m6A Target Gene Information
General Information of the m6A Target Gene (ID: M6ATAR00297)
Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)
ITGA6
can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).
Browse Regulator
Browse Disease
YTH domain-containing family protein 1 (YTHDF1) [READER]
| Representative RNA-seq result indicating the expression of this target gene regulated by YTHDF1 | ||
| Cell Line | AGS cell line | Homo sapiens |
|
Treatment: shYTHDF1 AGS
Control: shControl AGS
|
GSE159425 | |
| Regulation |
![]() ![]() |
logFC: -9.21E-01 p-value: 3.27E-05 |
| More Results | Click to View More RNA-seq Results | |
| Representative RIP-seq result supporting the interaction between ITGA6 and the regulator | ||
| Cell Line | Hela | Homo sapiens |
| Regulation | logFC: 2.14E+00 | GSE63591 |
| In total 1 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [1] | |||
| Response Summary | m6A writer METTL3 and eraser ALKBH5 altered cell adhesion by regulating Integrin alpha-6 (ITGA6) expression in bladder cancer cells. m6A is highly enriched within the ITGA6 transcripts, and increased m6A methylations of the ITGA6 mRNA 3'UTR promotes the translation of ITGA6 mRNA via binding of the m6A readers YTHDF1 and YTHDF3. Inhibition of ITGA6 results in decreased growth and progression of bladder cancer cells in vitro and in vivo. | |||
| Responsed Disease | Bladder cancer | ICD-11: 2C94 | ||
| Pathway Response | Cell adhesion molecules | hsa04514 | ||
| Cell Process | Cell adhesion | |||
| Cell migration | ||||
| Cell invasion | ||||
| In-vitro Model | 5637 | Bladder carcinoma | Homo sapiens | CVCL_0126 |
| HEK293T | Normal | Homo sapiens | CVCL_0063 | |
| J82 | Bladder carcinoma | Homo sapiens | CVCL_0359 | |
| SV-HUC-1 | Normal | Homo sapiens | CVCL_3798 | |
| T24 | Bladder carcinoma | Homo sapiens | CVCL_0554 | |
| UM-UC-3 | Bladder carcinoma | Homo sapiens | CVCL_1783 | |
| In-vivo Model | For the subcutaneous implantation model, 1 × 107 cells were subcutaneously implanted into 5-week-old BALB/cJNju-Foxn1nu/Nju nude mice. | |||
Fat mass and obesity-associated protein (FTO) [ERASER]
| Representative RNA-seq result indicating the expression of this target gene regulated by FTO | ||
| Cell Line | 253J cell line | Homo sapiens |
|
Treatment: siFTO 253J cells
Control: 253J cells
|
GSE150239 | |
| Regulation |
![]() ![]() |
logFC: 5.89E-01 p-value: 3.48E-07 |
| More Results | Click to View More RNA-seq Results | |
| In total 1 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [2] | |||
| Response Summary | In bladder cancer, the changes in m6A methylation level mainly appeared at 5' untranslated region (5' UTR) of MALAT1 and NOTCH1 transcripts, and at 3' UTR of CSNK2A2 and Integrin alpha-6 (ITGA6) transcripts, responding to the overexpression of FTO. SFPQ could influence the FTO-mediated m6A RNA demethylation, eventually affecting the gene expression. | |||
| Target Regulation | Up regulation | |||
| Responsed Disease | Bladder cancer | ICD-11: 2C94 | ||
| Pathway Response | Notch signaling pathway | hsa04330 | ||
| Cell Process | Cell proliferation | |||
| Cell invasion | ||||
| Cell apoptosis | ||||
| In-vitro Model | HT-1197 | Recurrent bladder carcinoma | Homo sapiens | CVCL_1291 |
| HT-1376 | Bladder carcinoma | Homo sapiens | CVCL_1292 | |
| In-vivo Model | BALB/cnu/nu mice (4-5 weeks old) were used for the xenograft experiment. The mice were randomly divided into 2 groups (n = 6 for each group) and injected with 5 × 106 HT-1197 cells in control group or FTO plasmid group, respectively. | |||
Methyltransferase-like 3 (METTL3) [WRITER]
| Representative RNA-seq result indicating the expression of this target gene regulated by METTL3 | ||
| Cell Line | MOLM-13 cell line | Homo sapiens |
|
Treatment: shMETTL3 MOLM13 cells
Control: MOLM13 cells
|
GSE98623 | |
| Regulation |
![]() ![]() |
logFC: -2.38E+00 p-value: 1.75E-72 |
| More Results | Click to View More RNA-seq Results | |
| In total 1 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [1] | |||
| Response Summary | m6A writer METTL3 and eraser ALKBH5 altered cell adhesion by regulating Integrin alpha-6 (ITGA6) expression in bladder cancer cells. m6A is highly enriched within the ITGA6 transcripts, and increased m6A methylations of the ITGA6 mRNA 3'UTR promotes the translation of ITGA6 mRNA via binding of the m6A readers YTHDF1 and YTHDF3. Inhibition of ITGA6 results in decreased growth and progression of bladder cancer cells in vitro and in vivo. | |||
| Target Regulation | Up regulation | |||
| Responsed Disease | Bladder cancer | ICD-11: 2C94 | ||
| Pathway Response | Cell adhesion molecules | hsa04514 | ||
| Cell Process | Cell adhesion | |||
| Cell migration | ||||
| Cell invasion | ||||
| In-vitro Model | 5637 | Bladder carcinoma | Homo sapiens | CVCL_0126 |
| HEK293T | Normal | Homo sapiens | CVCL_0063 | |
| J82 | Bladder carcinoma | Homo sapiens | CVCL_0359 | |
| SV-HUC-1 | Normal | Homo sapiens | CVCL_3798 | |
| T24 | Bladder carcinoma | Homo sapiens | CVCL_0554 | |
| UM-UC-3 | Bladder carcinoma | Homo sapiens | CVCL_1783 | |
| In-vivo Model | For the subcutaneous implantation model, 1 × 107 cells were subcutaneously implanted into 5-week-old BALB/cJNju-Foxn1nu/Nju nude mice. | |||
YTH domain-containing family protein 3 (YTHDF3) [READER]
| Representative RIP-seq result supporting the interaction between ITGA6 and the regulator | ||
| Cell Line | Hela | Homo sapiens |
