m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00297)

Target Name	Integrin alpha-6 (ITGA6)
Gene Name	ITGA6
Chromosomal Location	2q31.1
Family	integrin alpha chain family
Function	Integrin alpha-6/beta-1 (ITGA6:ITGB1) is a receptor for laminin on platelets (By similarity). Integrin alpha-6/beta-1 (ITGA6:ITGB1) is present in oocytes and is involved in sperm-egg fusion (By similarity). Integrin alpha-6/beta-4 (ITGA6:ITGB4) is a receptor for laminin in epithelial cells and it plays a critical structural role in the hemidesmosome (By similarity). ITGA6:ITGB4 binds to NRG1 (via EGF domain) and this binding is essential for NRG1-ERBB signaling. ITGA6:ITGB4 binds to IGF1 and this binding is essential for IGF1 signaling. ITGA6:ITGB4 binds to IGF2 and this binding is essential for IGF2 signaling. Click to Show/Hide
Gene ID	3655
Uniprot ID	ITA6_HUMAN
HGNC ID	HGNC:6142
KEGG ID	hsa:3655

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

ITGA6 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

YTH domain-containing family protein 1 (YTHDF1) [READER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by YTHDF1*
Cell Line	AGS cell line	Homo sapiens
Treatment: shYTHDF1 AGS Control: shControl AGS		GSE159425
Regulation		logFC: -9.21E-01 p-value: 3.27E-05
More Results	Click to View More RNA-seq Results
*Representative RIP-seq result supporting the interaction between ITGA6 and the regulator*
Cell Line	Hela	Homo sapiens
Regulation	logFC: 2.14E+00	GSE63591

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	m6A writer METTL3 and eraser ALKBH5 altered cell adhesion by regulating Integrin alpha-6 (ITGA6) expression in bladder cancer cells. m6A is highly enriched within the ITGA6 transcripts, and increased m6A methylations of the ITGA6 mRNA 3'UTR promotes the translation of ITGA6 mRNA via binding of the m6A readers YTHDF1 and YTHDF3. Inhibition of ITGA6 results in decreased growth and progression of bladder cancer cells in vitro and in vivo.
Responsed Disease	Bladder cancer		ICD-11: 2C94	Disease Info
Pathway Response	Cell adhesion molecules			hsa04514
Cell Process	Cell adhesion
	Cell migration
	Cell invasion
In-vitro Model	5637	Bladder carcinoma	Homo sapiens	CVCL_0126
	HEK293T	Normal	Homo sapiens	CVCL_0063
	J82	Bladder carcinoma	Homo sapiens	CVCL_0359
	SV-HUC-1	Normal	Homo sapiens	CVCL_3798
	T24	Bladder carcinoma	Homo sapiens	CVCL_0554
	UM-UC-3	Bladder carcinoma	Homo sapiens	CVCL_1783
In-vivo Model	For the subcutaneous implantation model, 1 × 10⁷ cells were subcutaneously implanted into 5-week-old BALB/cJNju-Foxn1nu/Nju nude mice.

Fat mass and obesity-associated protein (FTO) [ERASER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by FTO*
Cell Line	253J cell line	Homo sapiens
Treatment: siFTO 253J cells Control: 253J cells		GSE150239
Regulation		logFC: 5.89E-01 p-value: 3.48E-07
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[2]
Response Summary	In bladder cancer, the changes in m6A methylation level mainly appeared at 5' untranslated region (5' UTR) of MALAT1 and NOTCH1 transcripts, and at 3' UTR of CSNK2A2 and Integrin alpha-6 (ITGA6) transcripts, responding to the overexpression of FTO. SFPQ could influence the FTO-mediated m6A RNA demethylation, eventually affecting the gene expression.
Target Regulation	Up regulation
Responsed Disease	Bladder cancer		ICD-11: 2C94	Disease Info
Pathway Response	Notch signaling pathway			hsa04330
Cell Process	Cell proliferation
	Cell invasion
	Cell apoptosis
In-vitro Model	HT-1197	Recurrent bladder carcinoma	Homo sapiens	CVCL_1291
	HT-1376	Bladder carcinoma	Homo sapiens	CVCL_1292
In-vivo Model	BALB/cnu/nu mice (4-5 weeks old) were used for the xenograft experiment. The mice were randomly divided into 2 groups (n = 6 for each group) and injected with 5 × 10⁶ HT-1197 cells in control group or FTO plasmid group, respectively.

Methyltransferase-like 3 (METTL3) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by METTL3*
Cell Line	MOLM-13 cell line	Homo sapiens
Treatment: shMETTL3 MOLM13 cells Control: MOLM13 cells		GSE98623
Regulation		logFC: -2.38E+00 p-value: 1.75E-72
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	m6A writer METTL3 and eraser ALKBH5 altered cell adhesion by regulating Integrin alpha-6 (ITGA6) expression in bladder cancer cells. m6A is highly enriched within the ITGA6 transcripts, and increased m6A methylations of the ITGA6 mRNA 3'UTR promotes the translation of ITGA6 mRNA via binding of the m6A readers YTHDF1 and YTHDF3. Inhibition of ITGA6 results in decreased growth and progression of bladder cancer cells in vitro and in vivo.
Target Regulation	Up regulation
Responsed Disease	Bladder cancer		ICD-11: 2C94	Disease Info
Pathway Response	Cell adhesion molecules			hsa04514
Cell Process	Cell adhesion
	Cell migration
	Cell invasion
In-vitro Model	5637	Bladder carcinoma	Homo sapiens	CVCL_0126
	HEK293T	Normal	Homo sapiens	CVCL_0063
	J82	Bladder carcinoma	Homo sapiens	CVCL_0359
	SV-HUC-1	Normal	Homo sapiens	CVCL_3798
	T24	Bladder carcinoma	Homo sapiens	CVCL_0554
	UM-UC-3	Bladder carcinoma	Homo sapiens	CVCL_1783
In-vivo Model	For the subcutaneous implantation model, 1 × 10⁷ cells were subcutaneously implanted into 5-week-old BALB/cJNju-Foxn1nu/Nju nude mice.

YTH domain-containing family protein 3 (YTHDF3) [READER]

Regulator Info

*Representative RIP-seq result supporting the interaction between ITGA6 and the regulator*
Cell Line	Hela	Homo sapiens
Regulation	logFC: 1.67E+00	GSE86214

In total 2 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[3]
Response Summary	KDM5B regulates the YTHDF3/ITGA6 axis by inhibiting the expression of miR-448 to promote the occurrence of hepatocellular carcinoma. miR-448 could target YTHDF3 and inhibit the YTHDF3/Integrin alpha-6 (ITGA6) axis, thereby inhibiting the occurrence of HCC.
Responsed Disease	Hepatocellular carcinoma		ICD-11: 2C12.02	Disease Info
Cell Process	Cell proliferation
	Cell migration
	Cell invasion
	Cell apoptosis
In-vitro Model	HEK293T	Normal	Homo sapiens	CVCL_0063
	Hep 3B2.1-7	Childhood hepatocellular carcinoma	Homo sapiens	CVCL_0326
	SMMC-7721	Endocervical adenocarcinoma	Homo sapiens	CVCL_0534
In-vivo Model	HCC cells (5 × 10⁶ cells/mouse) that had been transfected with oe-NC + sh-NC, oe-KDM5B + sh-NC, or oe-KDM5B + sh-ITGA6, or treated with NS, GSK-467 (a selective inhibitor of KDM5B) + oe-NC or GSK-467 + oe-ITGA6 were then subcutaneously implanted into the back of mice.
Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	m6A writer METTL3 and eraser ALKBH5 altered cell adhesion by regulating Integrin alpha-6 (ITGA6) expression in bladder cancer cells. m6A is highly enriched within the ITGA6 transcripts, and increased m6A methylations of the ITGA6 mRNA 3'UTR promotes the translation of ITGA6 mRNA via binding of the m6A readers YTHDF1 and YTHDF3. Inhibition of ITGA6 results in decreased growth and progression of bladder cancer cells in vitro and in vivo.
Responsed Disease	Bladder cancer		ICD-11: 2C94	Disease Info
Pathway Response	Cell adhesion molecules			hsa04514
Cell Process	Cell adhesion
	Cell migration
	Cell invasion
In-vitro Model	5637	Bladder carcinoma	Homo sapiens	CVCL_0126
	HEK293T	Normal	Homo sapiens	CVCL_0063
	J82	Bladder carcinoma	Homo sapiens	CVCL_0359
	SV-HUC-1	Normal	Homo sapiens	CVCL_3798
	T24	Bladder carcinoma	Homo sapiens	CVCL_0554
	UM-UC-3	Bladder carcinoma	Homo sapiens	CVCL_1783
In-vivo Model	For the subcutaneous implantation model, 1 × 10⁷ cells were subcutaneously implanted into 5-week-old BALB/cJNju-Foxn1nu/Nju nude mice.

