General Information of the m6A Target Gene (ID: M6ATAR00319)
Target Name Ragulator complex protein LAMTOR5 (LAMTOR5/HBXIP)
Synonyms
Hepatitis B virus X-interacting protein; HBV X-interacting protein; HBX-interacting protein; Late endosomal/lysosomal adaptor and MAPK and MTOR activator 5; HBXIP; XIP
    Click to Show/Hide
Gene Name LAMTOR5
Chromosomal Location 1p13.3
Family LAMTOR5 family
Function
As part of the Ragulator complex it is involved in amino acid sensing and activation of mTORC1, a signaling complex promoting cell growth in response to growth factors, energy levels, and amino acids. Activated by amino acids through a mechanism involving the lysosomal V-ATPase, the Ragulator functions as a guanine nucleotide exchange factor activating the small GTPases Rag. Activated Ragulator and Rag GTPases function as a scaffold recruiting mTORC1 to lysosomes where it is in turn activated. When complexed to BIRC5, interferes with apoptosome assembly, preventing recruitment of pro-caspase-9 to oligomerized APAF1, thereby selectively suppressing apoptosis initiated via the mitochondrial/cytochrome c pathway. Down-regulates hepatitis B virus (HBV) replication.
    Click to Show/Hide
Gene ID 10542
Uniprot ID
LTOR5_HUMAN
HGNC ID
HGNC:17955
KEGG ID
hsa:10542
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
LAMTOR5 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Methyltransferase-like 3 (METTL3) [WRITER]
Representative RNA-seq result indicating the expression of this target gene regulated by METTL3
Cell Line Th1 cell line Mus musculus
Treatment: METTL3 knockout splenic Th1 cells
Control: Wild type splenic Th1 cells
GSE129648
Regulation
logFC: -6.20E-01
p-value: 1.93E-04
More Results Click to View More RNA-seq Results
In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary Ragulator complex protein LAMTOR5 (LAMTOR5/HBXIP) up-regulates METTL3 by suppressing let-7g, in which METTL3 increased HBXIP expression forming a positive feedback loop of HBXIP/let-7g/METTL3/HBXIP, leading to accelerated cell proliferation in breast cancer.
Target Regulation Up regulation
Responsed Disease Breast cancer ICD-11: 2C60
Cell Process Cell differentiation and apoptosis
Glutamine metabolism
Apoptosis (hsa04210)
Breast cancer [ICD-11: 2C60]
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [1]
Response Summary Ragulator complex protein LAMTOR5 (LAMTOR5/HBXIP) up-regulates METTL3 by suppressing let-7g, in which METTL3 increased HBXIP expression forming a positive feedback loop of HBXIP/let-7g/METTL3/HBXIP, leading to accelerated cell proliferation in breast cancer.
Responsed Disease Breast cancer [ICD-11: 2C60]
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
Target Regulation Up regulation
Cell Process Cell differentiation and apoptosis
Glutamine metabolism
Apoptosis (hsa04210)
Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator
Non-coding RNA
m6A Regulator: Methyltransferase-like 3 (METTL3)
In total 2 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05036
Epigenetic Regulator MicroRNA let-7g (MIRLET7G)
Regulated Target Methyltransferase-like protein 3 (METTL3)
Crosstalk relationship ncRNA → m6A
Disease Breast cancer
Crosstalk ID: M6ACROT05375
Epigenetic Regulator MicroRNA let-7g (MIRLET7G)
Regulated Target Methyltransferase-like protein 3 (METTL3)
Crosstalk relationship m6A → ncRNA
Disease Breast cancer
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00319)
Ragulator complex protein LAMTOR5 (LAMTOR5/HBXIP)
Adenosine-to-Inosine editing (A-to-I)
In total 1 m6A sequence/site(s) in this target gene
mod ID: A2ISITE009677 Click to Show/Hide the Full List
mod site chr1:110405311-110405312:- [2]
Sequence AAAAATTAGCCAGGCATGGTAGCAGGTGCTAGTAATCCCAG
