST00000602318.5 | ||
| External Link | RMBase: m6A_site_44651 | ||
| mod ID: M6ASITE041760 | Click to Show/Hide the Full List | ||
| mod site | chr1:110406344-110406345:- | [5] | |
| Sequence | CCATTGTTGGAGTCCTGTGCACAGATTCACAAGGACTTAAT | ||
| Motif Score | 2.830589286 | ||
| Cell/Tissue List | kidney | ||
| Seq Type List | m6A-REF-seq | ||
| Transcript ID List | ENST00000602318.5; ENST00000602858.5; ENST00000483260.5; ENST00000614544.1; ENST00000256644.8; ENST00000531779.1; ENST00000464240.1; ENST00000474861.6 | ||
| External Link | RMBase: m6A_site_44652 | ||
| mod ID: M6ASITE041761 | Click to Show/Hide the Full List | ||
| mod site | chr1:110406455-110406456:- | [4] | |
| Sequence | CTTAATGCCTGGTACATAGAACACCTGTATGTTTGTACTTA | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa; HepG2; A549; H1B; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; iSLK; MSC; TIME; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000464240.1; ENST00000531779.1; ENST00000474861.6; ENST00000614544.1; ENST00000256644.8; ENST00000483260.5; ENST00000602318.5 | ||
| External Link | RMBase: m6A_site_44653 | ||
| mod ID: M6ASITE041762 | Click to Show/Hide the Full List | ||
| mod site | chr1:110406536-110406537:- | [4] | |
| Sequence | CAACCGCGCCCGGCCCTAGAACTTAATTTTTTTCTTAGGGT | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000474861.6; ENST00000483260.5; ENST00000614544.1; ENST00000256644.8; ENST00000602318.5; ENST00000464240.1; ENST00000531779.1 | ||
| External Link | RMBase: m6A_site_44654 | ||
| mod ID: M6ASITE041763 | Click to Show/Hide the Full List | ||
| mod site | chr1:110407443-110407444:- | [6] | |
| Sequence | ACACGGGATGAGGGGGCTAAACTCTACCCAAGGCCGCAGGG | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000256644.8; ENST00000464240.1; ENST00000483260.5; ENST00000474861.6; ENST00000614544.1; ENST00000602318.5; ENST00000531779.1 | ||
| External Link | RMBase: m6A_site_44655 | ||
| mod ID: M6ASITE041764 | Click to Show/Hide the Full List | ||
| mod site | chr1:110407463-110407464:- | [6] | |
| Sequence | GACGTCGCGCGACCCCCGGGACACGGGATGAGGGGGCTAAA | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000474861.6; ENST00000483260.5; ENST00000256644.8; ENST00000464240.1; ENST00000602318.5; ENST00000531779.1; ENST00000614544.1 | ||
| External Link | RMBase: m6A_site_44656 | ||
| mod ID: M6ASITE041765 | Click to Show/Hide the Full List | ||
| mod site | chr1:110407536-110407537:- | [4] | |
| Sequence | CCTGAGGTCGCGGCGGAGGAACTTGAGCGGAACGAAAGGCG | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa; HepG2; H1A; H1B; GM12878; MT4; MM6; Jurkat; GSC-11; TIME; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000602318.5; ENST00000614544.1; ENST00000483260.5; ENST00000464240.1; ENST00000256644.8; ENST00000531779.1; ENST00000474861.6 | ||
| External Link | RMBase: m6A_site_44657 | ||
| mod ID: M6ASITE041766 | Click to Show/Hide the Full List | ||
| mod site | chr1:110407588-110407589:- | [4] | |
| Sequence | CTTGGAGCAGCACTTGGAAGACACGTGAGTAGTGCGCGCCT | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa; HepG2; hESC-HEK293T; H1B; H1A; fibroblasts; A549; GM12878; MT4; MM6; Jurkat; GSC-11; HEK293A-TOA; MSC; TIME; TREX; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000483260.5; ENST00000602318.5; ENST00000531779.1; ENST00000256644.8; ENST00000474861.6; ENST00000614544.1; ENST00000464240.1 | ||
| External Link | RMBase: m6A_site_44659 | ||
References