| Regulation | logFC: 1.67E+00 | GSE86214 |
| In total 2 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [3] | |||
| Response Summary | KDM5B regulates the YTHDF3/ITGA6 axis by inhibiting the expression of miR-448 to promote the occurrence of hepatocellular carcinoma. miR-448 could target YTHDF3 and inhibit the YTHDF3/Integrin alpha-6 (ITGA6) axis, thereby inhibiting the occurrence of HCC. | |||
| Responsed Disease | Hepatocellular carcinoma | ICD-11: 2C12.02 | ||
| Cell Process | Cell proliferation | |||
| Cell migration | ||||
| Cell invasion | ||||
| Cell apoptosis | ||||
| In-vitro Model | HEK293T | Normal | Homo sapiens | CVCL_0063 |
| Hep 3B2.1-7 | Childhood hepatocellular carcinoma | Homo sapiens | CVCL_0326 | |
| SMMC-7721 | Endocervical adenocarcinoma | Homo sapiens | CVCL_0534 | |
| In-vivo Model | HCC cells (5 × 106 cells/mouse) that had been transfected with oe-NC + sh-NC, oe-KDM5B + sh-NC, or oe-KDM5B + sh-ITGA6, or treated with NS, GSK-467 (a selective inhibitor of KDM5B) + oe-NC or GSK-467 + oe-ITGA6 were then subcutaneously implanted into the back of mice. | |||
| Experiment 2 Reporting the m6A Methylation Regulator of This Target Gene | [1] | |||
| Response Summary | m6A writer METTL3 and eraser ALKBH5 altered cell adhesion by regulating Integrin alpha-6 (ITGA6) expression in bladder cancer cells. m6A is highly enriched within the ITGA6 transcripts, and increased m6A methylations of the ITGA6 mRNA 3'UTR promotes the translation of ITGA6 mRNA via binding of the m6A readers YTHDF1 and YTHDF3. Inhibition of ITGA6 results in decreased growth and progression of bladder cancer cells in vitro and in vivo. | |||
| Responsed Disease | Bladder cancer | ICD-11: 2C94 | ||
| Pathway Response | Cell adhesion molecules | hsa04514 | ||
| Cell Process | Cell adhesion | |||
| Cell migration | ||||
| Cell invasion | ||||
| In-vitro Model | 5637 | Bladder carcinoma | Homo sapiens | CVCL_0126 |
| HEK293T | Normal | Homo sapiens | CVCL_0063 | |
| J82 | Bladder carcinoma | Homo sapiens | CVCL_0359 | |
| SV-HUC-1 | Normal | Homo sapiens | CVCL_3798 | |
| T24 | Bladder carcinoma | Homo sapiens | CVCL_0554 | |
| UM-UC-3 | Bladder carcinoma | Homo sapiens | CVCL_1783 | |
| In-vivo Model | For the subcutaneous implantation model, 1 × 107 cells were subcutaneously implanted into 5-week-old BALB/cJNju-Foxn1nu/Nju nude mice. | |||
RNA demethylase ALKBH5 (ALKBH5) [ERASER]
| In total 1 item(s) under this regulator | ||||
| Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene | [1] | |||
| Response Summary | m6A writer METTL3 and eraser ALKBH5 altered cell adhesion by regulating Integrin alpha-6 (ITGA6) expression in bladder cancer cells. m6A is highly enriched within the ITGA6 transcripts, and increased m6A methylations of the ITGA6 mRNA 3'UTR promotes the translation of ITGA6 mRNA via binding of the m6A readers YTHDF1 and YTHDF3. Inhibition of ITGA6 results in decreased growth and progression of bladder cancer cells in vitro and in vivo. | |||
| Responsed Disease | Bladder cancer | ICD-11: 2C94 | ||
| Pathway Response | Cell adhesion molecules | hsa04514 | ||
| Cell Process | Cell adhesion | |||
| Cell migration | ||||
| Cell invasion | ||||
| In-vitro Model | 5637 | Bladder carcinoma | Homo sapiens | CVCL_0126 |
| HEK293T | Normal | Homo sapiens | CVCL_0063 | |
| J82 | Bladder carcinoma | Homo sapiens | CVCL_0359 | |
| SV-HUC-1 | Normal | Homo sapiens | CVCL_3798 | |
| T24 | Bladder carcinoma | Homo sapiens | CVCL_0554 | |
| UM-UC-3 | Bladder carcinoma | Homo sapiens | CVCL_1783 | |
| In-vivo Model | For the subcutaneous implantation model, 1 × 107 cells were subcutaneously implanted into 5-week-old BALB/cJNju-Foxn1nu/Nju nude mice. | |||
Liver cancer [ICD-11: 2C12]
| In total 1 item(s) under this disease | ||||
| Experiment 1 Reporting the m6A-centered Disease Response | [3] | |||
| Response Summary | KDM5B regulates the YTHDF3/ITGA6 axis by inhibiting the expression of miR-448 to promote the occurrence of hepatocellular carcinoma. miR-448 could target YTHDF3 and inhibit the YTHDF3/Integrin alpha-6 (ITGA6) axis, thereby inhibiting the occurrence of HCC. | |||
| Responsed Disease | Hepatocellular carcinoma [ICD-11: 2C12.02] | |||
| Target Regulator | YTH domain-containing family protein 3 (YTHDF3) | READER | ||
| Cell Process | Cell proliferation | |||
| Cell migration | ||||
| Cell invasion | ||||
| Cell apoptosis | ||||
| In-vitro Model | HEK293T | Normal | Homo sapiens | CVCL_0063 |
| Hep 3B2.1-7 | Childhood hepatocellular carcinoma | Homo sapiens | CVCL_0326 | |
| SMMC-7721 | Endocervical adenocarcinoma | Homo sapiens | CVCL_0534 | |
| In-vivo Model | HCC cells (5 × 106 cells/mouse) that had been transfected with oe-NC + sh-NC, oe-KDM5B + sh-NC, or oe-KDM5B + sh-ITGA6, or treated with NS, GSK-467 (a selective inhibitor of KDM5B) + oe-NC or GSK-467 + oe-ITGA6 were then subcutaneously implanted into the back of mice. | |||
Bladder cancer [ICD-11: 2C94]
| In total 5 item(s) under this disease | ||||
| Experiment 1 Reporting the m6A-centered Disease Response | [2] | |||
| Response Summary | In bladder cancer, the changes in m6A methylation level mainly appeared at 5' untranslated region (5' UTR) of MALAT1 and NOTCH1 transcripts, and at 3' UTR of CSNK2A2 and Integrin alpha-6 (ITGA6) transcripts, responding to the overexpression of FTO. SFPQ could influence the FTO-mediated m6A RNA demethylation, eventually affecting the gene expression. | |||
