General Information of the m6A Target Gene (ID: M6ATAR00313)
Target Name Ribosomal protein S6 kinase beta-1 (RPS6KB1/p70S6K)
Synonyms
S6K-beta-1; S6K1; 70 kDa ribosomal protein S6 kinase 1; P70S6K1; p70-S6K 1; Ribosomal protein S6 kinase I; Serine/threonine-protein kinase 14A; p70 ribosomal S6 kinase alpha; p70 S6 kinase alpha; p70 S6K-alpha; p70 S6KA; STK14A
    Click to Show/Hide
Gene Name RPS6KB1
Chromosomal Location 17q23.1
Family protein kinase superfamily; AGC Ser/Thr protein kinase family; S6 kinase subfamily
Function
Serine/threonine-protein kinase that acts downstream of mTOR signaling in response to growth factors and nutrients to promote cell proliferation, cell growth and cell cycle progression. Regulates protein synthesis through phosphorylation of EIF4B, RPS6 and EEF2K, and contributes to cell survival by repressing the pro-apoptotic function of BAD. Under conditions of nutrient depletion, the inactive form associates with the EIF3 translation initiation complex. Upon mitogenic stimulation, phosphorylation by the mammalian target of rapamycin complex 1 (mTORC1) leads to dissociation from the EIF3 complex and activation. The active form then phosphorylates and activates several substrates in the pre-initiation complex, including the EIF2B complex and the cap-binding complex component EIF4B. Also controls translation initiation by phosphorylating a negative regulator of EIF4A, PDCD4, targeting it for ubiquitination and subsequent proteolysis. Promotes initiation of the pioneer round of protein synthesis by phosphorylating POLDIP3/SKAR. In response to IGF1, activates translation elongation by phosphorylating EEF2 kinase (EEF2K), which leads to its inhibition and thus activation of EEF2. Also plays a role in feedback regulation of mTORC2 by mTORC1 by phosphorylating RICTOR, resulting in the inhibition of mTORC2 and AKT1 signaling. Mediates cell survival by phosphorylating the pro-apoptotic protein BAD and suppressing its pro-apoptotic function. Phosphorylates mitochondrial URI1 leading to dissociation of a URI1-PPP1CC complex. The free mitochondrial PPP1CC can then dephosphorylate RPS6KB1 at Thr-412, which is proposed to be a negative feedback mechanism for the RPS6KB1 anti-apoptotic function. Mediates TNF-alpha-induced insulin resistance by phosphorylating IRS1 at multiple serine residues, resulting in accelerated degradation of IRS1. In cells lacking functional TSC1-2 complex, constitutively phosphorylates and inhibits GSK3B. May be involved in cytoskeletal rearrangement through binding to neurabin. Phosphorylates and activates the pyrimidine biosynthesis enzyme CAD, downstream of MTOR. Following activation by mTORC1, phosphorylates EPRS and thereby plays a key role in fatty acid uptake by adipocytes and also most probably in interferon-gamma-induced translation inhibition.
    Click to Show/Hide
Gene ID 6198
Uniprot ID
KS6B1_HUMAN
HGNC ID
HGNC:10436
KEGG ID
hsa:6198
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
RPS6KB1 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
Browse Drug
Methyltransferase-like 3 (METTL3) [WRITER]
Representative RNA-seq result indicating the expression of this target gene regulated by METTL3
Cell Line CT26 cell line Mus musculus
Treatment: METTL3 knockout CT26 cells
Control: CT26 cells
GSE142589
Regulation
logFC: -6.86E-01
p-value: 2.67E-02
More Results Click to View More RNA-seq Results
Representative RIP-seq result supporting the interaction between RPS6KB1 and the regulator
Cell Line MDA-MB-231 Homo sapiens
Regulation logFC: 1.70E+00 GSE60213
In total 2 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene [1]
Response Summary Down-regulation of METTL3 inhibits the proliferation and mobility of human gastric cancer cells and leads to inactivation of the AKT signaling pathway, suggesting that METTL3 is a potential target for the treatment of human gastric cancer. METTL3 knockdown decreased Bcl2 and increased Bax and active Caspase-3 in gastric cancer cells, which suggested the apoptotic pathway was activated. METTL3 led to inactivation of the AKT signaling pathway in human gastric cancer cells, including decreased phosphorylation levels of AKT and expression of down-stream effectors Ribosomal protein S6 kinase beta-1 (RPS6KB1/p70S6K) and Cyclin D1.
Target Regulation Up regulation
Responsed Disease Gastric cancer ICD-11: 2B72
Pathway Response PI3K-Akt signaling pathway hsa04151
Cell Process Cell proliferation
Cell migration
Cell invasion
In-vitro Model AGS Gastric adenocarcinoma Homo sapiens CVCL_0139
MKN45 Gastric adenocarcinoma Homo sapiens CVCL_0434
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene [2]
Response Summary METTL3 promotes the progression of retinoblastoma through PI3K/AKT/mTOR pathways in vitro and in vivo. METTL3 has an impact on the PI3K-AKT-mTOR-Ribosomal protein S6 kinase beta-1 (RPS6KB1/p70S6K)/4EBP1 pathway. The cell proliferation results show that the stimulatory function of METTL3 is lost after rapamycin treatment.
Target Regulation Up regulation
Responsed Disease Retinoblastoma ICD-11: 2D02.2
Responsed Drug Rapamycin Approved
Pathway Response PI3K-Akt signaling pathway hsa04151
mTOR signaling pathway hsa04150
Cell Process Cell proliferation
Cell migration
Cell invasion
Cell apoptosis
In-vitro Model WERI-Rb-1 Retinoblastoma Homo sapiens CVCL_1792
Y-79 Retinoblastoma Homo sapiens CVCL_1893
In-vivo Model To establish a subcutaneous tumour model in nude mice, 2 × 107 Y79 cells (METTL3 knockdown group: shNC, shRNA1 and shRNA2; METTL3 up-regulated group: NC and METLL3) were resuspended in 1 mL of pre-cooled PBS, and 200 uL of the cell suspension was injected subcutaneously into the left side of the armpit to investigate tumour growth (4 × 106 per mouse).
Gastric cancer [ICD-11: 2B72]
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [1]
Response Summary Down-regulation of METTL3 inhibits the proliferation and mobility of human gastric cancer cells and leads to inactivation of the AKT signaling pathway, suggesting that METTL3 is a potential target for the treatment of human gastric cancer. METTL3 knockdown decreased Bcl2 and increased Bax and active Caspase-3 in gastric cancer cells, which suggested the apoptotic pathway was activated. METTL3 led to inactivation of the AKT signaling pathway in human gastric cancer cells, including decreased phosphorylation levels of AKT and expression of down-stream effectors Ribosomal protein S6 kinase beta-1 (RPS6KB1/p70S6K) and Cyclin D1.