Transcript ID List ENST00000531779.1; ENST00000614544.1; rmsk_227760; ENST00000602318.5; ENST00000474861.6; ENST00000483260.5; ENST00000256644.8; ENST00000464240.1; ENST00000602858.5
External Link RMBase: RNA-editing_site_7678
5-methylcytidine (m5C)
In total 1 m6A sequence/site(s) in this target gene
mod ID: M5CSITE002939 Click to Show/Hide the Full List
mod site chr1:110407524-110407525:-
Sequence GCGGAGGAACTTGAGCGGAACGAAAGGCGCGAGCTGCGAGT
Cell/Tissue List T24
Seq Type List Bisulfite-seq
Transcript ID List ENST00000474861.6; ENST00000483260.5; ENST00000602318.5; ENST00000256644.8; ENST00000531779.1; ENST00000464240.1; ENST00000614544.1
External Link RMBase: m5C_site_3107
N6-methyladenosine (m6A)
In total 15 m6A sequence/site(s) in this target gene
mod ID: M6ASITE041752 Click to Show/Hide the Full List
mod site chr1:110401301-110401302:- [3]
Sequence TGAAGCAGCAGGTCCAGGTCACTTTGTATATAGAATTTTGC
Motif Score 2.469291667
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000602858.5; ENST00000474861.6; ENST00000602318.5; ENST00000483260.5; ENST00000614544.1; ENST00000256644.8; ENST00000464240.1
External Link RMBase: m6A_site_44644
mod ID: M6ASITE041753 Click to Show/Hide the Full List
mod site chr1:110401359-110401360:- [4]
Sequence TGCTTTCTAATGCTCTATGGACCGACTATCAAGATATTAGT
Motif Score 3.622404762
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000602318.5; ENST00000602858.5; ENST00000614544.1; ENST00000483260.5; ENST00000474861.6; ENST00000464240.1; ENST00000256644.8
External Link RMBase: m6A_site_44645
mod ID: M6ASITE041754 Click to Show/Hide the Full List
mod site chr1:110401450-110401451:- [3]
Sequence GTTAATTACCTTATAGAACTACTAAAGTTCCAGTAGTTAGG
Motif Score 2.500660714
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000483260.5; ENST00000474861.6; ENST00000602318.5; ENST00000464240.1; ENST00000256644.8; ENST00000614544.1; ENST00000602858.5
External Link RMBase: m6A_site_44646
mod ID: M6ASITE041755 Click to Show/Hide the Full List
mod site chr1:110401453-110401454:- [4]
Sequence TATGTTAATTACCTTATAGAACTACTAAAGTTCCAGTAGTT
Motif Score 3.373380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000602858.5; ENST00000602318.5; ENST00000256644.8; ENST00000614544.1; ENST00000474861.6; ENST00000464240.1; ENST00000483260.5
External Link RMBase: m6A_site_44647
mod ID: M6ASITE041756 Click to Show/Hide the Full List
mod site chr1:110401538-110401539:- [5]
Sequence TGGCATCACGGTGGCAGTGCACAAAATGGCCTCTTGATGCT
Motif Score 2.830589286
Cell/Tissue List HEK293; HEK293T; hESC-HEK293T
Seq Type List m6A-REF-seq; DART-seq; MAZTER-seq
Transcript ID List ENST00000256644.8; ENST00000602858.5; ENST00000614544.1; ENST00000464240.1; ENST00000474861.6; ENST00000483260.5; ENST00000602318.5
External Link RMBase: m6A_site_44648
mod ID: M6ASITE041757 Click to Show/Hide the Full List
mod site chr1:110404027-110404028:- [4]
Sequence TCTATTTTCCAGGCCGCGGGACCCTGTCAGATGAGCATGCT
Motif Score 3.622404762
Cell/Tissue List HeLa; HepG2; A549; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; TIME; endometrial; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000614544.1; ENST00000602318.5; ENST00000464240.1; ENST00000602858.5; ENST00000531779.1; ENST00000483260.5; ENST00000256644.8; ENST00000474861.6
External Link RMBase: m6A_site_44649
mod ID: M6ASITE041758 Click to Show/Hide the Full List
mod site chr1:110406330-110406331:- [4]
Sequence CTGTGCACAGATTCACAAGGACTTAATCTGGGTTGTAAGTA
Motif Score 4.065041667
Cell/Tissue List HeLa; HepG2; A549; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; TIME; endometrial; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000256644.8; ENST00000614544.1; ENST00000602858.5; ENST00000474861.6; ENST00000602318.5; ENST00000531779.1; ENST00000483260.5; ENST00000464240.1