| Responsed Disease | Bladder cancer [ICD-11: 2C94] | |||
| Target Regulator | Fat mass and obesity-associated protein (FTO) | ERASER | ||
| Target Regulation | Up regulation | |||
| Pathway Response | Notch signaling pathway | hsa04330 | ||
| Cell Process | Cell proliferation | |||
| Cell invasion | ||||
| Cell apoptosis | ||||
| In-vitro Model | HT-1197 | Recurrent bladder carcinoma | Homo sapiens | CVCL_1291 |
| HT-1376 | Bladder carcinoma | Homo sapiens | CVCL_1292 | |
| In-vivo Model | BALB/cnu/nu mice (4-5 weeks old) were used for the xenograft experiment. The mice were randomly divided into 2 groups (n = 6 for each group) and injected with 5 × 106 HT-1197 cells in control group or FTO plasmid group, respectively. | |||
| Experiment 2 Reporting the m6A-centered Disease Response | [1] | |||
| Response Summary | m6A writer METTL3 and eraser ALKBH5 altered cell adhesion by regulating Integrin alpha-6 (ITGA6) expression in bladder cancer cells. m6A is highly enriched within the ITGA6 transcripts, and increased m6A methylations of the ITGA6 mRNA 3'UTR promotes the translation of ITGA6 mRNA via binding of the m6A readers YTHDF1 and YTHDF3. Inhibition of ITGA6 results in decreased growth and progression of bladder cancer cells in vitro and in vivo. | |||
| Responsed Disease | Bladder cancer [ICD-11: 2C94] | |||
| Target Regulator | Methyltransferase-like 3 (METTL3) | WRITER | ||
| Target Regulation | Up regulation | |||
| Pathway Response | Cell adhesion molecules | hsa04514 | ||
| Cell Process | Cell adhesion | |||
| Cell migration | ||||
| Cell invasion | ||||
| In-vitro Model | 5637 | Bladder carcinoma | Homo sapiens | CVCL_0126 |
| HEK293T | Normal | Homo sapiens | CVCL_0063 | |
| J82 | Bladder carcinoma | Homo sapiens | CVCL_0359 | |
| SV-HUC-1 | Normal | Homo sapiens | CVCL_3798 | |
| T24 | Bladder carcinoma | Homo sapiens | CVCL_0554 | |
| UM-UC-3 | Bladder carcinoma | Homo sapiens | CVCL_1783 | |
| In-vivo Model | For the subcutaneous implantation model, 1 × 107 cells were subcutaneously implanted into 5-week-old BALB/cJNju-Foxn1nu/Nju nude mice. | |||
| Experiment 3 Reporting the m6A-centered Disease Response | [1] | |||
| Response Summary | m6A writer METTL3 and eraser ALKBH5 altered cell adhesion by regulating Integrin alpha-6 (ITGA6) expression in bladder cancer cells. m6A is highly enriched within the ITGA6 transcripts, and increased m6A methylations of the ITGA6 mRNA 3'UTR promotes the translation of ITGA6 mRNA via binding of the m6A readers YTHDF1 and YTHDF3. Inhibition of ITGA6 results in decreased growth and progression of bladder cancer cells in vitro and in vivo. | |||
| Responsed Disease | Bladder cancer [ICD-11: 2C94] | |||
| Target Regulator | RNA demethylase ALKBH5 (ALKBH5) | ERASER | ||
| Pathway Response | Cell adhesion molecules | hsa04514 | ||
| Cell Process | Cell adhesion | |||
| Cell migration | ||||
| Cell invasion | ||||
| In-vitro Model | 5637 | Bladder carcinoma | Homo sapiens | CVCL_0126 |
| HEK293T | Normal | Homo sapiens | CVCL_0063 | |
| J82 | Bladder carcinoma | Homo sapiens | CVCL_0359 | |
| SV-HUC-1 | Normal | Homo sapiens | CVCL_3798 | |
| T24 | Bladder carcinoma | Homo sapiens | CVCL_0554 | |
| UM-UC-3 | Bladder carcinoma | Homo sapiens | CVCL_1783 | |
| In-vivo Model | For the subcutaneous implantation model, 1 × 107 cells were subcutaneously implanted into 5-week-old BALB/cJNju-Foxn1nu/Nju nude mice. | |||
| Experiment 4 Reporting the m6A-centered Disease Response | [1] | |||
| Response Summary | m6A writer METTL3 and eraser ALKBH5 altered cell adhesion by regulating Integrin alpha-6 (ITGA6) expression in bladder cancer cells. m6A is highly enriched within the ITGA6 transcripts, and increased m6A methylations of the ITGA6 mRNA 3'UTR promotes the translation of ITGA6 mRNA via binding of the m6A readers YTHDF1 and YTHDF3. Inhibition of ITGA6 results in decreased growth and progression of bladder cancer cells in vitro and in vivo. | |||
| Responsed Disease | Bladder cancer [ICD-11: 2C94] | |||
| Target Regulator | YTH domain-containing family protein 1 (YTHDF1) | READER | ||
| Pathway Response | Cell adhesion molecules | hsa04514 | ||
| Cell Process | Cell adhesion | |||
| Cell migration | ||||
| Cell invasion | ||||
| In-vitro Model | 5637 | Bladder carcinoma | Homo sapiens | CVCL_0126 |
| HEK293T | Normal | Homo sapiens | CVCL_0063 | |
| J82 | Bladder carcinoma | Homo sapiens | CVCL_0359 | |
| SV-HUC-1 | Normal | Homo sapiens | CVCL_3798 | |
| T24 | Bladder carcinoma | Homo sapiens | CVCL_0554 | |
| UM-UC-3 | Bladder carcinoma | Homo sapiens | CVCL_1783 | |
| In-vivo Model | For the subcutaneous implantation model, 1 × 107 cells were subcutaneously implanted into 5-week-old BALB/cJNju-Foxn1nu/Nju nude mice. | |||
| Experiment 5 Reporting the m6A-centered Disease Response | [1] | |||
| Response Summary | m6A writer METTL3 and eraser ALKBH5 altered cell adhesion by regulating Integrin alpha-6 (ITGA6) expression in bladder cancer cells. m6A is highly enriched within the ITGA6 transcripts, and increased m6A methylations of the ITGA6 mRNA 3'UTR promotes the translation of ITGA6 mRNA via binding of the m6A readers YTHDF1 and YTHDF3. Inhibition of ITGA6 results in decreased growth and progression of bladder cancer cells in vitro and in vivo. | |||
| Responsed Disease | Bladder cancer [ICD-11: 2C94] | |||
| Target Regulator | YTH domain-containing family protein 3 (YTHDF3) | READER | ||
| Pathway Response | Cell adhesion molecules | hsa04514 | ||