Responsed Disease Gastric cancer [ICD-11: 2B72]
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
Target Regulation Up regulation
Pathway Response PI3K-Akt signaling pathway hsa04151
Cell Process Cell proliferation
Cell migration
Cell invasion
In-vitro Model AGS Gastric adenocarcinoma Homo sapiens CVCL_0139
MKN45 Gastric adenocarcinoma Homo sapiens CVCL_0434
Retina cancer [ICD-11: 2D02]
In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response [2]
Response Summary METTL3 promotes the progression of retinoblastoma through PI3K/AKT/mTOR pathways in vitro and in vivo. METTL3 has an impact on the PI3K-AKT-mTOR-Ribosomal protein S6 kinase beta-1 (RPS6KB1/p70S6K)/4EBP1 pathway. The cell proliferation results show that the stimulatory function of METTL3 is lost after rapamycin treatment.
Responsed Disease Retinoblastoma [ICD-11: 2D02.2]
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
Target Regulation Up regulation
Responsed Drug Rapamycin Approved
Pathway Response PI3K-Akt signaling pathway hsa04151
mTOR signaling pathway hsa04150
Cell Process Cell proliferation
Cell migration
Cell invasion
Cell apoptosis
In-vitro Model WERI-Rb-1 Retinoblastoma Homo sapiens CVCL_1792
Y-79 Retinoblastoma Homo sapiens CVCL_1893
In-vivo Model To establish a subcutaneous tumour model in nude mice, 2 × 107 Y79 cells (METTL3 knockdown group: shNC, shRNA1 and shRNA2; METTL3 up-regulated group: NC and METLL3) were resuspended in 1 mL of pre-cooled PBS, and 200 uL of the cell suspension was injected subcutaneously into the left side of the armpit to investigate tumour growth (4 × 106 per mouse).
Rapamycin [Approved]
In total 1 item(s) under this drug
Experiment 1 Reporting the m6A-centered Drug Response [2]
Response Summary METTL3 promotes the progression of retinoblastoma through PI3K/AKT/mTOR pathways in vitro and in vivo. METTL3 has an impact on the PI3K-AKT-mTOR-Ribosomal protein S6 kinase beta-1 (RPS6KB1/p70S6K)/4EBP1 pathway. The cell proliferation results show that the stimulatory function of METTL3 is lost after rapamycin treatment.
Target Regulator Methyltransferase-like 3 (METTL3) WRITER
Target Regulation Up regulation
Responsed Disease Retinoblastoma ICD-11: 2D02.2
Pathway Response PI3K-Akt signaling pathway hsa04151
mTOR signaling pathway hsa04150
Cell Process Cell proliferation
Cell migration
Cell invasion
Cell apoptosis
In-vitro Model WERI-Rb-1 Retinoblastoma Homo sapiens CVCL_1792
Y-79 Retinoblastoma Homo sapiens CVCL_1893
In-vivo Model To establish a subcutaneous tumour model in nude mice, 2 × 107 Y79 cells (METTL3 knockdown group: shNC, shRNA1 and shRNA2; METTL3 up-regulated group: NC and METLL3) were resuspended in 1 mL of pre-cooled PBS, and 200 uL of the cell suspension was injected subcutaneously into the left side of the armpit to investigate tumour growth (4 × 106 per mouse).
Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator
Histone modification
m6A Regulator: Methyltransferase-like 3 (METTL3)
In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03638
Epigenetic Regulator Histone-lysine N-methyltransferase EZH2 (EZH2)
Regulated Target Histone H3 lysine 27 trimethylation (H3K27me3)
Crosstalk relationship Histone modification → m6A
Disease Gastric cancer
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00313)
Ribosomal protein S6 kinase beta-1 (RPS6KB1/p70S6K)
Adenosine-to-Inosine editing (A-to-I)
In total 3 m6A sequence/site(s) in this target gene
mod ID: A2ISITE008339 Click to Show/Hide the Full List
mod site chr17:59894813-59894814:+ [3]
Sequence AGGGTTTCACCATATTGGCCAGGCTGTTCTCGGACTCCTGA
Transcript ID List ENST00000406116.7; ENST00000225577.9; ENST00000393021.7; ENST00000443572.6; ENST00000472940.5; ENST00000477179.5; ENST00000489824.1
External Link RMBase: RNA-editing_site_59651
mod ID: A2ISITE008340 Click to Show/Hide the Full List
mod site chr17:59895906-59895907:+ [3]
Sequence CCTCTCAAAGTGCTGGGATTACAGGCGTGAGCCACTGCATC
Transcript ID List ENST00000443572.6; ENST00000393021.7; ENST00000406116.7; ENST00000477179.5; ENST00000225577.9; ENST00000489824.1; ENST00000472940.5
External Link RMBase: RNA-editing_site_59652
mod ID: A2ISITE008341 Click to Show/Hide the Full List
mod site chr17:59936603-59936604:+ [4]
Sequence GCCTGTAATCCCCAAACTTTAAAGGGCCAAGGTGGGAGGAT
Transcript ID List rmsk_4733409; ENST00000406116.7; ENST00000443572.6; ENST00000225577.9; ENST00000393021.7; ENST00000472940.5
External Link RMBase: RNA-editing_site_59653
N6-methyladenosine (m6A)
In total 87 m6A sequence/site(s) in this target gene
mod ID: M6ASITE034512 Click to Show/Hide the Full List
mod site chr17:59893060-59893061:+ [5]
Sequence CCACTGTTTGGCTTCACGGAACCCTGTACGCATGCTCCTAC
Motif Score 2.930744048
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000393021.7
External Link RMBase: m6A_site_374932
mod ID: M6ASITE034513 Click to Show/Hide the Full List
mod site chr17:59893086-59893087:+ [5]
Sequence TACGCATGCTCCTACGCTGAACTTTAGGAGCCAGTCTAAGG
Motif Score 3.373380952
Cell/Tissue List HeLa; A549; HEK293A-TOA; iSLK
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000393021.7; ENST00000472940.5
External Link RMBase: m6A_site_374933
mod ID: M6ASITE034514 Click to Show/Hide the Full List
mod site chr17:59893227-59893228:+ [5]
Sequence CGGCTTTTACCCAGCCCCGGACTTCCGAGACAGGGAAGCTG
Motif Score 4.065041667
Cell/Tissue List HeLa; CD34; HepG2; A549; U2OS; MT4; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293T; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000477179.5; ENST00000489824.1; ENST00000406116.7; ENST00000472940.5; ENST00000393021.7; ENST00000225577.9; ENST00000443572.6
External Link RMBase: m6A_site_374934
mod ID: M6ASITE034515 Click to Show/Hide the Full List
mod site chr17:59893236-59893237:+ [5]