External Link RMBase: m6A_site_44650
mod ID: M6ASITE041759 Click to Show/Hide the Full List
mod site chr1:110406336-110406337:- [5]
Sequence GGAGTCCTGTGCACAGATTCACAAGGACTTAATCTGGGTTG
Motif Score 2.047297619
Cell/Tissue List liver; hESC-HEK293T
Seq Type List m6A-REF-seq; MAZTER-seq
Transcript ID List ENST00000464240.1; ENST00000474861.6; ENST00000531779.1; ENST00000614544.1; ENST00000483260.5; ENST00000602858.5; ENST00000256644.8; ENST00000602318.5
External Link RMBase: m6A_site_44651
mod ID: M6ASITE041760 Click to Show/Hide the Full List
mod site chr1:110406344-110406345:- [5]
Sequence CCATTGTTGGAGTCCTGTGCACAGATTCACAAGGACTTAAT
Motif Score 2.830589286
Cell/Tissue List kidney
Seq Type List m6A-REF-seq
Transcript ID List ENST00000602318.5; ENST00000602858.5; ENST00000483260.5; ENST00000614544.1; ENST00000256644.8; ENST00000531779.1; ENST00000464240.1; ENST00000474861.6
External Link RMBase: m6A_site_44652
mod ID: M6ASITE041761 Click to Show/Hide the Full List
mod site chr1:110406455-110406456:- [4]
Sequence CTTAATGCCTGGTACATAGAACACCTGTATGTTTGTACTTA
Motif Score 2.951386905
Cell/Tissue List HeLa; HepG2; A549; H1B; MM6; Jurkat; CD4T; peripheral-blood; GSC-11; iSLK; MSC; TIME; endometrial; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000464240.1; ENST00000531779.1; ENST00000474861.6; ENST00000614544.1; ENST00000256644.8; ENST00000483260.5; ENST00000602318.5
External Link RMBase: m6A_site_44653
mod ID: M6ASITE041762 Click to Show/Hide the Full List
mod site chr1:110406536-110406537:- [4]
Sequence CAACCGCGCCCGGCCCTAGAACTTAATTTTTTTCTTAGGGT
Motif Score 3.373380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000474861.6; ENST00000483260.5; ENST00000614544.1; ENST00000256644.8; ENST00000602318.5; ENST00000464240.1; ENST00000531779.1
External Link RMBase: m6A_site_44654
mod ID: M6ASITE041763 Click to Show/Hide the Full List
mod site chr1:110407443-110407444:- [6]
Sequence ACACGGGATGAGGGGGCTAAACTCTACCCAAGGCCGCAGGG
Motif Score 2.627720238
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000256644.8; ENST00000464240.1; ENST00000483260.5; ENST00000474861.6; ENST00000614544.1; ENST00000602318.5; ENST00000531779.1
External Link RMBase: m6A_site_44655
mod ID: M6ASITE041764 Click to Show/Hide the Full List
mod site chr1:110407463-110407464:- [6]
Sequence GACGTCGCGCGACCCCCGGGACACGGGATGAGGGGGCTAAA
Motif Score 3.643047619
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000474861.6; ENST00000483260.5; ENST00000256644.8; ENST00000464240.1; ENST00000602318.5; ENST00000531779.1; ENST00000614544.1
External Link RMBase: m6A_site_44656
mod ID: M6ASITE041765 Click to Show/Hide the Full List
mod site chr1:110407536-110407537:- [4]
Sequence CCTGAGGTCGCGGCGGAGGAACTTGAGCGGAACGAAAGGCG
Motif Score 3.373380952
Cell/Tissue List HeLa; HepG2; H1A; H1B; GM12878; MT4; MM6; Jurkat; GSC-11; TIME; endometrial; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000602318.5; ENST00000614544.1; ENST00000483260.5; ENST00000464240.1; ENST00000256644.8; ENST00000531779.1; ENST00000474861.6
External Link RMBase: m6A_site_44657
mod ID: M6ASITE041766 Click to Show/Hide the Full List
mod site chr1:110407588-110407589:- [4]
Sequence CTTGGAGCAGCACTTGGAAGACACGTGAGTAGTGCGCGCCT
Motif Score 2.897386905
Cell/Tissue List HeLa; HepG2; hESC-HEK293T; H1B; H1A; fibroblasts; A549; GM12878; MT4; MM6; Jurkat; GSC-11; HEK293A-TOA; MSC; TIME; TREX; endometrial; HEC-1-A
Seq Type List m6A-seq; MeRIP-seq; MAZTER-seq
Transcript ID List ENST00000483260.5; ENST00000602318.5; ENST00000531779.1; ENST00000256644.8; ENST00000474861.6; ENST00000614544.1; ENST00000464240.1
External Link RMBase: m6A_site_44659