| Cell Process | Cell adhesion | |||
| Cell migration | ||||
| Cell invasion | ||||
| In-vitro Model | 5637 | Bladder carcinoma | Homo sapiens | CVCL_0126 |
| HEK293T | Normal | Homo sapiens | CVCL_0063 | |
| J82 | Bladder carcinoma | Homo sapiens | CVCL_0359 | |
| SV-HUC-1 | Normal | Homo sapiens | CVCL_3798 | |
| T24 | Bladder carcinoma | Homo sapiens | CVCL_0554 | |
| UM-UC-3 | Bladder carcinoma | Homo sapiens | CVCL_1783 | |
| In-vivo Model | For the subcutaneous implantation model, 1 × 107 cells were subcutaneously implanted into 5-week-old BALB/cJNju-Foxn1nu/Nju nude mice. | |||
Full List of Crosstalk(s) between m6A Modification and Epigenetic Regulation Related to This Regulator
Histone modification
m6A Regulator: YTH domain-containing family protein 3 (YTHDF3)
| In total 1 item(s) under this m6A regulator | ||
| Crosstalk ID: M6ACROT03213 | ||
| Epigenetic Regulator | Lysine-specific demethylase 5B (KDM5B) | |
| Regulated Target | Histone H3 lysine 4 trimethylation (H3K4me3) | |
| Crosstalk relationship | Histone modification → m6A | |
| Disease | Liver cancer | |
Non-coding RNA
m6A Regulator: Methyltransferase-like 3 (METTL3)
| In total 2 item(s) under this m6A regulator | ||
| Crosstalk ID: M6ACROT05111 | ||
| Epigenetic Regulator | hsa-miR-502-3p | |
| Regulated Target | Ragulator complex protein LAMTOR5 (LAMTOR5/HBXIP) | |
| Crosstalk relationship | ncRNA → m6A | |
| Disease | Liver hepatocellular carcinoma | |
| Crosstalk ID: M6ACROT05112 | ||
| Epigenetic Regulator | Small nucleolar RNA host gene 3 (SNHG3) | |
| Regulated Target | hsa-miR-502-3p | |
| Crosstalk relationship | ncRNA → m6A | |
| Disease | Liver hepatocellular carcinoma | |
m6A Regulator: YTH domain-containing family protein 3 (YTHDF3)
| In total 2 item(s) under this m6A regulator | ||
| Crosstalk ID: M6ACROT05113 | ||
| Epigenetic Regulator | hsa-miR-502-3p | |
| Regulated Target | YTH N6-methyladenosine RNA binding protein F3 (YTHDF3) | |
| Crosstalk relationship | ncRNA → m6A | |
| Disease | Liver hepatocellular carcinoma | |
| Crosstalk ID: M6ACROT05114 | ||
| Epigenetic Regulator | Small nucleolar RNA host gene 3 (SNHG3) | |
| Regulated Target | hsa-miR-502-3p | |
| Crosstalk relationship | ncRNA → m6A | |
| Disease | Liver hepatocellular carcinoma | |
RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00297)
| In total 6 m6A sequence/site(s) in this target gene | |||
| mod ID: A2ISITE010091 | Click to Show/Hide the Full List | ||
| mod site | chr2:172432697-172432698:+ | [7] | |
| Sequence | GGATTTTCATGAGTGTTTGTAAATTTCACCTGGCTTTTGCC | ||
| Transcript ID List | ENST00000458358.5; ENST00000412899.5; ENST00000264107.11; rmsk_743436; ENST00000409080.6; ENST00000409532.5; ENST00000442250.5 | ||
| External Link | RMBase: RNA-editing_site_81618 | ||
| mod ID: A2ISITE010092 | Click to Show/Hide the Full List | ||
| mod site | chr2:172442156-172442157:+ | [7] | |
| Sequence | CCTGCGTCATGTTTCTGAATAAGGAGTCCTGGTTACCGCCA | ||
| Transcript ID List | ENST00000264107.11; ENST00000409080.6; ENST00000409532.5; ENST00000458358.5; ENST00000442250.5; ENST00000412899.5 | ||
| External Link | RMBase: RNA-editing_site_81619 | ||
| mod ID: A2ISITE010093 | Click to Show/Hide the Full List | ||
| mod site | chr2:172447472-172447473:+ | [7] | |
| Sequence | TCTCAGCCTACCAAAGTGCTACGATTACAGGTGTGAGTCAC | ||
| Transcript ID List | ENST00000458358.5; ENST00000409532.5; ENST00000264107.11; ENST00000412899.5; ENST00000442250.5; ENST00000409080.6 | ||
| External Link | RMBase: RNA-editing_site_81620 | ||
| mod ID: A2ISITE010094 | Click to Show/Hide the Full List | ||
| mod site | chr2:172450394-172450395:+ | [7] | |
| Sequence | GTGACTCAGGCCTTTGTTTTAGGAGTTTGCAGGAGCTCAGA | ||
| Transcript ID List | ENST00000412899.5; ENST00000442250.5; ENST00000458358.5; ENST00000409080.6; ENST00000409532.5; ENST00000264107.11 | ||
| External Link | RMBase: RNA-editing_site_81621 | ||
| mod ID: A2ISITE010095 | Click to Show/Hide the Full List | ||
| mod site | chr2:172494302-172494303:+ | [8] | |
| Sequence | GATTGCTTGAGCCCAGGAGTTAGAGACCAGCCTGGGTAACA | ||
| Transcript ID List | ENST00000442250.5; ENST00000416789.1; ENST00000264107.11; ENST00000409080.6; ENST00000458358.5; ENST00000409532.5; ENST00000475302.1; rmsk_743537 | ||
| External Link | RMBase: RNA-editing_site_81622 | ||
| mod ID: A2ISITE010096 | Click to Show/Hide the Full List | ||
| mod site | chr2:172497350-172497351:+ | [7] | |
| Sequence | AAAAAATTTTTAAAAAAATTAGCTGTGAGTGGTGGCATGCG | ||
| Transcript ID List | ENST00000475302.1; ENST00000409532.5; ENST00000409080.6; rmsk_743541; ENST00000442250.5; ENST00000416789.1; ENST00000458358.5; ENST00000264107.11 | ||
| External Link | RMBase: RNA-editing_site_81623 | ||
N6-methyladenosine (m6A)
| In total 75 m6A sequence/site(s) in this target gene | |||
| mod ID: M6ASITE048021 | Click to Show/Hide the Full List | ||
| mod site | chr2:172427583-172427584:+ | [9] | |
| Sequence | CGCCTGCGAGTCTCCAGAGAACAACGGGCTCATTCAGCGGT | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HepG2; U2OS; H1A; fibroblasts; GSC-11; HEK293T; HEK293A-TOA; TREX; TIME | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000412899.5; ENST00000264107.11; ENST00000409532.5 | ||
| External Link | RMBase: m6A_site_499583 | ||
| mod ID: M6ASITE048022 | Click to Show/Hide the Full List | ||
| mod site | chr2:172427726-172427727:+ | [10] | |