RNA demethylase ALKBH5 (ALKBH5) [ERASER]

Regulator Info

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	m6A writer METTL3 and eraser ALKBH5 altered cell adhesion by regulating Integrin alpha-6 (ITGA6) expression in bladder cancer cells. m6A is highly enriched within the ITGA6 transcripts, and increased m6A methylations of the ITGA6 mRNA 3'UTR promotes the translation of ITGA6 mRNA via binding of the m6A readers YTHDF1 and YTHDF3. Inhibition of ITGA6 results in decreased growth and progression of bladder cancer cells in vitro and in vivo.
Responsed Disease	Bladder cancer		ICD-11: 2C94	Disease Info
Pathway Response	Cell adhesion molecules			hsa04514
Cell Process	Cell adhesion
	Cell migration
	Cell invasion
In-vitro Model	5637	Bladder carcinoma	Homo sapiens	CVCL_0126
	HEK293T	Normal	Homo sapiens	CVCL_0063
	J82	Bladder carcinoma	Homo sapiens	CVCL_0359
	SV-HUC-1	Normal	Homo sapiens	CVCL_3798
	T24	Bladder carcinoma	Homo sapiens	CVCL_0554
	UM-UC-3	Bladder carcinoma	Homo sapiens	CVCL_1783
In-vivo Model	For the subcutaneous implantation model, 1 × 10⁷ cells were subcutaneously implanted into 5-week-old BALB/cJNju-Foxn1nu/Nju nude mice.

Liver cancer [ICD-11: 2C12]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[3]
Response Summary	KDM5B regulates the YTHDF3/ITGA6 axis by inhibiting the expression of miR-448 to promote the occurrence of hepatocellular carcinoma. miR-448 could target YTHDF3 and inhibit the YTHDF3/Integrin alpha-6 (ITGA6) axis, thereby inhibiting the occurrence of HCC.
Responsed Disease	Hepatocellular carcinoma [ICD-11: 2C12.02]
Target Regulator	YTH domain-containing family protein 3 (YTHDF3)		READER	Regulator Info
Cell Process	Cell proliferation
	Cell migration
	Cell invasion
	Cell apoptosis
In-vitro Model	HEK293T	Normal	Homo sapiens	CVCL_0063
	Hep 3B2.1-7	Childhood hepatocellular carcinoma	Homo sapiens	CVCL_0326
	SMMC-7721	Endocervical adenocarcinoma	Homo sapiens	CVCL_0534
In-vivo Model	HCC cells (5 × 10⁶ cells/mouse) that had been transfected with oe-NC + sh-NC, oe-KDM5B + sh-NC, or oe-KDM5B + sh-ITGA6, or treated with NS, GSK-467 (a selective inhibitor of KDM5B) + oe-NC or GSK-467 + oe-ITGA6 were then subcutaneously implanted into the back of mice.

Bladder cancer [ICD-11: 2C94]

Disease Info

In total 5 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[2]
Response Summary	In bladder cancer, the changes in m6A methylation level mainly appeared at 5' untranslated region (5' UTR) of MALAT1 and NOTCH1 transcripts, and at 3' UTR of CSNK2A2 and Integrin alpha-6 (ITGA6) transcripts, responding to the overexpression of FTO. SFPQ could influence the FTO-mediated m6A RNA demethylation, eventually affecting the gene expression.
Responsed Disease	Bladder cancer [ICD-11: 2C94]
Target Regulator	Fat mass and obesity-associated protein (FTO)		ERASER	Regulator Info
Target Regulation	Up regulation
Pathway Response	Notch signaling pathway			hsa04330
Cell Process	Cell proliferation
	Cell invasion
	Cell apoptosis
In-vitro Model	HT-1197	Recurrent bladder carcinoma	Homo sapiens	CVCL_1291
In-vitro Model	HT-1376	Bladder carcinoma	Homo sapiens	CVCL_1292
In-vivo Model	BALB/cnu/nu mice (4-5 weeks old) were used for the xenograft experiment. The mice were randomly divided into 2 groups (n = 6 for each group) and injected with 5 × 10⁶ HT-1197 cells in control group or FTO plasmid group, respectively.
Experiment 2 Reporting the m6A-centered Disease Response				[1]
Response Summary	m6A writer METTL3 and eraser ALKBH5 altered cell adhesion by regulating Integrin alpha-6 (ITGA6) expression in bladder cancer cells. m6A is highly enriched within the ITGA6 transcripts, and increased m6A methylations of the ITGA6 mRNA 3'UTR promotes the translation of ITGA6 mRNA via binding of the m6A readers YTHDF1 and YTHDF3. Inhibition of ITGA6 results in decreased growth and progression of bladder cancer cells in vitro and in vivo.
Responsed Disease	Bladder cancer [ICD-11: 2C94]
Target Regulator	Methyltransferase-like 3 (METTL3)		WRITER	Regulator Info
Target Regulation	Up regulation
Pathway Response	Cell adhesion molecules			hsa04514
Cell Process	Cell adhesion
	Cell migration
	Cell invasion
In-vitro Model	5637	Bladder carcinoma	Homo sapiens	CVCL_0126
	HEK293T	Normal	Homo sapiens	CVCL_0063
	J82	Bladder carcinoma	Homo sapiens	CVCL_0359
	SV-HUC-1	Normal	Homo sapiens	CVCL_3798
	T24	Bladder carcinoma	Homo sapiens	CVCL_0554
	UM-UC-3	Bladder carcinoma	Homo sapiens	CVCL_1783
In-vivo Model	For the subcutaneous implantation model, 1 × 10⁷ cells were subcutaneously implanted into 5-week-old BALB/cJNju-Foxn1nu/Nju nude mice.
Experiment 3 Reporting the m6A-centered Disease Response				[1]
Response Summary	m6A writer METTL3 and eraser ALKBH5 altered cell adhesion by regulating Integrin alpha-6 (ITGA6) expression in bladder cancer cells. m6A is highly enriched within the ITGA6 transcripts, and increased m6A methylations of the ITGA6 mRNA 3'UTR promotes the translation of ITGA6 mRNA via binding of the m6A readers YTHDF1 and YTHDF3. Inhibition of ITGA6 results in decreased growth and progression of bladder cancer cells in vitro and in vivo.
Responsed Disease	Bladder cancer [ICD-11: 2C94]
Target Regulator	RNA demethylase ALKBH5 (ALKBH5)		ERASER	Regulator Info
Pathway Response	Cell adhesion molecules			hsa04514
Cell Process	Cell adhesion
	Cell migration
	Cell invasion
In-vitro Model	5637	Bladder carcinoma	Homo sapiens	CVCL_0126
	HEK293T	Normal	Homo sapiens	CVCL_0063
	J82	Bladder carcinoma	Homo sapiens	CVCL_0359
	SV-HUC-1	Normal	Homo sapiens	CVCL_3798
	T24	Bladder carcinoma	Homo sapiens	CVCL_0554
	UM-UC-3	Bladder carcinoma	Homo sapiens	CVCL_1783
In-vivo Model	For the subcutaneous implantation model, 1 × 10⁷ cells were subcutaneously implanted into 5-week-old BALB/cJNju-Foxn1nu/Nju nude mice.
Experiment 4 Reporting the m6A-centered Disease Response				[1]
Response Summary	m6A writer METTL3 and eraser ALKBH5 altered cell adhesion by regulating Integrin alpha-6 (ITGA6) expression in bladder cancer cells. m6A is highly enriched within the ITGA6 transcripts, and increased m6A methylations of the ITGA6 mRNA 3'UTR promotes the translation of ITGA6 mRNA via binding of the m6A readers YTHDF1 and YTHDF3. Inhibition of ITGA6 results in decreased growth and progression of bladder cancer cells in vitro and in vivo.
Responsed Disease	Bladder cancer [ICD-11: 2C94]
Target Regulator	YTH domain-containing family protein 1 (YTHDF1)		READER	Regulator Info
Pathway Response	Cell adhesion molecules			hsa04514
Cell Process	Cell adhesion
	Cell migration
	Cell invasion
In-vitro Model	5637	Bladder carcinoma	Homo sapiens	CVCL_0126
	HEK293T	Normal	Homo sapiens	CVCL_0063
	J82	Bladder carcinoma	Homo sapiens	CVCL_0359
	SV-HUC-1	Normal	Homo sapiens	CVCL_3798
	T24	Bladder carcinoma	Homo sapiens	CVCL_0554
	UM-UC-3	Bladder carcinoma	Homo sapiens	CVCL_1783
In-vivo Model	For the subcutaneous implantation model, 1 × 10⁷ cells were subcutaneously implanted into 5-week-old BALB/cJNju-Foxn1nu/Nju nude mice.
Experiment 5 Reporting the m6A-centered Disease Response				[1]
Response Summary	m6A writer METTL3 and eraser ALKBH5 altered cell adhesion by regulating Integrin alpha-6 (ITGA6) expression in bladder cancer cells. m6A is highly enriched within the ITGA6 transcripts, and increased m6A methylations of the ITGA6 mRNA 3'UTR promotes the translation of ITGA6 mRNA via binding of the m6A readers YTHDF1 and YTHDF3. Inhibition of ITGA6 results in decreased growth and progression of bladder cancer cells in vitro and in vivo.
Responsed Disease	Bladder cancer [ICD-11: 2C94]
Target Regulator	YTH domain-containing family protein 3 (YTHDF3)		READER	Regulator Info
Pathway Response	Cell adhesion molecules			hsa04514
Cell Process	Cell adhesion
	Cell migration
	Cell invasion
In-vitro Model	5637	Bladder carcinoma	Homo sapiens	CVCL_0126
	HEK293T	Normal	Homo sapiens	CVCL_0063
	J82	Bladder carcinoma	Homo sapiens	CVCL_0359
	SV-HUC-1	Normal	Homo sapiens	CVCL_3798
	T24	Bladder carcinoma	Homo sapiens	CVCL_0554
	UM-UC-3	Bladder carcinoma	Homo sapiens	CVCL_1783
In-vivo Model	For the subcutaneous implantation model, 1 × 10⁷ cells were subcutaneously implanted into 5-week-old BALB/cJNju-Foxn1nu/Nju nude mice.

Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator

Histone modification

m6A Regulator: YTH domain-containing family protein 3 (YTHDF3)

Regulator Info

In total 1 item(s) under this m6A regulator
Crosstalk ID: M6ACROT03213		Crosstalk Info
Epigenetic Regulator	Lysine-specific demethylase 5B (KDM5B)
Regulated Target	Histone H3 lysine 4 trimethylation (H3K4me3)
Crosstalk relationship	Histone modification → m6A
Disease	Liver cancer	Disease Info

Non-coding RNA

m6A Regulator: Methyltransferase-like 3 (METTL3)

Regulator Info

In total 2 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05111		Crosstalk Info
Epigenetic Regulator	hsa-miR-502-3p
Regulated Target	Ragulator complex protein LAMTOR5 (LAMTOR5/HBXIP)
Crosstalk relationship	ncRNA → m6A
Disease	Liver hepatocellular carcinoma	Disease Info
Crosstalk ID: M6ACROT05112		Crosstalk Info
Epigenetic Regulator	Small nucleolar RNA host gene 3 (SNHG3)
Regulated Target	hsa-miR-502-3p
Crosstalk relationship	ncRNA → m6A
Disease	Liver hepatocellular carcinoma	Disease Info

m6A Regulator: YTH domain-containing family protein 3 (YTHDF3)

Regulator Info

In total 2 item(s) under this m6A regulator
Crosstalk ID: M6ACROT05113		Crosstalk Info
Epigenetic Regulator	hsa-miR-502-3p
Regulated Target	YTH N6-methyladenosine RNA binding protein F3 (YTHDF3)
Crosstalk relationship	ncRNA → m6A
Disease	Liver hepatocellular carcinoma	Disease Info
Crosstalk ID: M6ACROT05114		Crosstalk Info
Epigenetic Regulator	Small nucleolar RNA host gene 3 (SNHG3)
Regulated Target	hsa-miR-502-3p
Crosstalk relationship	ncRNA → m6A
Disease	Liver hepatocellular carcinoma	Disease Info

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00297)

Integrin alpha-6 (ITGA6)

Adenosine-to-Inosine editing (A-to-I)

In total 6 m6A sequence/site(s) in this target gene
mod ID: A2ISITE010091		Click to Show/Hide the Full List
mod site	chr2:172432697-172432698:+		[7]
Sequence	GGATTTTCATGAGTGTTTGTAAATTTCACCTGGCTTTTGCC
Transcript ID List	ENST00000458358.5; ENST00000412899.5; ENST00000264107.11; rmsk_743436; ENST00000409080.6; ENST00000409532.5; ENST00000442250.5
External Link	RMBase: RNA-editing_site_81618
mod ID: A2ISITE010092		Click to Show/Hide the Full List
mod site	chr2:172442156-172442157:+		[7]
Sequence	CCTGCGTCATGTTTCTGAATAAGGAGTCCTGGTTACCGCCA
Transcript ID List	ENST00000264107.11; ENST00000409080.6; ENST00000409532.5; ENST00000458358.5; ENST00000442250.5; ENST00000412899.5
External Link	RMBase: RNA-editing_site_81619
mod ID: A2ISITE010093		Click to Show/Hide the Full List
mod site	chr2:172447472-172447473:+		[7]
Sequence	TCTCAGCCTACCAAAGTGCTACGATTACAGGTGTGAGTCAC
Transcript ID List	ENST00000458358.5; ENST00000409532.5; ENST00000264107.11; ENST00000412899.5; ENST00000442250.5; ENST00000409080.6
External Link	RMBase: RNA-editing_site_81620
mod ID: A2ISITE010094		Click to Show/Hide the Full List
mod site	chr2:172450394-172450395:+		[7]
Sequence	GTGACTCAGGCCTTTGTTTTAGGAGTTTGCAGGAGCTCAGA
Transcript ID List	ENST00000412899.5; ENST00000442250.5; ENST00000458358.5; ENST00000409080.6; ENST00000409532.5; ENST00000264107.11
External Link	RMBase: RNA-editing_site_81621
mod ID: A2ISITE010095		Click to Show/Hide the Full List
mod site	chr2:172494302-172494303:+		[8]
Sequence	GATTGCTTGAGCCCAGGAGTTAGAGACCAGCCTGGGTAACA
Transcript ID List	ENST00000442250.5; ENST00000416789.1; ENST00000264107.11; ENST00000409080.6; ENST00000458358.5; ENST00000409532.5; ENST00000475302.1; rmsk_743537
External Link	RMBase: RNA-editing_site_81622
mod ID: A2ISITE010096		Click to Show/Hide the Full List
mod site	chr2:172497350-172497351:+		[7]
Sequence	AAAAAATTTTTAAAAAAATTAGCTGTGAGTGGTGGCATGCG
Transcript ID List	ENST00000475302.1; ENST00000409532.5; ENST00000409080.6; rmsk_743541; ENST00000442250.5; ENST00000416789.1; ENST00000458358.5; ENST00000264107.11
External Link	RMBase: RNA-editing_site_81623