Sequence CCCAGCCCCGGACTTCCGAGACAGGGAAGCTGAGGACATGG
Motif Score 2.897386905
Cell/Tissue List HeLa; CD34; HepG2; A549; U2OS; MT4; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293T; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000225577.9; ENST00000477179.5; ENST00000443572.6; ENST00000489824.1; ENST00000472940.5; ENST00000393021.7; ENST00000406116.7
External Link RMBase: m6A_site_374935
mod ID: M6ASITE034516 Click to Show/Hide the Full List
mod site chr17:59893251-59893252:+ [5]
Sequence CCGAGACAGGGAAGCTGAGGACATGGCAGGAGTGTTTGACA
Motif Score 3.643047619
Cell/Tissue List HeLa; CD34; HepG2; A549; U2OS; MT4; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293T; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000477179.5; ENST00000472940.5; ENST00000393021.7; ENST00000225577.9; ENST00000489824.1; ENST00000443572.6; ENST00000406116.7
External Link RMBase: m6A_site_374936
mod ID: M6ASITE034517 Click to Show/Hide the Full List
mod site chr17:59893275-59893276:+ [5]
Sequence GGCAGGAGTGTTTGACATAGACCTGGACCAGCCAGAGGACG
Motif Score 2.876744048
Cell/Tissue List HeLa; CD34; HepG2; A549; U2OS; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293T; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000225577.9; ENST00000393021.7; ENST00000406116.7; ENST00000477179.5; ENST00000443572.6; ENST00000489824.1; ENST00000472940.5
External Link RMBase: m6A_site_374937
mod ID: M6ASITE034518 Click to Show/Hide the Full List
mod site chr17:59893281-59893282:+ [5]
Sequence AGTGTTTGACATAGACCTGGACCAGCCAGAGGACGCGGGCT
Motif Score 3.622404762
Cell/Tissue List HeLa; CD34; HepG2; A549; U2OS; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293T; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000393021.7; ENST00000489824.1; ENST00000477179.5; ENST00000472940.5; ENST00000406116.7; ENST00000443572.6; ENST00000225577.9
External Link RMBase: m6A_site_374938
mod ID: M6ASITE034519 Click to Show/Hide the Full List
mod site chr17:59893828-59893829:+ [5]
Sequence GTTAGAAGTGACAGCTGAAAACTTCTGTCGGGAGTAGCACT
Motif Score 2.627720238
Cell/Tissue List HeLa; CD34; HepG2; HEK293T; A549; U2OS; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; iSLK; TREX; MSC; endometrial; HEC-1-A; GSCs; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000472940.5; ENST00000225577.9; ENST00000406116.7; ENST00000393021.7; ENST00000477179.5; ENST00000443572.6; ENST00000489824.1
External Link RMBase: m6A_site_374939
mod ID: M6ASITE034520 Click to Show/Hide the Full List
mod site chr17:59910583-59910584:+ [6]
Sequence TCAGTTAAATGAAAGCATGGACCATGGGGGAGTTGGACCAT
Motif Score 3.622404762
Cell/Tissue List HepG2; U2OS; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000406116.7; ENST00000393021.7; ENST00000472940.5; ENST00000443572.6; ENST00000592726.1; ENST00000225577.9; ENST00000489824.1; ENST00000477179.5
External Link RMBase: m6A_site_374940
mod ID: M6ASITE034521 Click to Show/Hide the Full List
mod site chr17:59910599-59910600:+ [6]
Sequence ATGGACCATGGGGGAGTTGGACCATATGAACTGTAAGTTTA
Motif Score 3.622404762
Cell/Tissue List HepG2; U2OS; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000225577.9; ENST00000472940.5; ENST00000393021.7; ENST00000477179.5; ENST00000489824.1; ENST00000406116.7; ENST00000443572.6; ENST00000592726.1
External Link RMBase: m6A_site_374941
mod ID: M6ASITE034522 Click to Show/Hide the Full List
mod site chr17:59910608-59910609:+ [5]
Sequence GGGGGAGTTGGACCATATGAACTGTAAGTTTATATGAAGAG
Motif Score 3.373380952
Cell/Tissue List HeLa; HepG2; U2OS; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000225577.9; ENST00000477179.5; ENST00000393021.7; ENST00000592726.1; ENST00000489824.1; ENST00000406116.7; ENST00000472940.5; ENST00000443572.6
External Link RMBase: m6A_site_374942
mod ID: M6ASITE034523 Click to Show/Hide the Full List
mod site chr17:59912692-59912693:+ [5]
Sequence TTTCTTCCCAGTGGCATGGAACATTGTGAGAAATTTGAAAT
Motif Score 2.951386905
Cell/Tissue List HeLa; HepG2; U2OS; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000477179.5; ENST00000225577.9; ENST00000443572.6; ENST00000393021.7; ENST00000472940.5; ENST00000489824.1; ENST00000406116.7; ENST00000592726.1
External Link RMBase: m6A_site_374943
mod ID: M6ASITE034524 Click to Show/Hide the Full List
mod site chr17:59912720-59912721:+ [5]
Sequence AGAAATTTGAAATCTCAGAAACTAGTGTGAACAGAGGGCCA
Motif Score 2.627720238
Cell/Tissue List HeLa; HepG2; U2OS; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000225577.9; ENST00000443572.6; ENST00000489824.1; ENST00000393021.7; ENST00000472940.5; ENST00000406116.7; ENST00000592726.1; ENST00000477179.5
External Link RMBase: m6A_site_374944
mod ID: M6ASITE034525 Click to Show/Hide the Full List
mod site chr17:59912730-59912731:+ [5]
Sequence AATCTCAGAAACTAGTGTGAACAGAGGGCCAGAAAAAATCA
Motif Score 2.951386905
Cell/Tissue List HeLa; HepG2; U2OS; Huh7
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000406116.7; ENST00000592726.1; ENST00000472940.5; ENST00000393021.7; ENST00000489824.1; ENST00000477179.5; ENST00000225577.9; ENST00000443572.6
External Link RMBase: m6A_site_374945
mod ID: M6ASITE034526 Click to Show/Hide the Full List
mod site chr17:59912752-59912753:+ [5]
Sequence AGAGGGCCAGAAAAAATCAGACCAGAATGTTTTGAGCTACT
Motif Score 2.876744048
Cell/Tissue List HeLa; HepG2; HEK293T; U2OS; Huh7
Seq Type List m6A-seq; DART-seq; MeRIP-seq
Transcript ID List ENST00000592726.1; ENST00000393021.7; ENST00000477179.5; ENST00000225577.9; ENST00000443572.6; ENST00000472940.5; ENST00000489824.1; ENST00000406116.7
External Link RMBase: m6A_site_374946
mod ID: M6ASITE034527 Click to Show/Hide the Full List
mod site chr17:59914655-59914656:+ [7]
Sequence TTTTTCAAGTACGAAAAGTAACAGGAGCAAATACTGGGAAA
Motif Score 2.168095238