| Sequence | CAGCAGCGCGGCAGCCTCGGACCCAGCCCGGAGCGCAGGGC | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HepG2; HeLa; A549; U2OS; H1B; H1299; Jurkat; CD4T; GSC-11; HEK293T; HEK293A-TOA; TIME; TREX; iSLK; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000412899.5; ENST00000409080.6; ENST00000409532.5; ENST00000264107.11 | ||
| External Link | RMBase: m6A_site_499584 | ||
| mod ID: M6ASITE048023 | Click to Show/Hide the Full List | ||
| mod site | chr2:172427867-172427868:+ | [11] | |
| Sequence | CGGCGCAGCCTTCAACTTGGACACTCGGGAGGACAACGTGA | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; HepG2; A549; U2OS; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293T; iSLK; TIME; endometrial; HEC-1-A; GSCs | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000409532.5; ENST00000458358.5; ENST00000264107.11; ENST00000409080.6; ENST00000412899.5; ENST00000442250.5 | ||
| External Link | RMBase: m6A_site_499586 | ||
| mod ID: M6ASITE048024 | Click to Show/Hide the Full List | ||
| mod site | chr2:172427879-172427880:+ | [11] | |
| Sequence | CAACTTGGACACTCGGGAGGACAACGTGATCCGGAAATATG | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; HepG2; A549; hESC-HEK293T; U2OS; Jurkat; CD4T; peripheral-blood; GSC-11; iSLK; TIME; endometrial; HEC-1-A; GSCs | ||
| Seq Type List | m6A-seq; MeRIP-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000409080.6; ENST00000264107.11; ENST00000409532.5; ENST00000458358.5; ENST00000412899.5; ENST00000442250.5 | ||
| External Link | RMBase: m6A_site_499587 | ||
| mod ID: M6ASITE048025 | Click to Show/Hide the Full List | ||
| mod site | chr2:172427903-172427904:+ | [11] | |
| Sequence | CGTGATCCGGAAATATGGAGACCCCGGGAGCCTCTTCGGCT | ||
| Motif Score | 2.876744048 | ||
| Cell/Tissue List | HeLa; HepG2; A549; CD4T; peripheral-blood; GSC-11; HEK293T; TIME; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000442250.5; ENST00000458358.5; ENST00000409532.5; ENST00000409080.6; ENST00000412899.5; ENST00000264107.11 | ||
| External Link | RMBase: m6A_site_499588 | ||
| mod ID: M6ASITE048026 | Click to Show/Hide the Full List | ||
| mod site | chr2:172427960-172427961:+ | [11] | |
| Sequence | CTGGCAACTGCAGCCCGAGGACAAGCGGCTGTGAGTTCCCA | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; HepG2; hESC-HEK293T; peripheral-blood; GSC-11; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000458358.5; ENST00000442250.5; ENST00000409080.6; ENST00000264107.11; ENST00000412899.5; ENST00000409532.5 | ||
| External Link | RMBase: m6A_site_499589 | ||
| mod ID: M6ASITE048027 | Click to Show/Hide the Full List | ||
| mod site | chr2:172469006-172469007:+ | [11] | |
| Sequence | GATCCGGTCCCAAGATGAGGACATGCTTAATCATCCTCTTT | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa; HepG2; BGC823; peripheral-blood; HEK293T; endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000442250.5; ENST00000497107.1; ENST00000264107.11; ENST00000458358.5; ENST00000409532.5; ENST00000409080.6; ENST00000412899.5 | ||
| External Link | RMBase: m6A_site_499604 | ||
| mod ID: M6ASITE048028 | Click to Show/Hide the Full List | ||
| mod site | chr2:172469076-172469077:+ | [10] | |
| Sequence | TCATATGTAATTTTTTAAAAACAAGGTTTATAGACAAGAAT | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HepG2; endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000409532.5; ENST00000497107.1; ENST00000458358.5; ENST00000412899.5; ENST00000409080.6; ENST00000442250.5; ENST00000264107.11 | ||
| External Link | RMBase: m6A_site_499605 | ||
| mod ID: M6ASITE048029 | Click to Show/Hide the Full List | ||
| mod site | chr2:172469089-172469090:+ | [10] | |
| Sequence | TTTAAAAACAAGGTTTATAGACAAGAATGGGCTACTTTCTT | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HepG2; endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000458358.5; ENST00000442250.5; ENST00000409080.6; ENST00000264107.11; ENST00000409532.5; ENST00000412899.5; ENST00000497107.1 | ||
| External Link | RMBase: m6A_site_499606 | ||
| mod ID: M6ASITE048030 | Click to Show/Hide the Full List | ||
| mod site | chr2:172469124-172469125:+ | [12] | |
| Sequence | TTTCTTCCATCTGCTTGCAGACATGTGCTCACCGATATGAA | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | endometrial | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000497107.1; ENST00000442250.5; ENST00000412899.5; ENST00000409080.6; ENST00000264107.11; ENST00000458358.5; ENST00000409532.5 | ||
| External Link | RMBase: m6A_site_499607 | ||
| mod ID: M6ASITE048031 | Click to Show/Hide the Full List | ||
| mod site | chr2:172469182-172469183:+ | [13] | |
| Sequence | TACGAAGCAGGAATCCCGAGACATCTTTGGGCGGTGTTATG | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | Huh7 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000458358.5; ENST00000442250.5; ENST00000497107.1; ENST00000409080.6; ENST00000412899.5; ENST00000264107.11; ENST00000409532.5 | ||
| External Link | RMBase: m6A_site_499608 | ||
| mod ID: M6ASITE048032 | Click to Show/Hide the Full List | ||
| mod site | chr2:172469332-172469333:+ | [11] | |
| Sequence | AGCAGCTACTTTTACTAAAGACTTTCATTACATTGTATTTG | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa; HEC-1-A | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000442250.5; ENST00000264107.11; ENST00000409080.6; ENST00000497107.1; ENST00000412899.5; ENST00000458358.5; ENST00000409532.5 | ||
| External Link | RMBase: m6A_site_499609 | ||
| mod ID: M6ASITE048033 | Click to Show/Hide the Full List | ||
| mod site | chr2:172469341-172469342:+ | [14] | |
| Sequence | TTTTACTAAAGACTTTCATTACATTGTATTTGGAGCCCCGG | ||