N6-methyladenosine (m6A)

In total 75 m6A sequence/site(s) in this target gene
mod ID: M6ASITE048021		Click to Show/Hide the Full List
mod site	chr2:172427583-172427584:+		[9]
Sequence	CGCCTGCGAGTCTCCAGAGAACAACGGGCTCATTCAGCGGT
Motif Score	2.951386905
Cell/Tissue List	HepG2; U2OS; H1A; fibroblasts; GSC-11; HEK293T; HEK293A-TOA; TREX; TIME
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000412899.5; ENST00000264107.11; ENST00000409532.5
External Link	RMBase: m6A_site_499583
mod ID: M6ASITE048022		Click to Show/Hide the Full List
mod site	chr2:172427726-172427727:+		[10]
Sequence	CAGCAGCGCGGCAGCCTCGGACCCAGCCCGGAGCGCAGGGC
Motif Score	3.622404762
Cell/Tissue List	HepG2; HeLa; A549; U2OS; H1B; H1299; Jurkat; CD4T; GSC-11; HEK293T; HEK293A-TOA; TIME; TREX; iSLK; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000412899.5; ENST00000409080.6; ENST00000409532.5; ENST00000264107.11
External Link	RMBase: m6A_site_499584
mod ID: M6ASITE048023		Click to Show/Hide the Full List
mod site	chr2:172427867-172427868:+		[11]
Sequence	CGGCGCAGCCTTCAACTTGGACACTCGGGAGGACAACGTGA
Motif Score	3.643047619
Cell/Tissue List	HeLa; HepG2; A549; U2OS; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293T; iSLK; TIME; endometrial; HEC-1-A; GSCs
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000409532.5; ENST00000458358.5; ENST00000264107.11; ENST00000409080.6; ENST00000412899.5; ENST00000442250.5
External Link	RMBase: m6A_site_499586
mod ID: M6ASITE048024		Click to Show/Hide the Full List
mod site	chr2:172427879-172427880:+		[11]
Sequence	CAACTTGGACACTCGGGAGGACAACGTGATCCGGAAATATG
Motif Score	3.643047619
Cell/Tissue List	HeLa; HepG2; A549; hESC-HEK293T; U2OS; Jurkat; CD4T; peripheral-blood; GSC-11; iSLK; TIME; endometrial; HEC-1-A; GSCs
Seq Type List	m6A-seq; MeRIP-seq; MAZTER-seq
Transcript ID List	ENST00000409080.6; ENST00000264107.11; ENST00000409532.5; ENST00000458358.5; ENST00000412899.5; ENST00000442250.5
External Link	RMBase: m6A_site_499587
mod ID: M6ASITE048025		Click to Show/Hide the Full List
mod site	chr2:172427903-172427904:+		[11]
Sequence	CGTGATCCGGAAATATGGAGACCCCGGGAGCCTCTTCGGCT
Motif Score	2.876744048
Cell/Tissue List	HeLa; HepG2; A549; CD4T; peripheral-blood; GSC-11; HEK293T; TIME; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000442250.5; ENST00000458358.5; ENST00000409532.5; ENST00000409080.6; ENST00000412899.5; ENST00000264107.11
External Link	RMBase: m6A_site_499588
mod ID: M6ASITE048026		Click to Show/Hide the Full List
mod site	chr2:172427960-172427961:+		[11]
Sequence	CTGGCAACTGCAGCCCGAGGACAAGCGGCTGTGAGTTCCCA
Motif Score	3.643047619
Cell/Tissue List	HeLa; HepG2; hESC-HEK293T; peripheral-blood; GSC-11; endometrial; HEC-1-A
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000458358.5; ENST00000442250.5; ENST00000409080.6; ENST00000264107.11; ENST00000412899.5; ENST00000409532.5
External Link	RMBase: m6A_site_499589
mod ID: M6ASITE048027		Click to Show/Hide the Full List
mod site	chr2:172469006-172469007:+		[11]
Sequence	GATCCGGTCCCAAGATGAGGACATGCTTAATCATCCTCTTT
Motif Score	3.643047619
Cell/Tissue List	HeLa; HepG2; BGC823; peripheral-blood; HEK293T; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000442250.5; ENST00000497107.1; ENST00000264107.11; ENST00000458358.5; ENST00000409532.5; ENST00000409080.6; ENST00000412899.5
External Link	RMBase: m6A_site_499604
mod ID: M6ASITE048028		Click to Show/Hide the Full List
mod site	chr2:172469076-172469077:+		[10]
Sequence	TCATATGTAATTTTTTAAAAACAAGGTTTATAGACAAGAAT
Motif Score	2.20572619
Cell/Tissue List	HepG2; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000409532.5; ENST00000497107.1; ENST00000458358.5; ENST00000412899.5; ENST00000409080.6; ENST00000442250.5; ENST00000264107.11
External Link	RMBase: m6A_site_499605
mod ID: M6ASITE048029		Click to Show/Hide the Full List
mod site	chr2:172469089-172469090:+		[10]
Sequence	TTTAAAAACAAGGTTTATAGACAAGAATGGGCTACTTTCTT
Motif Score	2.897386905
Cell/Tissue List	HepG2; endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000458358.5; ENST00000442250.5; ENST00000409080.6; ENST00000264107.11; ENST00000409532.5; ENST00000412899.5; ENST00000497107.1
External Link	RMBase: m6A_site_499606
mod ID: M6ASITE048030		Click to Show/Hide the Full List
mod site	chr2:172469124-172469125:+		[12]
Sequence	TTTCTTCCATCTGCTTGCAGACATGTGCTCACCGATATGAA
Motif Score	2.897386905
Cell/Tissue List	endometrial
Seq Type List	m6A-seq
Transcript ID List	ENST00000497107.1; ENST00000442250.5; ENST00000412899.5; ENST00000409080.6; ENST00000264107.11; ENST00000458358.5; ENST00000409532.5
External Link	RMBase: m6A_site_499607
mod ID: M6ASITE048031		Click to Show/Hide the Full List
mod site	chr2:172469182-172469183:+		[13]
Sequence	TACGAAGCAGGAATCCCGAGACATCTTTGGGCGGTGTTATG
Motif Score	2.897386905
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000458358.5; ENST00000442250.5; ENST00000497107.1; ENST00000409080.6; ENST00000412899.5; ENST00000264107.11; ENST00000409532.5
External Link	RMBase: m6A_site_499608
mod ID: M6ASITE048032		Click to Show/Hide the Full List
mod site	chr2:172469332-172469333:+		[11]
Sequence	AGCAGCTACTTTTACTAAAGACTTTCATTACATTGTATTTG
Motif Score	3.319380952
Cell/Tissue List	HeLa; HEC-1-A
Seq Type List	m6A-seq
Transcript ID List	ENST00000442250.5; ENST00000264107.11; ENST00000409080.6; ENST00000497107.1; ENST00000412899.5; ENST00000458358.5; ENST00000409532.5
External Link	RMBase: m6A_site_499609
mod ID: M6ASITE048033		Click to Show/Hide the Full List
mod site	chr2:172469341-172469342:+		[14]
Sequence	TTTTACTAAAGACTTTCATTACATTGTATTTGGAGCCCCGG
Motif Score	2.07285119
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000409532.5; ENST00000442250.5; ENST00000412899.5; ENST00000264107.11; ENST00000409080.6; ENST00000497107.1; ENST00000458358.5
External Link	RMBase: m6A_site_499610
mod ID: M6ASITE048034		Click to Show/Hide the Full List
mod site	chr2:172471000-172471001:+		[14]
Sequence	TCGTGTAGAGCAAAAGAATAACACTTTTTTTGACATGAACA
Motif Score	2.168095238
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000409532.5; ENST00000497107.1; ENST00000412899.5; ENST00000442250.5; ENST00000458358.5; ENST00000264107.11; ENST00000409080.6
External Link	RMBase: m6A_site_499611
mod ID: M6ASITE048035		Click to Show/Hide the Full List
mod site	chr2:172471018-172471019:+		[11]
Sequence	TAACACTTTTTTTGACATGAACATCTTTGAAGATGGGCCTT
Motif Score	2.951386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000442250.5; ENST00000497107.1; ENST00000264107.11; ENST00000409080.6; ENST00000458358.5; ENST00000412899.5; ENST00000409532.5
External Link	RMBase: m6A_site_499612
mod ID: M6ASITE048036		Click to Show/Hide the Full List
mod site	chr2:172471056-172471057:+		[11]
Sequence	CTTATGAAGTTGGTGGAGAGACTGAGCATGATGAAAGTCTC
Motif Score	3.319380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000264107.11; ENST00000409080.6; ENST00000458358.5; ENST00000442250.5; ENST00000497107.1; ENST00000409532.5; ENST00000412899.5
External Link	RMBase: m6A_site_499613
mod ID: M6ASITE048037		Click to Show/Hide the Full List
mod site	chr2:172474162-172474163:+		[11]
Sequence	CGTGGTTTTGCTGAAGAGAGACATGAAGTCTGCACATCTCC