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000489824.1; ENST00000472940.5; ENST00000592726.1; ENST00000443572.6; ENST00000225577.9; ENST00000393021.7; ENST00000406116.7
External Link RMBase: m6A_site_374947
mod ID: M6ASITE034528 Click to Show/Hide the Full List
mod site chr17:59926470-59926471:+ [7]
Sequence ATGCTAAAGATACAGCTCATACAAAAGCAGAACGGAATATT
Motif Score 2.110482143
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000443572.6; ENST00000225577.9; ENST00000472940.5; ENST00000489824.1; ENST00000406116.7; ENST00000393021.7
External Link RMBase: m6A_site_374948
mod ID: M6ASITE034529 Click to Show/Hide the Full List
mod site chr17:59926553-59926554:+ [5]
Sequence GCCTTTCAGACTGGTGGAAAACTCTACCTCATCCTTGAGTA
Motif Score 2.627720238
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000443572.6; ENST00000472940.5; ENST00000489824.1; ENST00000393021.7; ENST00000406116.7; ENST00000225577.9
External Link RMBase: m6A_site_374949
mod ID: M6ASITE034530 Click to Show/Hide the Full List
mod site chr17:59930123-59930124:+ [5]
Sequence TTTTTCTTTACAGGAGGAGAACTATTTATGCAGTTAGAAAG
Motif Score 3.373380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000472940.5; ENST00000489824.1; ENST00000443572.6; ENST00000406116.7; ENST00000393021.7; ENST00000225577.9
External Link RMBase: m6A_site_374950
mod ID: M6ASITE034531 Click to Show/Hide the Full List
mod site chr17:59930164-59930165:+ [5]
Sequence AGAGGGAATATTTATGGAAGACACTGCCTGGTAAGTGAACT
Motif Score 2.897386905
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000489824.1; ENST00000393021.7; ENST00000406116.7; ENST00000443572.6; ENST00000225577.9; ENST00000472940.5
External Link RMBase: m6A_site_374951
mod ID: M6ASITE034532 Click to Show/Hide the Full List
mod site chr17:59930398-59930399:+ [5]
Sequence CACCAGTTGTTCCTAACAGAACCATTCTCATTGCGGCTTTC
Motif Score 2.930744048
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000472940.5; ENST00000406116.7; ENST00000443572.6; ENST00000489824.1; ENST00000393021.7; ENST00000225577.9
External Link RMBase: m6A_site_374952
mod ID: M6ASITE034533 Click to Show/Hide the Full List
mod site chr17:59934179-59934180:+ [7]
Sequence TTCATTGTAGGTCATGTGAAACTAACAGACTTTGGACTATG
Motif Score 2.627720238
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000587622.1; ENST00000472940.5; ENST00000443572.6; ENST00000225577.9; ENST00000590928.1; ENST00000393021.7; ENST00000406116.7
External Link RMBase: m6A_site_374953
mod ID: M6ASITE034534 Click to Show/Hide the Full List
mod site chr17:59934194-59934195:+ [5]
Sequence GTGAAACTAACAGACTTTGGACTATGCAAAGAATCTATTCA
Motif Score 4.065041667
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000587622.1; ENST00000225577.9; ENST00000406116.7; ENST00000443572.6; ENST00000393021.7; ENST00000590928.1; ENST00000472940.5
External Link RMBase: m6A_site_374954
mod ID: M6ASITE034535 Click to Show/Hide the Full List
mod site chr17:59934222-59934223:+ [5]
Sequence AAGAATCTATTCATGATGGAACAGTCACACACACATTTTGT
Motif Score 2.951386905
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000443572.6; ENST00000393021.7; ENST00000472940.5; ENST00000587622.1; ENST00000590928.1; ENST00000406116.7; ENST00000225577.9
External Link RMBase: m6A_site_374955
mod ID: M6ASITE034536 Click to Show/Hide the Full List
mod site chr17:59934246-59934247:+ [5]
Sequence TCACACACACATTTTGTGGAACAATAGAATACATGTGAGCT
Motif Score 2.951386905
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000393021.7; ENST00000587622.1; ENST00000406116.7; ENST00000472940.5; ENST00000443572.6; ENST00000590928.1; ENST00000225577.9
External Link RMBase: m6A_site_374956
mod ID: M6ASITE034537 Click to Show/Hide the Full List
mod site chr17:59935248-59935249:+ [5]
Sequence GACAAAATCCTCAAATGTAAACTCAATTTGCCTCCCTACCT
Motif Score 2.627720238
Cell/Tissue List HeLa; HEK293T
Seq Type List m6A-seq; DART-seq
Transcript ID List ENST00000443572.6; ENST00000225577.9; ENST00000472940.5; ENST00000393021.7; ENST00000406116.7
External Link RMBase: m6A_site_374957
mod ID: M6ASITE034538 Click to Show/Hide the Full List
mod site chr17:59945431-59945432:+ [7]
Sequence ACATATGTGGCTCCATCTGTACTTGAAAGTGTGAAAGAAAA
Motif Score 3.278136905
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000475155.1; ENST00000472940.5; ENST00000225577.9; ENST00000393021.7; ENST00000406116.7; ENST00000443572.6; ENST00000591035.1
External Link RMBase: m6A_site_374958
mod ID: M6ASITE034539 Click to Show/Hide the Full List
mod site chr17:59945464-59945465:+ [5]
Sequence AAAGAAAAGTTTTCCTTTGAACCAAAAATCCGATCACCTCG
Motif Score 2.930744048
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000472940.5; ENST00000475155.1; ENST00000225577.9; ENST00000393021.7; ENST00000406116.7; ENST00000591035.1; ENST00000443572.6
External Link RMBase: m6A_site_374959
mod ID: M6ASITE034540 Click to Show/Hide the Full List
mod site chr17:59945507-59945508:+ [5]
Sequence GATTTATTGGCAGCCCACGAACACCTGTCAGGTATTTCACA
Motif Score 2.951386905
Cell/Tissue List HeLa; CD34; HEK293T
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000472940.5; ENST00000225577.9; ENST00000443572.6; ENST00000591035.1; ENST00000406116.7; ENST00000393021.7; ENST00000475155.1
External Link RMBase: m6A_site_374960
mod ID: M6ASITE034541 Click to Show/Hide the Full List
mod site chr17:59946617-59946618:+ [5]
Sequence CCAGCACAGCAAATCCTCAGACACCTGTGGAATACCCAATG
Motif Score 2.897386905
Cell/Tissue List HeLa; CD34; HEK293T; HepG2; U2OS; A549; GM12878; MM6; Huh7; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000406116.7; ENST00000591035.1; ENST00000393021.7; ENST00000475155.1; ENST00000472940.5; ENST00000225577.9; ENST00000443572.6
External Link RMBase: m6A_site_374961
mod ID: M6ASITE034542 Click to Show/Hide the Full List
mod site chr17:59946641-59946642:+ [5]
Sequence CTGTGGAATACCCAATGGAAACAAGTGGCATAGAGCAGATG
Motif Score 2.20572619