| Motif Score | 2.07285119 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000409532.5; ENST00000442250.5; ENST00000412899.5; ENST00000264107.11; ENST00000409080.6; ENST00000497107.1; ENST00000458358.5 | ||
| External Link | RMBase: m6A_site_499610 | ||
| mod ID: M6ASITE048034 | Click to Show/Hide the Full List | ||
| mod site | chr2:172471000-172471001:+ | [14] | |
| Sequence | TCGTGTAGAGCAAAAGAATAACACTTTTTTTGACATGAACA | ||
| Motif Score | 2.168095238 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000409532.5; ENST00000497107.1; ENST00000412899.5; ENST00000442250.5; ENST00000458358.5; ENST00000264107.11; ENST00000409080.6 | ||
| External Link | RMBase: m6A_site_499611 | ||
| mod ID: M6ASITE048035 | Click to Show/Hide the Full List | ||
| mod site | chr2:172471018-172471019:+ | [11] | |
| Sequence | TAACACTTTTTTTGACATGAACATCTTTGAAGATGGGCCTT | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000442250.5; ENST00000497107.1; ENST00000264107.11; ENST00000409080.6; ENST00000458358.5; ENST00000412899.5; ENST00000409532.5 | ||
| External Link | RMBase: m6A_site_499612 | ||
| mod ID: M6ASITE048036 | Click to Show/Hide the Full List | ||
| mod site | chr2:172471056-172471057:+ | [11] | |
| Sequence | CTTATGAAGTTGGTGGAGAGACTGAGCATGATGAAAGTCTC | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000264107.11; ENST00000409080.6; ENST00000458358.5; ENST00000442250.5; ENST00000497107.1; ENST00000409532.5; ENST00000412899.5 | ||
| External Link | RMBase: m6A_site_499613 | ||
| mod ID: M6ASITE048037 | Click to Show/Hide the Full List | ||
| mod site | chr2:172474162-172474163:+ | [11] | |
| Sequence | CGTGGTTTTGCTGAAGAGAGACATGAAGTCTGCACATCTCC | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000412899.5; ENST00000264107.11; ENST00000442250.5; ENST00000409080.6; ENST00000458358.5; ENST00000409532.5 | ||
| External Link | RMBase: m6A_site_499614 | ||
| mod ID: M6ASITE048038 | Click to Show/Hide the Full List | ||
| mod site | chr2:172474175-172474176:+ | [15] | |
| Sequence | AAGAGAGACATGAAGTCTGCACATCTCCTCCCTGAGCACAT | ||
| Motif Score | 2.830589286 | ||
| Cell/Tissue List | kidney | ||
| Seq Type List | m6A-REF-seq | ||
| Transcript ID List | ENST00000458358.5; ENST00000442250.5; ENST00000412899.5; ENST00000409080.6; ENST00000409532.5; ENST00000264107.11 | ||
| External Link | RMBase: m6A_site_499615 | ||
| mod ID: M6ASITE048039 | Click to Show/Hide the Full List | ||
| mod site | chr2:172474249-172474250:+ | [11] | |
| Sequence | CTATGATGTGGCGGTGGTGGACCTCAACAAGGATGGGTGAG | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000458358.5; ENST00000264107.11; ENST00000442250.5; ENST00000409532.5; ENST00000409080.6; ENST00000412899.5 | ||
| External Link | RMBase: m6A_site_499616 | ||
| mod ID: M6ASITE048040 | Click to Show/Hide the Full List | ||
| mod site | chr2:172474255-172474256:+ | [14] | |
| Sequence | TGTGGCGGTGGTGGACCTCAACAAGGATGGGTGAGAAAGCC | ||
| Motif Score | 2.173910714 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000442250.5; ENST00000409080.6; ENST00000458358.5; ENST00000412899.5; ENST00000264107.11; ENST00000409532.5 | ||
| External Link | RMBase: m6A_site_499617 | ||
| mod ID: M6ASITE048041 | Click to Show/Hide the Full List | ||
| mod site | chr2:172475008-172475009:+ | [11] | |
| Sequence | TGCAGTGTATGTCTACATGAACCAGCAAGGCAGATGGAATA | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000264107.11; ENST00000442250.5; ENST00000409532.5; ENST00000458358.5; ENST00000409080.6 | ||
| External Link | RMBase: m6A_site_499618 | ||
| mod ID: M6ASITE048042 | Click to Show/Hide the Full List | ||
| mod site | chr2:172475055-172475056:+ | [11] | |
| Sequence | AGCCAATTCGTCTTAATGGAACCAAAGATTCTATGTTTGGC | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000264107.11; ENST00000409080.6; ENST00000458358.5; ENST00000409532.5; ENST00000442250.5 | ||
| External Link | RMBase: m6A_site_499619 | ||
| mod ID: M6ASITE048043 | Click to Show/Hide the Full List | ||
| mod site | chr2:172475675-172475676:+ | [11] | |
| Sequence | GCAAATGGAATAAATACCAAACCAACACAGGTAACCAAATA | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000409532.5; ENST00000409080.6; ENST00000458358.5; ENST00000442250.5; ENST00000264107.11 | ||
| External Link | RMBase: m6A_site_499620 | ||
| mod ID: M6ASITE048044 | Click to Show/Hide the Full List | ||
| mod site | chr2:172476440-172476441:+ | [11] | |
| Sequence | TGGATATTCAATTGCTGGAAACATGGACCTTGATCGAAATT | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000442250.5; ENST00000264107.11; ENST00000409080.6; ENST00000409532.5; ENST00000458358.5 | ||
| External Link | RMBase: m6A_site_499621 | ||
| mod ID: M6ASITE048045 | Click to Show/Hide the Full List | ||
| mod site | chr2:172476446-172476447:+ | [11] | |
| Sequence | TTCAATTGCTGGAAACATGGACCTTGATCGAAATTCCTACC | ||
| Motif Score | 3.622404762 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000264107.11; ENST00000409532.5; ENST00000409080.6; ENST00000458358.5; ENST00000442250.5 | ||
| External Link | RMBase: m6A_site_499622 | ||
| mod ID: M6ASITE048046 | Click to Show/Hide the Full List | ||
| mod site | chr2:172479668-172479669:+ | [11] | |
| Sequence | CTGTGATTAATATTCAGAAAACCATCACAGTAACTCCTAAC | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000458358.5; ENST00000442250.5; ENST00000264107.11; ENST00000409080.6; ENST00000409532.5 | ||
| External Link | RMBase: m6A_site_499623 | ||
| mod ID: M6ASITE048047 | Click to Show/Hide the Full List | ||