Motif Score	2.897386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000412899.5; ENST00000264107.11; ENST00000442250.5; ENST00000409080.6; ENST00000458358.5; ENST00000409532.5
External Link	RMBase: m6A_site_499614
mod ID: M6ASITE048038		Click to Show/Hide the Full List
mod site	chr2:172474175-172474176:+		[15]
Sequence	AAGAGAGACATGAAGTCTGCACATCTCCTCCCTGAGCACAT
Motif Score	2.830589286
Cell/Tissue List	kidney
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000458358.5; ENST00000442250.5; ENST00000412899.5; ENST00000409080.6; ENST00000409532.5; ENST00000264107.11
External Link	RMBase: m6A_site_499615
mod ID: M6ASITE048039		Click to Show/Hide the Full List
mod site	chr2:172474249-172474250:+		[11]
Sequence	CTATGATGTGGCGGTGGTGGACCTCAACAAGGATGGGTGAG
Motif Score	3.622404762
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000458358.5; ENST00000264107.11; ENST00000442250.5; ENST00000409532.5; ENST00000409080.6; ENST00000412899.5
External Link	RMBase: m6A_site_499616
mod ID: M6ASITE048040		Click to Show/Hide the Full List
mod site	chr2:172474255-172474256:+		[14]
Sequence	TGTGGCGGTGGTGGACCTCAACAAGGATGGGTGAGAAAGCC
Motif Score	2.173910714
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000442250.5; ENST00000409080.6; ENST00000458358.5; ENST00000412899.5; ENST00000264107.11; ENST00000409532.5
External Link	RMBase: m6A_site_499617
mod ID: M6ASITE048041		Click to Show/Hide the Full List
mod site	chr2:172475008-172475009:+		[11]
Sequence	TGCAGTGTATGTCTACATGAACCAGCAAGGCAGATGGAATA
Motif Score	2.930744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000264107.11; ENST00000442250.5; ENST00000409532.5; ENST00000458358.5; ENST00000409080.6
External Link	RMBase: m6A_site_499618
mod ID: M6ASITE048042		Click to Show/Hide the Full List
mod site	chr2:172475055-172475056:+		[11]
Sequence	AGCCAATTCGTCTTAATGGAACCAAAGATTCTATGTTTGGC
Motif Score	2.930744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000264107.11; ENST00000409080.6; ENST00000458358.5; ENST00000409532.5; ENST00000442250.5
External Link	RMBase: m6A_site_499619
mod ID: M6ASITE048043		Click to Show/Hide the Full List
mod site	chr2:172475675-172475676:+		[11]
Sequence	GCAAATGGAATAAATACCAAACCAACACAGGTAACCAAATA
Motif Score	2.185083333
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000409532.5; ENST00000409080.6; ENST00000458358.5; ENST00000442250.5; ENST00000264107.11
External Link	RMBase: m6A_site_499620
mod ID: M6ASITE048044		Click to Show/Hide the Full List
mod site	chr2:172476440-172476441:+		[11]
Sequence	TGGATATTCAATTGCTGGAAACATGGACCTTGATCGAAATT
Motif Score	2.20572619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000442250.5; ENST00000264107.11; ENST00000409080.6; ENST00000409532.5; ENST00000458358.5
External Link	RMBase: m6A_site_499621
mod ID: M6ASITE048045		Click to Show/Hide the Full List
mod site	chr2:172476446-172476447:+		[11]
Sequence	TTCAATTGCTGGAAACATGGACCTTGATCGAAATTCCTACC
Motif Score	3.622404762
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000264107.11; ENST00000409532.5; ENST00000409080.6; ENST00000458358.5; ENST00000442250.5
External Link	RMBase: m6A_site_499622
mod ID: M6ASITE048046		Click to Show/Hide the Full List
mod site	chr2:172479668-172479669:+		[11]
Sequence	CTGTGATTAATATTCAGAAAACCATCACAGTAACTCCTAAC
Motif Score	2.185083333
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000458358.5; ENST00000442250.5; ENST00000264107.11; ENST00000409080.6; ENST00000409532.5
External Link	RMBase: m6A_site_499623
mod ID: M6ASITE048047		Click to Show/Hide the Full List
mod site	chr2:172479710-172479711:+		[11]
Sequence	GAATTGACCTCCGCCAGAAAACAGCGTGTGGGGCGCCTAGT
Motif Score	2.20572619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000409080.6; ENST00000458358.5; ENST00000409532.5; ENST00000264107.11; ENST00000442250.5
External Link	RMBase: m6A_site_499624
mod ID: M6ASITE048048		Click to Show/Hide the Full List
mod site	chr2:172484853-172484854:+		[11]
Sequence	CTCAAGAGTTCAGTTTCGAAACCAAGGTTCTGAGCCCAAAT
Motif Score	2.185083333
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000442250.5; ENST00000409080.6; ENST00000264107.11; ENST00000409532.5; ENST00000458358.5
External Link	RMBase: m6A_site_499625
mod ID: M6ASITE048049		Click to Show/Hide the Full List
mod site	chr2:172484884-172484885:+		[11]
Sequence	GAGCCCAAATATACTCAAGAACTAACTCTGAAGAGGCAGAA
Motif Score	3.373380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000264107.11; ENST00000409080.6; ENST00000409532.5; ENST00000442250.5; ENST00000458358.5
External Link	RMBase: m6A_site_499626
mod ID: M6ASITE048050		Click to Show/Hide the Full List
mod site	chr2:172484905-172484906:+		[11]
Sequence	CTAACTCTGAAGAGGCAGAAACAGAAAGTGTGCATGGAGGA
Motif Score	2.20572619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000442250.5; ENST00000264107.11; ENST00000458358.5; ENST00000409080.6; ENST00000409532.5
External Link	RMBase: m6A_site_499627
mod ID: M6ASITE048051		Click to Show/Hide the Full List
mod site	chr2:172484927-172484928:+		[11]
Sequence	AGAAAGTGTGCATGGAGGAAACCCTGTGGCTACAGGTGAGG
Motif Score	2.185083333
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000458358.5; ENST00000442250.5; ENST00000409080.6; ENST00000264107.11; ENST00000409532.5
External Link	RMBase: m6A_site_499628
mod ID: M6ASITE048052		Click to Show/Hide the Full List
mod site	chr2:172485137-172485138:+		[11]
Sequence	CAGGATAATATCAGAGATAAACTGCGTCCCATTCCCATAAC
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000458358.5; ENST00000442250.5; ENST00000264107.11; ENST00000409532.5; ENST00000409080.6
External Link	RMBase: m6A_site_499629
mod ID: M6ASITE048053		Click to Show/Hide the Full List
mod site	chr2:172485242-172485243:+		[11]
Sequence	CCAATTCTGAATTCAGATGAACCCAAGACAGCTCATATTGA
Motif Score	2.930744048
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000442250.5; ENST00000409532.5; ENST00000409080.6; ENST00000264107.11; ENST00000458358.5
External Link	RMBase: m6A_site_499630
mod ID: M6ASITE048054		Click to Show/Hide the Full List
mod site	chr2:172485249-172485250:+		[11]
Sequence	TGAATTCAGATGAACCCAAGACAGCTCATATTGATGTAAGT
Motif Score	2.897386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000409080.6; ENST00000264107.11; ENST00000442250.5; ENST00000409532.5; ENST00000458358.5
External Link	RMBase: m6A_site_499631
mod ID: M6ASITE048055		Click to Show/Hide the Full List
mod site	chr2:172487053-172487054:+		[14]
Sequence	AAAAGAGGGATGTGGAGACGACAATGTATGTAACAGCAACC
Motif Score	2.865571429
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000409080.6; ENST00000264107.11; ENST00000442250.5; ENST00000409532.5; ENST00000458358.5
External Link	RMBase: m6A_site_499632
mod ID: M6ASITE048056		Click to Show/Hide the Full List
mod site	chr2:172487078-172487079:+		[11]
Sequence	GTATGTAACAGCAACCTTAAACTAGAATATAAATTTTGCAC
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000409532.5; ENST00000442250.5; ENST00000409080.6; ENST00000264107.11; ENST00000458358.5
External Link	RMBase: m6A_site_499633
mod ID: M6ASITE048057		Click to Show/Hide the Full List
mod site	chr2:172487116-172487117:+		[11]
Sequence	CACCCGAGAAGGAAATCAAGACAAATTTTCTTATTTACCAA
Motif Score	2.897386905
Cell/Tissue List	HeLa; hESC-HEK293T