Cell/Tissue List HeLa; CD34; HepG2; HEK293T; U2OS; hNPCs; hESCs; fibroblasts; A549; GM12878; MM6; Huh7; peripheral-blood; HEK293A-TOA; iSLK; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000475155.1; ENST00000393021.7; ENST00000406116.7; ENST00000591035.1; ENST00000225577.9; ENST00000443572.6; ENST00000472940.5
External Link RMBase: m6A_site_374962
mod ID: M6ASITE034543 Click to Show/Hide the Full List
mod site chr17:59946703-59946704:+ [7]
Sequence GCATCGGCACCACTTCCAATACGACAGCCGAACTCTGGGCC
Motif Score 2.084416667
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000406116.7; ENST00000393021.7; ENST00000472940.5; ENST00000591035.1; ENST00000443572.6; ENST00000475155.1; ENST00000225577.9
External Link RMBase: m6A_site_374963
mod ID: M6ASITE034544 Click to Show/Hide the Full List
mod site chr17:59946706-59946707:+ [8]
Sequence TCGGCACCACTTCCAATACGACAGCCGAACTCTGGGCCATA
Motif Score 2.865571429
Cell/Tissue List A549
Seq Type List m6A-CLIP/IP
Transcript ID List ENST00000393021.7; ENST00000443572.6; ENST00000406116.7; ENST00000225577.9; ENST00000472940.5; ENST00000591035.1; ENST00000475155.1
External Link RMBase: m6A_site_374964
mod ID: M6ASITE034545 Click to Show/Hide the Full List
mod site chr17:59946714-59946715:+ [5]
Sequence ACTTCCAATACGACAGCCGAACTCTGGGCCATACAAAAAAC
Motif Score 3.373380952
Cell/Tissue List HeLa; CD34; HepG2; HEK293T; A549; U2OS; hNPCs; hESCs; fibroblasts; GM12878; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; TREX; endometrial; NB4
Seq Type List m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List ENST00000475155.1; ENST00000443572.6; ENST00000406116.7; ENST00000225577.9; ENST00000393021.7; ENST00000472940.5; ENST00000591035.1
External Link RMBase: m6A_site_374965
mod ID: M6ASITE034546 Click to Show/Hide the Full List
mod site chr17:59946733-59946734:+ [5]
Sequence AACTCTGGGCCATACAAAAAACAAGCTTTTCCCATGATCTC
Motif Score 2.20572619
Cell/Tissue List HeLa; CD34; HepG2; HEK293T; A549; U2OS; hNPCs; hESCs; fibroblasts; GM12878; MM6; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; TREX; endometrial; NB4
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000472940.5; ENST00000225577.9; ENST00000591035.1; ENST00000475155.1; ENST00000443572.6; ENST00000393021.7; ENST00000406116.7
External Link RMBase: m6A_site_374966
mod ID: M6ASITE034547 Click to Show/Hide the Full List
mod site chr17:59946864-59946865:+ [8]
Sequence GCATCCTGCAAGGTGAAACGACTCAAAATGACAGTTTCAGA
Motif Score 3.287565476
Cell/Tissue List A549
Seq Type List m6A-CLIP/IP
Transcript ID List ENST00000225577.9; ENST00000443572.6; ENST00000472940.5; ENST00000591035.1; ENST00000406116.7; ENST00000475155.1; ENST00000393021.7
External Link RMBase: m6A_site_374967
mod ID: M6ASITE034548 Click to Show/Hide the Full List
mod site chr17:59946874-59946875:+ [8]
Sequence AGGTGAAACGACTCAAAATGACAGTTTCAGAGAGTCAATGT
Motif Score 2.859755952
Cell/Tissue List CD8T; A549; AML
Seq Type List m6A-CLIP/IP; miCLIP
Transcript ID List ENST00000443572.6; ENST00000225577.9; ENST00000475155.1; ENST00000393021.7; ENST00000472940.5; ENST00000406116.7; ENST00000591035.1
External Link RMBase: m6A_site_374968
mod ID: M6ASITE034549 Click to Show/Hide the Full List
mod site chr17:59946906-59946907:+ [5]
Sequence AGTCAATGTCATTACATAGAACACTTCAGACACAGGAAAAA
Motif Score 2.951386905
Cell/Tissue List HeLa; CD34; HepG2; HEK293T; A549; BGC823; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A; GSCs; NB4; AML
Seq Type List m6A-seq; MeRIP-seq; miCLIP
Transcript ID List ENST00000591035.1; ENST00000443572.6; ENST00000475155.1; ENST00000225577.9; ENST00000406116.7; ENST00000472940.5; ENST00000393021.7
External Link RMBase: m6A_site_374969
mod ID: M6ASITE034550 Click to Show/Hide the Full List
mod site chr17:59946915-59946916:+ [5]
Sequence CATTACATAGAACACTTCAGACACAGGAAAAATAAACGTGG
Motif Score 2.897386905
Cell/Tissue List HeLa; CD34; HepG2; HEK293T; A549; BGC823; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A; GSCs; NB4
Seq Type List m6A-seq; MeRIP-seq; DART-seq
Transcript ID List ENST00000225577.9; ENST00000443572.6; ENST00000472940.5; ENST00000406116.7; ENST00000591035.1; ENST00000393021.7; ENST00000475155.1
External Link RMBase: m6A_site_374970
mod ID: M6ASITE034551 Click to Show/Hide the Full List
mod site chr17:59946930-59946931:+ [7]
Sequence TTCAGACACAGGAAAAATAAACGTGGATTTTAAAAAATCAA
Motif Score 2.179660714
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000591035.1; ENST00000406116.7; ENST00000443572.6; ENST00000472940.5; ENST00000475155.1; ENST00000225577.9; ENST00000393021.7
External Link RMBase: m6A_site_374971
mod ID: M6ASITE034552 Click to Show/Hide the Full List
mod site chr17:59946969-59946970:+ [5]
Sequence AATCAATGGTGCAAAAAAAAACTTAAAGCAAAATAGTATTG
Motif Score 2.627720238
Cell/Tissue List HeLa; CD34; HepG2; HEK293T; A549; BGC823; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; H1299; MM6; Huh7; Jurkat; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; TREX; GSCs
Seq Type List m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List ENST00000406116.7; ENST00000443572.6; ENST00000225577.9; ENST00000393021.7; ENST00000472940.5; ENST00000591035.1
External Link RMBase: m6A_site_374972
mod ID: M6ASITE034553 Click to Show/Hide the Full List
mod site chr17:59946994-59946995:+ [5]
Sequence AAGCAAAATAGTATTGCTGAACTCTTAGGCACATCAATTAA
Motif Score 3.373380952
Cell/Tissue List HeLa; CD34; HepG2; HEK293T; A549; BGC823; U2OS; H1B; hNPCs; hESCs; fibroblasts; GM12878; LCLs; CD8T; MM6; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX; AML
Seq Type List m6A-seq; MeRIP-seq; m6A-CLIP/IP; miCLIP
Transcript ID List ENST00000393021.7; ENST00000406116.7; ENST00000591035.1; ENST00000472940.5; ENST00000443572.6; ENST00000225577.9
External Link RMBase: m6A_site_374973