| mod site | chr2:172479710-172479711:+ | [11] | |
| Sequence | GAATTGACCTCCGCCAGAAAACAGCGTGTGGGGCGCCTAGT | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000409080.6; ENST00000458358.5; ENST00000409532.5; ENST00000264107.11; ENST00000442250.5 | ||
| External Link | RMBase: m6A_site_499624 | ||
| mod ID: M6ASITE048048 | Click to Show/Hide the Full List | ||
| mod site | chr2:172484853-172484854:+ | [11] | |
| Sequence | CTCAAGAGTTCAGTTTCGAAACCAAGGTTCTGAGCCCAAAT | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000442250.5; ENST00000409080.6; ENST00000264107.11; ENST00000409532.5; ENST00000458358.5 | ||
| External Link | RMBase: m6A_site_499625 | ||
| mod ID: M6ASITE048049 | Click to Show/Hide the Full List | ||
| mod site | chr2:172484884-172484885:+ | [11] | |
| Sequence | GAGCCCAAATATACTCAAGAACTAACTCTGAAGAGGCAGAA | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000264107.11; ENST00000409080.6; ENST00000409532.5; ENST00000442250.5; ENST00000458358.5 | ||
| External Link | RMBase: m6A_site_499626 | ||
| mod ID: M6ASITE048050 | Click to Show/Hide the Full List | ||
| mod site | chr2:172484905-172484906:+ | [11] | |
| Sequence | CTAACTCTGAAGAGGCAGAAACAGAAAGTGTGCATGGAGGA | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000442250.5; ENST00000264107.11; ENST00000458358.5; ENST00000409080.6; ENST00000409532.5 | ||
| External Link | RMBase: m6A_site_499627 | ||
| mod ID: M6ASITE048051 | Click to Show/Hide the Full List | ||
| mod site | chr2:172484927-172484928:+ | [11] | |
| Sequence | AGAAAGTGTGCATGGAGGAAACCCTGTGGCTACAGGTGAGG | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000458358.5; ENST00000442250.5; ENST00000409080.6; ENST00000264107.11; ENST00000409532.5 | ||
| External Link | RMBase: m6A_site_499628 | ||
| mod ID: M6ASITE048052 | Click to Show/Hide the Full List | ||
| mod site | chr2:172485137-172485138:+ | [11] | |
| Sequence | CAGGATAATATCAGAGATAAACTGCGTCCCATTCCCATAAC | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000458358.5; ENST00000442250.5; ENST00000264107.11; ENST00000409532.5; ENST00000409080.6 | ||
| External Link | RMBase: m6A_site_499629 | ||
| mod ID: M6ASITE048053 | Click to Show/Hide the Full List | ||
| mod site | chr2:172485242-172485243:+ | [11] | |
| Sequence | CCAATTCTGAATTCAGATGAACCCAAGACAGCTCATATTGA | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000442250.5; ENST00000409532.5; ENST00000409080.6; ENST00000264107.11; ENST00000458358.5 | ||
| External Link | RMBase: m6A_site_499630 | ||
| mod ID: M6ASITE048054 | Click to Show/Hide the Full List | ||
| mod site | chr2:172485249-172485250:+ | [11] | |
| Sequence | TGAATTCAGATGAACCCAAGACAGCTCATATTGATGTAAGT | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000409080.6; ENST00000264107.11; ENST00000442250.5; ENST00000409532.5; ENST00000458358.5 | ||
| External Link | RMBase: m6A_site_499631 | ||
| mod ID: M6ASITE048055 | Click to Show/Hide the Full List | ||
| mod site | chr2:172487053-172487054:+ | [14] | |
| Sequence | AAAAGAGGGATGTGGAGACGACAATGTATGTAACAGCAACC | ||
| Motif Score | 2.865571429 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000409080.6; ENST00000264107.11; ENST00000442250.5; ENST00000409532.5; ENST00000458358.5 | ||
| External Link | RMBase: m6A_site_499632 | ||
| mod ID: M6ASITE048056 | Click to Show/Hide the Full List | ||
| mod site | chr2:172487078-172487079:+ | [11] | |
| Sequence | GTATGTAACAGCAACCTTAAACTAGAATATAAATTTTGCAC | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000409532.5; ENST00000442250.5; ENST00000409080.6; ENST00000264107.11; ENST00000458358.5 | ||
| External Link | RMBase: m6A_site_499633 | ||
| mod ID: M6ASITE048057 | Click to Show/Hide the Full List | ||
| mod site | chr2:172487116-172487117:+ | [11] | |
| Sequence | CACCCGAGAAGGAAATCAAGACAAATTTTCTTATTTACCAA | ||
| Motif Score | 2.897386905 | ||
| Cell/Tissue List | HeLa; hESC-HEK293T | ||
| Seq Type List | m6A-seq; MAZTER-seq | ||
| Transcript ID List | ENST00000264107.11; ENST00000458358.5; ENST00000409532.5; ENST00000442250.5; ENST00000409080.6 | ||
| External Link | RMBase: m6A_site_499634 | ||
| mod ID: M6ASITE048058 | Click to Show/Hide the Full List | ||
| mod site | chr2:172487281-172487282:+ | [11] | |
| Sequence | AGTCAAAAAGGTGTACCAGAACTAGTTCTAAAAGATCAGAA | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa; Huh7 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000264107.11; ENST00000409532.5; ENST00000409080.6; ENST00000458358.5; ENST00000442250.5 | ||
| External Link | RMBase: m6A_site_499635 | ||
| mod ID: M6ASITE048059 | Click to Show/Hide the Full List | ||
| mod site | chr2:172487321-172487322:+ | [15] | |
| Sequence | AGGATATTGCTTTAGAAATAACAGTGACAAACAGCCCTTCC | ||
| Motif Score | 2.168095238 | ||
| Cell/Tissue List | kidney | ||
| Seq Type List | m6A-REF-seq | ||
| Transcript ID List | ENST00000442250.5; ENST00000264107.11; ENST00000458358.5; ENST00000409080.6; ENST00000409532.5 | ||
| External Link | RMBase: m6A_site_499636 | ||
| mod ID: M6ASITE048060 | Click to Show/Hide the Full List | ||
| mod site | chr2:172487331-172487332:+ | [11] | |
| Sequence | TTTAGAAATAACAGTGACAAACAGCCCTTCCAACCCAAGGA | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa; Huh7 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000409532.5; ENST00000264107.11; ENST00000458358.5; ENST00000409080.6; ENST00000442250.5 | ||
| External Link | RMBase: m6A_site_499637 | ||
| mod ID: M6ASITE048061 | Click to Show/Hide the Full List | ||