Seq Type List	m6A-seq; MAZTER-seq
Transcript ID List	ENST00000264107.11; ENST00000458358.5; ENST00000409532.5; ENST00000442250.5; ENST00000409080.6
External Link	RMBase: m6A_site_499634
mod ID: M6ASITE048058		Click to Show/Hide the Full List
mod site	chr2:172487281-172487282:+		[11]
Sequence	AGTCAAAAAGGTGTACCAGAACTAGTTCTAAAAGATCAGAA
Motif Score	3.373380952
Cell/Tissue List	HeLa; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000264107.11; ENST00000409532.5; ENST00000409080.6; ENST00000458358.5; ENST00000442250.5
External Link	RMBase: m6A_site_499635
mod ID: M6ASITE048059		Click to Show/Hide the Full List
mod site	chr2:172487321-172487322:+		[15]
Sequence	AGGATATTGCTTTAGAAATAACAGTGACAAACAGCCCTTCC
Motif Score	2.168095238
Cell/Tissue List	kidney
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000442250.5; ENST00000264107.11; ENST00000458358.5; ENST00000409080.6; ENST00000409532.5
External Link	RMBase: m6A_site_499636
mod ID: M6ASITE048060		Click to Show/Hide the Full List
mod site	chr2:172487331-172487332:+		[11]
Sequence	TTTAGAAATAACAGTGACAAACAGCCCTTCCAACCCAAGGA
Motif Score	2.20572619
Cell/Tissue List	HeLa; Huh7
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000409532.5; ENST00000264107.11; ENST00000458358.5; ENST00000409080.6; ENST00000442250.5
External Link	RMBase: m6A_site_499637
mod ID: M6ASITE048061		Click to Show/Hide the Full List
mod site	chr2:172489491-172489492:+		[11]
Sequence	TATTTTCTAACAGGTAATAAACTTAGGTAAACCTCTTACAA
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000264107.11; ENST00000458358.5; ENST00000416789.1; ENST00000409532.5; ENST00000469534.1; ENST00000409080.6; ENST00000442250.5
External Link	RMBase: m6A_site_499638
mod ID: M6ASITE048062		Click to Show/Hide the Full List
mod site	chr2:172489501-172489502:+		[11]
Sequence	CAGGTAATAAACTTAGGTAAACCTCTTACAAACCTCGGCAC
Motif Score	2.185083333
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000442250.5; ENST00000416789.1; ENST00000409080.6; ENST00000409532.5; ENST00000458358.5; ENST00000264107.11; ENST00000469534.1
External Link	RMBase: m6A_site_499639
mod ID: M6ASITE048063		Click to Show/Hide the Full List
mod site	chr2:172489512-172489513:+		[11]
Sequence	CTTAGGTAAACCTCTTACAAACCTCGGCACAGCAACCTTGA
Motif Score	2.185083333
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000416789.1; ENST00000409532.5; ENST00000442250.5; ENST00000458358.5; ENST00000264107.11; ENST00000469534.1; ENST00000409080.6
External Link	RMBase: m6A_site_499640
mod ID: M6ASITE048064		Click to Show/Hide the Full List
mod site	chr2:172489533-172489534:+		[11]
Sequence	CCTCGGCACAGCAACCTTGAACATTCAGTGGCCAAAAGAAA
Motif Score	2.951386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000458358.5; ENST00000409532.5; ENST00000469534.1; ENST00000416789.1; ENST00000264107.11; ENST00000409080.6; ENST00000442250.5
External Link	RMBase: m6A_site_499641
mod ID: M6ASITE048065		Click to Show/Hide the Full List
mod site	chr2:172489641-172489642:+		[11]
Sequence	TGAGCCACAAAAGGAGATAAACTCCCTGAACCTAACGGTAT
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000442250.5; ENST00000409532.5; ENST00000458358.5; ENST00000416789.1; ENST00000264107.11; ENST00000469534.1; ENST00000409080.6
External Link	RMBase: m6A_site_499642
mod ID: M6ASITE048066		Click to Show/Hide the Full List
mod site	chr2:172489706-172489707:+		[13]
Sequence	CATAAATGCAAATTAGAGAAACTAACTTGTTAGGGGAAAAT
Motif Score	2.627720238
Cell/Tissue List	Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000264107.11; ENST00000409080.6; ENST00000469534.1; ENST00000442250.5; ENST00000416789.1; ENST00000458358.5; ENST00000409532.5
External Link	RMBase: m6A_site_499643
mod ID: M6ASITE048067		Click to Show/Hide the Full List
mod site	chr2:172491116-172491117:+		[11]
Sequence	TTGCTGAAAGAAAATACCAGACTCTTGTAAGTATTTTTCAA
Motif Score	3.319380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000409532.5; ENST00000470259.1; ENST00000458358.5; ENST00000442250.5; ENST00000416789.1; ENST00000475302.1; ENST00000264107.11; ENST00000409080.6
External Link	RMBase: m6A_site_499644
mod ID: M6ASITE048068		Click to Show/Hide the Full List
mod site	chr2:172491239-172491240:+		[11]
Sequence	GAACTGTAGCGTGAACGTGAACTGTGTGAACATCAGATGCC
Motif Score	3.373380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000442250.5; ENST00000416789.1; ENST00000458358.5; ENST00000264107.11; ENST00000409080.6; ENST00000475302.1; ENST00000409532.5; ENST00000470259.1
External Link	RMBase: m6A_site_499645
mod ID: M6ASITE048069		Click to Show/Hide the Full List
mod site	chr2:172491248-172491249:+		[11]
Sequence	CGTGAACGTGAACTGTGTGAACATCAGATGCCCGCTGCGGG
Motif Score	2.951386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000458358.5; ENST00000416789.1; ENST00000442250.5; ENST00000475302.1; ENST00000409080.6; ENST00000264107.11; ENST00000470259.1; ENST00000409532.5
External Link	RMBase: m6A_site_499646
mod ID: M6ASITE048070		Click to Show/Hide the Full List
mod site	chr2:172491275-172491276:+		[11]
Sequence	ATGCCCGCTGCGGGGGCTGGACAGCAAGGCGTCTCTTATTT
Motif Score	3.643047619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000409080.6; ENST00000442250.5; ENST00000409532.5; ENST00000416789.1; ENST00000458358.5; ENST00000475302.1; ENST00000264107.11
External Link	RMBase: m6A_site_499647
mod ID: M6ASITE048071		Click to Show/Hide the Full List
mod site	chr2:172491314-172491315:+		[11]
Sequence	TTTGCGCTCGAGGTTATGGAACAGCACATTTCTAGAGGTAT
Motif Score	2.951386905
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000409080.6; ENST00000458358.5; ENST00000264107.11; ENST00000442250.5; ENST00000409532.5; ENST00000416789.1; ENST00000475302.1
External Link	RMBase: m6A_site_499648
mod ID: M6ASITE048072		Click to Show/Hide the Full List
mod site	chr2:172491435-172491436:+		[11]
Sequence	TCCAAACAGGAATATTCCAAACTGAACTACTTGGACATTCT
Motif Score	2.627720238
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000409532.5; ENST00000475302.1; ENST00000458358.5; ENST00000442250.5; ENST00000409080.6; ENST00000416789.1; ENST00000264107.11
External Link	RMBase: m6A_site_499649
mod ID: M6ASITE048073		Click to Show/Hide the Full List
mod site	chr2:172491440-172491441:+		[11]
Sequence	ACAGGAATATTCCAAACTGAACTACTTGGACATTCTCATGC
Motif Score	3.373380952
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000458358.5; ENST00000264107.11; ENST00000475302.1; ENST00000409532.5; ENST00000416789.1; ENST00000442250.5; ENST00000409080.6
External Link	RMBase: m6A_site_499650
mod ID: M6ASITE048074		Click to Show/Hide the Full List
mod site	chr2:172491449-172491450:+		[11]
Sequence	TTCCAAACTGAACTACTTGGACATTCTCATGCGAGCCTTCA
Motif Score	3.643047619
Cell/Tissue List	HeLa
Seq Type List	m6A-seq
Transcript ID List	ENST00000409532.5; ENST00000442250.5; ENST00000264107.11; ENST00000409080.6; ENST00000475302.1; ENST00000416789.1; ENST00000458358.5
External Link	RMBase: m6A_site_499651
mod ID: M6ASITE048075		Click to Show/Hide the Full List
mod site	chr2:172504209-172504210:+		[11]
Sequence	ATTGATAACCTTGAAAAAAAACAGTGGATCACAAAGTGGAA
Motif Score	2.20572619
Cell/Tissue List	HeLa; HEK293T; kidney; HepG2; U2OS; hNPCs; hESCs; fibroblasts; A549; Huh7; TIME; TREX; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq; m6A-REF-seq