mod ID: M6ASITE034554 Click to Show/Hide the Full List
mod site chr17:59947028-59947029:+ [7]
Sequence CAATTAATTGATTCCTCGCGACATCTTCTCAACCTTATCAA
Motif Score 2.865571429
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000406116.7; ENST00000591035.1; ENST00000393021.7; ENST00000443572.6; ENST00000225577.9; ENST00000472940.5
External Link RMBase: m6A_site_374974
mod ID: M6ASITE034555 Click to Show/Hide the Full List
mod site chr17:59947073-59947074:+ [5]
Sequence TTTCATGTTGATGACTCGAAACTGACAGTATTAAGGGTAGG
Motif Score 2.627720238
Cell/Tissue List HeLa; HepG2; HEK293T; A549; U2OS; hNPCs; hESCs; fibroblasts; GM12878; Huh7; HEK293A-TOA; iSLK; MSC; TIME; TREX
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000443572.6; ENST00000591035.1; ENST00000225577.9; ENST00000472940.5; ENST00000393021.7; ENST00000406116.7
External Link RMBase: m6A_site_374975
mod ID: M6ASITE034556 Click to Show/Hide the Full List
mod site chr17:59947077-59947078:+ [9]
Sequence ATGTTGATGACTCGAAACTGACAGTATTAAGGGTAGGATGT
Motif Score 2.859755952
Cell/Tissue List brain; HEK293; kidney
Seq Type List m6A-REF-seq
Transcript ID List ENST00000225577.9; ENST00000591035.1; ENST00000443572.6; ENST00000406116.7; ENST00000472940.5; ENST00000393021.7
External Link RMBase: m6A_site_374976
mod ID: M6ASITE034557 Click to Show/Hide the Full List
mod site chr17:59947110-59947111:+ [7]
Sequence TAGGATGTTGCTTCTGAATCACTGTTGAGTTCTGATTGTGT
Motif Score 2.469291667
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000472940.5; ENST00000393021.7; ENST00000406116.7; ENST00000225577.9; ENST00000591035.1; ENST00000443572.6
External Link RMBase: m6A_site_374977
mod ID: M6ASITE034558 Click to Show/Hide the Full List
mod site chr17:59947163-59947164:+ [7]
Sequence ATCCTTTCATTAGGCAAAGTACAAAATTGCCTATAATACTT
Motif Score 2.856142857
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000393021.7; ENST00000472940.5; ENST00000591035.1; ENST00000225577.9; ENST00000406116.7
External Link RMBase: m6A_site_374978
mod ID: M6ASITE034559 Click to Show/Hide the Full List
mod site chr17:59947194-59947195:+ [5]
Sequence TATAATACTTGCAACTAAGGACAAATTAGCATGCAAGCTTG
Motif Score 3.643047619
Cell/Tissue List HeLa; HepG2; HEK293T; U2OS; hNPCs; hESCs; fibroblasts; A549; GM12878; Huh7; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; TREX
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000406116.7; ENST00000393021.7; ENST00000472940.5; ENST00000225577.9; ENST00000591035.1
External Link RMBase: m6A_site_374979
mod ID: M6ASITE034560 Click to Show/Hide the Full List
mod site chr17:59947220-59947221:+ [5]
Sequence TAGCATGCAAGCTTGGTCAAACTTTTTCCAGCAAAATGGAA
Motif Score 2.627720238
Cell/Tissue List HeLa; HepG2; HEK293T; hNPCs; hESCs; fibroblasts; A549; GM12878; CD8T; Huh7; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; TREX
Seq Type List m6A-seq; MeRIP-seq; DART-seq; m6A-CLIP/IP
Transcript ID List ENST00000472940.5; ENST00000393021.7; ENST00000591035.1; ENST00000225577.9; ENST00000406116.7
External Link RMBase: m6A_site_374980
mod ID: M6ASITE034561 Click to Show/Hide the Full List
mod site chr17:59947247-59947248:+ [5]
Sequence CCAGCAAAATGGAAGCAAAGACAAAAGAAACTTACCAATTG
Motif Score 2.897386905
Cell/Tissue List HeLa; HepG2; HEK293T; hNPCs; hESCs; fibroblasts; A549; GM12878; Huh7; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; TREX
Seq Type List m6A-seq; MeRIP-seq; DART-seq
Transcript ID List ENST00000591035.1; ENST00000406116.7; ENST00000225577.9; ENST00000393021.7; ENST00000472940.5
External Link RMBase: m6A_site_374981
mod ID: M6ASITE034562 Click to Show/Hide the Full List
mod site chr17:59947256-59947257:+ [5]
Sequence TGGAAGCAAAGACAAAAGAAACTTACCAATTGATGTTTTAC
Motif Score 2.627720238
Cell/Tissue List HeLa; HepG2; HEK293T; hNPCs; hESCs; fibroblasts; A549; GM12878; CD8T; Huh7; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; TREX
Seq Type List m6A-seq; MeRIP-seq; DART-seq; m6A-CLIP/IP
Transcript ID List ENST00000472940.5; ENST00000406116.7; ENST00000591035.1; ENST00000225577.9; ENST00000393021.7
External Link RMBase: m6A_site_374982
mod ID: M6ASITE034563 Click to Show/Hide the Full List
mod site chr17:59947260-59947261:+ [7]
Sequence AGCAAAGACAAAAGAAACTTACCAATTGATGTTTTACGTGC
Motif Score 2.052208333
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000225577.9; ENST00000472940.5; ENST00000406116.7; ENST00000393021.7; ENST00000591035.1
External Link RMBase: m6A_site_374983
mod ID: M6ASITE034564 Click to Show/Hide the Full List
mod site chr17:59947283-59947284:+ [5]
Sequence AATTGATGTTTTACGTGCAAACAACCTGAATCTTTTTTTTA
Motif Score 2.20572619
Cell/Tissue List HeLa; HepG2; HEK293T; hNPCs; hESCs; fibroblasts; A549; GM12878; Huh7; peripheral-blood; HEK293A-TOA; iSLK; MSC; TIME; TREX
Seq Type List m6A-seq; MeRIP-seq; DART-seq
Transcript ID List ENST00000406116.7; ENST00000591035.1; ENST00000393021.7; ENST00000225577.9; ENST00000472940.5
External Link RMBase: m6A_site_374984
mod ID: M6ASITE034565 Click to Show/Hide the Full List
mod site chr17:59947354-59947355:+ [5]
Sequence GATTCAGCTCATTATGAAAAACATCCCAAACTTTAAAATGC
Motif Score 2.20572619
Cell/Tissue List HeLa; HEK293T; HepG2; A549; GM12878; Huh7; HEK293A-TOA
Seq Type List m6A-seq; MeRIP-seq; DART-seq
Transcript ID List ENST00000225577.9; ENST00000393021.7; ENST00000472940.5; ENST00000591035.1; ENST00000406116.7
External Link RMBase: m6A_site_374985
mod ID: M6ASITE034566 Click to Show/Hide the Full List
mod site chr17:59947363-59947364:+ [5]
Sequence CATTATGAAAAACATCCCAAACTTTAAAATGCGAAATTATT
Motif Score 2.627720238
Cell/Tissue List HeLa; HEK293T; HepG2; A549; GM12878; Huh7; HEK293A-TOA
Seq Type List m6A-seq; MeRIP-seq
Transcript ID List ENST00000406116.7; ENST00000472940.5; ENST00000591035.1; ENST00000225577.9; ENST00000393021.7