Transcript ID List	ENST00000416789.1; ENST00000264107.11; ENST00000409080.6; ENST00000409532.5; ENST00000458358.5; ENST00000442250.5
External Link	RMBase: m6A_site_499658
mod ID: M6ASITE048076		Click to Show/Hide the Full List
mod site	chr2:172504288-172504289:+		[11]
Sequence	AAAAGCTTCACAGTACCCAAACTGCTTTTTCCAACTCAGAA
Motif Score	2.627720238
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; H1A; hNPCs; hESCs; fibroblasts; H1299; Huh7; Jurkat; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; TIME; TREX; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000409532.5; ENST00000409080.6; ENST00000264107.11; ENST00000416789.1
External Link	RMBase: m6A_site_499659
mod ID: M6ASITE048077		Click to Show/Hide the Full List
mod site	chr2:172504347-172504348:+		[11]
Sequence	AGCCTGCTCAATCCCTGAGGACTGATTTCAGAGTGACTACA
Motif Score	4.065041667
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; CD8T; H1299; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List	ENST00000409532.5; ENST00000409080.6; ENST00000264107.11
External Link	RMBase: m6A_site_499660
mod ID: M6ASITE048078		Click to Show/Hide the Full List
mod site	chr2:172504362-172504363:+		[16]
Sequence	TGAGGACTGATTTCAGAGTGACTACACACAGTACGAACCTA
Motif Score	3.28175
Cell/Tissue List	CD8T
Seq Type List	m6A-CLIP/IP
Transcript ID List	ENST00000409080.6; ENST00000264107.11; ENST00000409532.5
External Link	RMBase: m6A_site_499661
mod ID: M6ASITE048079		Click to Show/Hide the Full List
mod site	chr2:172504365-172504366:+		[14]
Sequence	GGACTGATTTCAGAGTGACTACACACAGTACGAACCTACAG
Motif Score	2.078666667
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000409080.6; ENST00000264107.11; ENST00000409532.5
External Link	RMBase: m6A_site_499662
mod ID: M6ASITE048080		Click to Show/Hide the Full List
mod site	chr2:172504378-172504379:+		[11]
Sequence	AGTGACTACACACAGTACGAACCTACAGTTTTAACTGTGGA
Motif Score	2.930744048
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; H1299; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000264107.11; ENST00000409080.6; ENST00000409532.5
External Link	RMBase: m6A_site_499663
mod ID: M6ASITE048081		Click to Show/Hide the Full List
mod site	chr2:172504446-172504447:+		[11]
Sequence	TTTGCACAGCCAAATTTAAAACTGTTGGAATGGATTTTTCT
Motif Score	2.627720238
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; CD8T; H1299; Huh7; Jurkat; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq; m6A-CLIP/IP
Transcript ID List	ENST00000264107.11; ENST00000409532.5; ENST00000409080.6
External Link	RMBase: m6A_site_499664
mod ID: M6ASITE048082		Click to Show/Hide the Full List
mod site	chr2:172504484-172504485:+		[16]
Sequence	TCTTTAACTGCCGTAATTTAACTTTCTGGGTTGCCTTTATT
Motif Score	2.590089286
Cell/Tissue List	A549
Seq Type List	m6A-CLIP/IP
Transcript ID List	ENST00000409532.5; ENST00000264107.11; ENST00000409080.6
External Link	RMBase: m6A_site_499665
mod ID: M6ASITE048083		Click to Show/Hide the Full List
mod site	chr2:172504680-172504681:+		[14]
Sequence	CACGTTAGCTGTCCCACATCACAAGACTATGCCATTGGGGT
Motif Score	2.047297619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000264107.11; ENST00000409080.6
External Link	RMBase: m6A_site_499666
mod ID: M6ASITE048084		Click to Show/Hide the Full List
mod site	chr2:172504685-172504686:+		[11]
Sequence	TAGCTGTCCCACATCACAAGACTATGCCATTGGGGTAGTTG
Motif Score	3.319380952
Cell/Tissue List	HeLa; HepG2; HEK293T; A549; U2OS; fibroblasts; H1299; Huh7; Jurkat; iSLK; TIME; TREX; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000264107.11; ENST00000409080.6
External Link	RMBase: m6A_site_499667
mod ID: M6ASITE048085		Click to Show/Hide the Full List
mod site	chr2:172504732-172504733:+		[11]
Sequence	AACGGAAAGTGCTGTCTTAAACTAAATGTGCAATAGAAGGT
Motif Score	2.627720238
Cell/Tissue List	HeLa; HEK293T; A549; HepG2; U2OS; H1299; Huh7; iSLK; TIME; TREX; endometrial; HEC-1-A
Seq Type List	m6A-seq; MeRIP-seq
Transcript ID List	ENST00000409080.6; ENST00000264107.11
External Link	RMBase: m6A_site_499668
mod ID: M6ASITE048086		Click to Show/Hide the Full List
mod site	chr2:172504820-172504821:+		[14]
Sequence	CCTGCTCACGTCAAATGCATACAAGTTTCATTCTCCCTTTC
Motif Score	2.110482143
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000264107.11; ENST00000409080.6
External Link	RMBase: m6A_site_499669
mod ID: M6ASITE048087		Click to Show/Hide the Full List
mod site	chr2:172505239-172505240:+		[14]
Sequence	TTTCTGGATTTCATACTGTAACATTCAGGAATTCTTGGAGA
Motif Score	2.168095238
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000264107.11; ENST00000409080.6
External Link	RMBase: m6A_site_499670
mod ID: M6ASITE048088		Click to Show/Hide the Full List
mod site	chr2:172505279-172505280:+		[17]
Sequence	AAAATGGGTTTATTCACTGAACTCTAGTGCGGTTTACTCAC
Motif Score	3.373380952
Cell/Tissue List	A549
Seq Type List	m6A-seq
Transcript ID List	ENST00000264107.11; ENST00000409080.6
External Link	RMBase: m6A_site_499671
mod ID: M6ASITE048089		Click to Show/Hide the Full List
mod site	chr2:172505324-172505325:+		[17]
Sequence	GCAAATACTGTATATTCAGGACTTGAAAGAAATGGTGAATG
Motif Score	4.065041667
Cell/Tissue List	hNPCs; A549
Seq Type List	m6A-seq; m6A-CLIP/IP
Transcript ID List	ENST00000264107.11; ENST00000409080.6
External Link	RMBase: m6A_site_499672
mod ID: M6ASITE048090		Click to Show/Hide the Full List
mod site	chr2:172505361-172505362:+		[17]
Sequence	AATGCCTATGGTGGATCCAAACTGATCCAGTATAAGACTAC
Motif Score	2.627720238
Cell/Tissue List	hNPCs
Seq Type List	m6A-seq
Transcript ID List	ENST00000409080.6; ENST00000264107.11
External Link	RMBase: m6A_site_499673
mod ID: M6ASITE048091		Click to Show/Hide the Full List
mod site	chr2:172505377-172505378:+		[17]
Sequence	CCAAACTGATCCAGTATAAGACTACTGAATCTGCTACCAAA
Motif Score	3.319380952
Cell/Tissue List	hNPCs
Seq Type List	m6A-seq
Transcript ID List	ENST00000264107.11; ENST00000409080.6
External Link	RMBase: m6A_site_499674
mod ID: M6ASITE048092		Click to Show/Hide the Full List
mod site	chr2:172505602-172505603:+		[14]
Sequence	TTTTTTAATTACCATGCTTCACAATGTTAAGTTATATGGGG
Motif Score	2.047297619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000264107.11; ENST00000409080.6
External Link	RMBase: m6A_site_499675
mod ID: M6ASITE048093		Click to Show/Hide the Full List
mod site	chr2:172505627-172505628:+		[15]
Sequence	GTTAAGTTATATGGGGAGCAACAGCAAACAGGTGCTAATTT
Motif Score	2.173910714
Cell/Tissue List	kidney
Seq Type List	m6A-REF-seq
Transcript ID List	ENST00000409080.6; ENST00000264107.11
External Link	RMBase: m6A_site_499676
mod ID: M6ASITE048094		Click to Show/Hide the Full List
mod site	chr2:172506015-172506016:+		[14]
Sequence	GAGGGTGGTTCAACAAAGAAACAAAGATGTTATGGTGTTTA
Motif Score	2.20572619
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000264107.11; ENST00000409080.6
External Link	RMBase: m6A_site_499677
mod ID: M6ASITE048095		Click to Show/Hide the Full List
mod site	chr2:172506095-172506096:+		[14]
Sequence	CTGGTCTGTTTGCATTTGATACATTTTTGTACTAACTAGCA
Motif Score	2.110482143
Cell/Tissue List	hESC-HEK293T
Seq Type List	MAZTER-seq
Transcript ID List	ENST00000409080.6; ENST00000264107.11
External Link	RMBase: m6A_site_499678