External Link RMBase: m6A_site_374986
mod ID: M6ASITE034567 Click to Show/Hide the Full List
mod site chr17:59947405-59947406:+ [10]
Sequence GTTGGTGTGAAGAAAGCCAGACAACTTCTGTTTCTTCTCTT
Motif Score 2.897386905
Cell/Tissue List HEK293T; HepG2; GM12878; Huh7
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000591035.1; ENST00000472940.5; ENST00000393021.7; ENST00000225577.9; ENST00000406116.7
External Link RMBase: m6A_site_374987
mod ID: M6ASITE034568 Click to Show/Hide the Full List
mod site chr17:59947408-59947409:+ [7]
Sequence GGTGTGAAGAAAGCCAGACAACTTCTGTTTCTTCTCTTGGT
Motif Score 2.595904762
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000472940.5; ENST00000406116.7; ENST00000591035.1; ENST00000393021.7; ENST00000225577.9
External Link RMBase: m6A_site_374988
mod ID: M6ASITE034569 Click to Show/Hide the Full List
mod site chr17:59947495-59947496:+ [10]
Sequence CGTTTGAGGGATTGGGGTGGACCTGGGGTTTATTTTCAGTA
Motif Score 3.622404762
Cell/Tissue List HEK293T; HepG2; Huh7
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000406116.7; ENST00000591035.1; ENST00000225577.9; ENST00000393021.7
External Link RMBase: m6A_site_374989
mod ID: M6ASITE034570 Click to Show/Hide the Full List
mod site chr17:59947675-59947676:+ [7]
Sequence TTGTCCCGGGCCTGCATTGCACTGGAAAAAAAAATCGCCAC
Motif Score 3.252583333
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000591035.1; ENST00000225577.9; ENST00000393021.7; ENST00000587061.1; ENST00000406116.7
External Link RMBase: m6A_site_374990
mod ID: M6ASITE034571 Click to Show/Hide the Full List
mod site chr17:59947724-59947725:+
Sequence ACACCAGTATTTGGTTCAAGACACCAAATGTCTTCAGCCCA
Motif Score 2.897386905
Cell/Tissue List HEK293T
Seq Type List MeRIP-seq
Transcript ID List ENST00000591035.1; ENST00000406116.7; ENST00000225577.9; ENST00000587061.1; ENST00000393021.7
External Link RMBase: m6A_site_374991
mod ID: M6ASITE034572 Click to Show/Hide the Full List
mod site chr17:59947755-59947756:+
Sequence CTTCAGCCCATGGCTGAAGAACAACAGAAGAGAGTCAGGAT
Motif Score 2.951386905
Cell/Tissue List HEK293T
Seq Type List MeRIP-seq
Transcript ID List ENST00000406116.7; ENST00000393021.7; ENST00000591035.1; ENST00000587061.1; ENST00000225577.9
External Link RMBase: m6A_site_374992
mod ID: M6ASITE034573 Click to Show/Hide the Full List
mod site chr17:59947947-59947948:+ [7]
Sequence TCCTTATATTTTTTTCCTCAACAGTTTTAAAAAGAAAAAAA
Motif Score 2.173910714
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000587061.1; ENST00000225577.9; ENST00000591035.1; ENST00000406116.7; ENST00000393021.7
External Link RMBase: m6A_site_374993
mod ID: M6ASITE034574 Click to Show/Hide the Full List
mod site chr17:59948049-59948050:+ [9]
Sequence CCTTTTGATGAATGTCTTCCACAGTAAAGAAAACTTAGTGG
Motif Score 2.053113095
Cell/Tissue List HEK293; HEK293T
Seq Type List m6A-REF-seq; DART-seq
Transcript ID List ENST00000587061.1; ENST00000225577.9; ENST00000591035.1; ENST00000406116.7; ENST00000393021.7
External Link RMBase: m6A_site_374994
mod ID: M6ASITE034575 Click to Show/Hide the Full List
mod site chr17:59948061-59948062:+ [7]
Sequence TGTCTTCCACAGTAAAGAAAACTTAGTGGCTTAATTTAGGA
Motif Score 2.627720238
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000591035.1; ENST00000393021.7; ENST00000225577.9; ENST00000587061.1; ENST00000406116.7
External Link RMBase: m6A_site_374995
mod ID: M6ASITE034576 Click to Show/Hide the Full List
mod site chr17:59948118-59948119:+ [7]
Sequence ACTATGTTTTTGAAATTGTAACAAAATCTACATAAATGATT
Motif Score 2.168095238
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000587061.1; ENST00000393021.7; ENST00000591035.1; ENST00000406116.7; ENST00000225577.9
External Link RMBase: m6A_site_374996
mod ID: M6ASITE034577 Click to Show/Hide the Full List
mod site chr17:59948168-59948169:+ [7]
Sequence AAAGAATAAAAATAAAGGTAACTTTACCTTTCTTAAATATT
Motif Score 2.590089286
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000393021.7; ENST00000591035.1; ENST00000225577.9; ENST00000587061.1; ENST00000406116.7
External Link RMBase: m6A_site_374997
mod ID: M6ASITE034578 Click to Show/Hide the Full List
mod site chr17:59948216-59948217:+ [7]
Sequence TTAAAGAGAGCATTTCCATGACTTTAGCTGGTGAAAGGGTT
Motif Score 3.28175
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000591035.1; ENST00000225577.9; ENST00000393021.7; ENST00000587061.1
External Link RMBase: m6A_site_374998
mod ID: M6ASITE034579 Click to Show/Hide the Full List
mod site chr17:59948647-59948648:+ [10]
Sequence CGATAAAAGTTCATCTTTGGACAGAAAGCCTTTAAAAAAAA
Motif Score 3.643047619
Cell/Tissue List HEK293T; HeLa
Seq Type List MeRIP-seq; m6A-seq
Transcript ID List ENST00000225577.9; ENST00000591035.1; ENST00000587061.1; ENST00000393021.7
External Link RMBase: m6A_site_374999
mod ID: M6ASITE034580 Click to Show/Hide the Full List
mod site chr17:59948716-59948717:+ [5]
Sequence ATTGCAGCAGCCTACTGAGAACTTTGACTGTTGCTGGTAAA
Motif Score 3.373380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000591035.1; ENST00000587061.1; ENST00000225577.9; ENST00000393021.7
External Link RMBase: m6A_site_375000
mod ID: M6ASITE034581 Click to Show/Hide the Full List
mod site chr17:59948746-59948747:+ [7]
Sequence TTGCTGGTAAATTAGAAGCTACAATAATAATTAAGGGCAGA
Motif Score 2.078666667
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000225577.9; ENST00000591035.1; ENST00000587061.1; ENST00000393021.7
External Link RMBase: m6A_site_375001
mod ID: M6ASITE034582 Click to Show/Hide the Full List
mod site chr17:59948773-59948774:+ [7]
Sequence TAATTAAGGGCAGAAATTATACTTAAAAAGTGCAGATCCTT
Motif Score 2.53247619
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000587061.1; ENST00000393021.7; ENST00000591035.1; ENST00000225577.9
External Link RMBase: m6A_site_375002
mod ID: M6ASITE034583 Click to Show/Hide the Full List
mod site chr17:59949042-59949043:+ [5]
Sequence GCTATAACCACCCCAGTTAAACCATTTTCATAATTAGTAGT
Motif Score 2.185083333
Cell/Tissue List HeLa; HEK293T
Seq Type List m6A-seq; DART-seq
Transcript ID List ENST00000591035.1; ENST00000225577.9; ENST00000393021.7; ENST00000587061.1
External Link RMBase: m6A_site_375003
mod ID: M6ASITE034584 Click to Show/Hide the Full List
mod site chr17:59949206-59949207:+ [5]
Sequence CTGTGGAAAGTTTATTGAGAACTTGTTTCATAAATGGATAT
Motif Score 3.373380952
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000587061.1; ENST00000393021.7; ENST00000591035.1; ENST00000225577.9
External Link RMBase: m6A_site_375004
mod ID: M6ASITE034585 Click to Show/Hide the Full List
mod site chr17:59949246-59949247:+ [5]
Sequence TCCCTACTATGACTGTGAAAACATGTCAAGTGTCACATTAG
Motif Score 2.20572619
Cell/Tissue List HeLa; HEK293T
Seq Type List m6A-seq; DART-seq
Transcript ID List ENST00000587061.1; ENST00000591035.1; ENST00000225577.9; ENST00000393021.7
External Link RMBase: m6A_site_375005
mod ID: M6ASITE034586 Click to Show/Hide the Full List
mod site chr17:59949275-59949276:+ [5]
Sequence GTGTCACATTAGTGTCACAGACAGAAAGCACACACCTATGC
Motif Score 2.897386905
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000591035.1; ENST00000225577.9; ENST00000587061.1; ENST00000393021.7
External Link RMBase: m6A_site_375006
mod ID: M6ASITE034587 Click to Show/Hide the Full List
mod site chr17:59949360-59949361:+ [7]
Sequence TAAAATATGATGTCGATATTACTAGTCTTGAGTTTCTAAGA
Motif Score 2.494845238
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000587061.1; ENST00000393021.7; ENST00000591035.1; ENST00000225577.9
External Link RMBase: m6A_site_375007
mod ID: M6ASITE034588 Click to Show/Hide the Full List
mod site chr17:59949521-59949522:+ [7]
Sequence TTTTTAATTAAAATATAATCACTGAAGTTTACTAATTTGAT
Motif Score 2.469291667
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000225577.9; ENST00000587061.1; ENST00000393021.7; ENST00000591035.1
External Link RMBase: m6A_site_375008
mod ID: M6ASITE034589 Click to Show/Hide the Full List
mod site chr17:59949531-59949532:+ [7]
Sequence AAATATAATCACTGAAGTTTACTAATTTGATTTTATAAGGT
Motif Score 2.494845238
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000591035.1; ENST00000225577.9; ENST00000393021.7; ENST00000587061.1
External Link RMBase: m6A_site_375009
mod ID: M6ASITE034590 Click to Show/Hide the Full List
mod site chr17:59949682-59949683:+ [7]
Sequence TTTCCCCCTTTATGGTCTTAACTAATTTGAATCCTTCAAGA
Motif Score 2.590089286
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000393021.7; ENST00000591035.1; ENST00000587061.1; ENST00000225577.9
External Link RMBase: m6A_site_375010
mod ID: M6ASITE034591 Click to Show/Hide the Full List
mod site chr17:59949787-59949788:+ [7]
Sequence TATGATACTCCATAAATTCAACATTCTTTACTATAGGTAAT
Motif Score 2.173910714
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000225577.9; ENST00000591035.1; ENST00000587061.1; ENST00000393021.7
External Link RMBase: m6A_site_375011
mod ID: M6ASITE034592 Click to Show/Hide the Full List
mod site chr17:59949820-59949821:+ [7]
Sequence TAGGTAATGAATGATTATAAACAAGATGCATCTTAGATAGT
Motif Score 2.20572619
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000225577.9; ENST00000587061.1; ENST00000393021.7; ENST00000591035.1
External Link RMBase: m6A_site_375012
mod ID: M6ASITE034593 Click to Show/Hide the Full List
mod site chr17:59949849-59949850:+ [7]
Sequence ATCTTAGATAGTATTAATATACTGAGCCTTGGATTATATAT
Motif Score 2.53247619
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000587061.1; ENST00000225577.9; ENST00000591035.1; ENST00000393021.7
External Link RMBase: m6A_site_375013
mod ID: M6ASITE034594 Click to Show/Hide the Full List
mod site chr17:59949880-59949881:+ [7]
Sequence GATTATATATTTAATATAGGACCTATTTTGAATATTCAGTT
Motif Score 3.622404762
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000591035.1; ENST00000393021.7; ENST00000587061.1; ENST00000225577.9
External Link RMBase: m6A_site_375014
mod ID: M6ASITE034595 Click to Show/Hide the Full List
mod site chr17:59949921-59949922:+ [7]
Sequence AATCATATGGTTCCTAGCTTACAAGGGCTAGATCTAAGATT
Motif Score 2.07285119
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000393021.7; ENST00000225577.9; ENST00000587061.1; ENST00000591035.1
External Link RMBase: m6A_site_375015
mod ID: M6ASITE034596 Click to Show/Hide the Full List
mod site chr17:59950067-59950068:+ [7]
Sequence AGTAGACACTAGCAAGCTGGACAAACTATCACAAAAGTATT
Motif Score 3.643047619
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000225577.9; ENST00000587061.1; ENST00000591035.1; ENST00000393021.7
External Link RMBase: m6A_site_375016
mod ID: M6ASITE034597 Click to Show/Hide the Full List
mod site chr17:59950150-59950151:+ [7]
Sequence TTTTTCTTGTGTGATTCTTAACATTATAGCACAAGTATTAT
Motif Score 2.168095238
Cell/Tissue List HEK293T
Seq Type List DART-seq
Transcript ID List ENST00000393021.7; ENST00000587061.1; ENST00000225577.9; ENST00000591035.1
External Link RMBase: m6A_site_375017
mod ID: M6ASITE034598 Click to Show/Hide the Full List
mod site chr17:59950236-59950237:+ [5]
Sequence TGTTTGTGTTTGCTCTTTAAACTATTGTTTCTCCTATCCCA
Motif Score 2.627720238
Cell/Tissue List HeLa
Seq Type List m6A-seq
Transcript ID List ENST00000587061.1; ENST00000393021.7; ENST00000591035.1; ENST00000225577.9
External Link RMBase: m6A_site_375018
Pseudouridine (Pseudo)
In total 1 m6A sequence/site(s) in this target gene
mod ID: PSESITE000108 Click to Show/Hide the Full List
mod site chr17:59946741-59946742:+ [11]
Sequence GCCATACAAAAAACAAGCTTTTCCCATGATCTCCAAACGGC
Transcript ID List ENST00000443572.6; ENST00000393021.7; ENST00000406116.7; ENST00000225577.9; ENST00000472940.5; ENST00000475155.1; ENST00000591035.1
External Link RMBase: Pseudo_site_2252