Ref 1	N(6)-methyladenosine modification of ITGA6 mRNA promotes the development and progression of bladder cancer. EBioMedicine. 2019 Sep;47:195-207. doi: 10.1016/j.ebiom.2019.07.068. Epub 2019 Aug 10.
Ref 2	The tumor-suppressive effects of alpha-ketoglutarate-dependent dioxygenase FTO via N6-methyladenosine RNA methylation on bladder cancer patients. Bioengineered. 2021 Dec;12(1):5323-5333. doi: 10.1080/21655979.2021.1964893.
Ref 3	KDM5B promotes self-renewal of hepatocellular carcinoma cells through the microRNA-448-mediated YTHDF3/ITGA6 axis. J Cell Mol Med. 2021 Apr 7;25(13):5949-62. doi: 10.1111/jcmm.16342. Online ahead of print.
Ref 4	Azapeptides structurally based upon inhibitory sites of cystatins as potent and selective inhibitors of cysteine proteases. J Med Chem. 2002 Sep 12;45(19):4202-11. doi: 10.1021/jm020850k.
Ref 5	A potent, selective inhibitor of matrix metalloproteinase-3 for the topical treatment of chronic dermal ulcers. J Med Chem. 2003 Jul 31;46(16):3514-25. doi: 10.1021/jm0308038.
Ref 6	MicroPET/CT Imaging of AXL Downregulation by HSP90 Inhibition in Triple-Negative Breast Cancer. Contrast Media Mol Imaging. 2017 May 14;2017:1686525. doi: 10.1155/2017/1686525. eCollection 2017.
Ref 7	RADAR: a rigorously annotated database of A-to-I RNA editing. Nucleic Acids Res. 2014 Jan;42(Database issue):D109-13. doi: 10.1093/nar/gkt996. Epub 2013 Oct 25.
Ref 8	Comprehensive analysis of RNA-Seq data reveals extensive RNA editing in a human transcriptome. Nat Biotechnol. 2012 Feb 12;30(3):253-60. doi: 10.1038/nbt.2122.
Ref 9	Efficacy of MEK inhibition in patients with histiocytic neoplasms. Nature. 2019 Mar;567(7749):521-524. doi: 10.1038/s41586-019-1012-y. Epub 2019 Mar 13.
Ref 10	Histone H3 trimethylation at lysine 36 guides m(6)A RNA modification co-transcriptionally. Nature. 2019 Mar;567(7748):414-419. doi: 10.1038/s41586-019-1016-7. Epub 2019 Mar 13.
Ref 11	VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018 Feb 27;4:10. doi: 10.1038/s41421-018-0019-0. eCollection 2018.
Ref 12	m(6)A mRNA methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer. Nat Cell Biol. 2018 Sep;20(9):1074-1083. doi: 10.1038/s41556-018-0174-4. Epub 2018 Aug 27.
Ref 13	N6-Methyladenosine in Flaviviridae Viral RNA Genomes Regulates Infection. Cell Host Microbe. 2016 Nov 9;20(5):654-665. doi: 10.1016/j.chom.2016.09.015. Epub 2016 Oct 20.
Ref 14	Deciphering the "m(6)A Code" via Antibody-Independent Quantitative Profiling. Cell. 2019 Jul 25;178(3):731-747.e16. doi: 10.1016/j.cell.2019.06.013. Epub 2019 Jun 27.
Ref 15	Single-base mapping of m(6)A by an antibody-independent method. Sci Adv. 2019 Jul 3;5(7):eaax0250. doi: 10.1126/sciadv.aax0250. eCollection 2019 Jul.
Ref 16	A majority of m6A residues are in the last exons, allowing the potential for 3' UTR regulation. Genes Dev. 2015 Oct 1;29(19):2037-53. doi: 10.1101/gad.269415.115. Epub 2015 Sep 24.
Ref 17	Perturbation of m6A writers reveals two distinct classes of mRNA methylation at internal and 5' sites. Cell Rep. 2014 Jul 10;8(1):284-96. doi: 10.1016/j.celrep.2014.05.048. Epub 2014 Jun 26.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map