| mod site | chr2:172489491-172489492:+ | [11] | |
| Sequence | TATTTTCTAACAGGTAATAAACTTAGGTAAACCTCTTACAA | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000264107.11; ENST00000458358.5; ENST00000416789.1; ENST00000409532.5; ENST00000469534.1; ENST00000409080.6; ENST00000442250.5 | ||
| External Link | RMBase: m6A_site_499638 | ||
| mod ID: M6ASITE048062 | Click to Show/Hide the Full List | ||
| mod site | chr2:172489501-172489502:+ | [11] | |
| Sequence | CAGGTAATAAACTTAGGTAAACCTCTTACAAACCTCGGCAC | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000442250.5; ENST00000416789.1; ENST00000409080.6; ENST00000409532.5; ENST00000458358.5; ENST00000264107.11; ENST00000469534.1 | ||
| External Link | RMBase: m6A_site_499639 | ||
| mod ID: M6ASITE048063 | Click to Show/Hide the Full List | ||
| mod site | chr2:172489512-172489513:+ | [11] | |
| Sequence | CTTAGGTAAACCTCTTACAAACCTCGGCACAGCAACCTTGA | ||
| Motif Score | 2.185083333 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000416789.1; ENST00000409532.5; ENST00000442250.5; ENST00000458358.5; ENST00000264107.11; ENST00000469534.1; ENST00000409080.6 | ||
| External Link | RMBase: m6A_site_499640 | ||
| mod ID: M6ASITE048064 | Click to Show/Hide the Full List | ||
| mod site | chr2:172489533-172489534:+ | [11] | |
| Sequence | CCTCGGCACAGCAACCTTGAACATTCAGTGGCCAAAAGAAA | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000458358.5; ENST00000409532.5; ENST00000469534.1; ENST00000416789.1; ENST00000264107.11; ENST00000409080.6; ENST00000442250.5 | ||
| External Link | RMBase: m6A_site_499641 | ||
| mod ID: M6ASITE048065 | Click to Show/Hide the Full List | ||
| mod site | chr2:172489641-172489642:+ | [11] | |
| Sequence | TGAGCCACAAAAGGAGATAAACTCCCTGAACCTAACGGTAT | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000442250.5; ENST00000409532.5; ENST00000458358.5; ENST00000416789.1; ENST00000264107.11; ENST00000469534.1; ENST00000409080.6 | ||
| External Link | RMBase: m6A_site_499642 | ||
| mod ID: M6ASITE048066 | Click to Show/Hide the Full List | ||
| mod site | chr2:172489706-172489707:+ | [13] | |
| Sequence | CATAAATGCAAATTAGAGAAACTAACTTGTTAGGGGAAAAT | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | Huh7 | ||
| Seq Type List | MeRIP-seq | ||
| Transcript ID List | ENST00000264107.11; ENST00000409080.6; ENST00000469534.1; ENST00000442250.5; ENST00000416789.1; ENST00000458358.5; ENST00000409532.5 | ||
| External Link | RMBase: m6A_site_499643 | ||
| mod ID: M6ASITE048067 | Click to Show/Hide the Full List | ||
| mod site | chr2:172491116-172491117:+ | [11] | |
| Sequence | TTGCTGAAAGAAAATACCAGACTCTTGTAAGTATTTTTCAA | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000409532.5; ENST00000470259.1; ENST00000458358.5; ENST00000442250.5; ENST00000416789.1; ENST00000475302.1; ENST00000264107.11; ENST00000409080.6 | ||
| External Link | RMBase: m6A_site_499644 | ||
| mod ID: M6ASITE048068 | Click to Show/Hide the Full List | ||
| mod site | chr2:172491239-172491240:+ | [11] | |
| Sequence | GAACTGTAGCGTGAACGTGAACTGTGTGAACATCAGATGCC | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000442250.5; ENST00000416789.1; ENST00000458358.5; ENST00000264107.11; ENST00000409080.6; ENST00000475302.1; ENST00000409532.5; ENST00000470259.1 | ||
| External Link | RMBase: m6A_site_499645 | ||
| mod ID: M6ASITE048069 | Click to Show/Hide the Full List | ||
| mod site | chr2:172491248-172491249:+ | [11] | |
| Sequence | CGTGAACGTGAACTGTGTGAACATCAGATGCCCGCTGCGGG | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000458358.5; ENST00000416789.1; ENST00000442250.5; ENST00000475302.1; ENST00000409080.6; ENST00000264107.11; ENST00000470259.1; ENST00000409532.5 | ||
| External Link | RMBase: m6A_site_499646 | ||
| mod ID: M6ASITE048070 | Click to Show/Hide the Full List | ||
| mod site | chr2:172491275-172491276:+ | [11] | |
| Sequence | ATGCCCGCTGCGGGGGCTGGACAGCAAGGCGTCTCTTATTT | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000409080.6; ENST00000442250.5; ENST00000409532.5; ENST00000416789.1; ENST00000458358.5; ENST00000475302.1; ENST00000264107.11 | ||
| External Link | RMBase: m6A_site_499647 | ||
| mod ID: M6ASITE048071 | Click to Show/Hide the Full List | ||
| mod site | chr2:172491314-172491315:+ | [11] | |
| Sequence | TTTGCGCTCGAGGTTATGGAACAGCACATTTCTAGAGGTAT | ||
| Motif Score | 2.951386905 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000409080.6; ENST00000458358.5; ENST00000264107.11; ENST00000442250.5; ENST00000409532.5; ENST00000416789.1; ENST00000475302.1 | ||
| External Link | RMBase: m6A_site_499648 | ||
| mod ID: M6ASITE048072 | Click to Show/Hide the Full List | ||
| mod site | chr2:172491435-172491436:+ | [11] | |
| Sequence | TCCAAACAGGAATATTCCAAACTGAACTACTTGGACATTCT | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000409532.5; ENST00000475302.1; ENST00000458358.5; ENST00000442250.5; ENST00000409080.6; ENST00000416789.1; ENST00000264107.11 | ||
| External Link | RMBase: m6A_site_499649 | ||
| mod ID: M6ASITE048073 | Click to Show/Hide the Full List | ||
| mod site | chr2:172491440-172491441:+ | [11] | |
| Sequence | ACAGGAATATTCCAAACTGAACTACTTGGACATTCTCATGC | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000458358.5; ENST00000264107.11; ENST00000475302.1; ENST00000409532.5; ENST00000416789.1; ENST00000442250.5; ENST00000409080.6 | ||
| External Link | RMBase: m6A_site_499650 | ||
| mod ID: M6ASITE048074 | Click to Show/Hide the Full List | ||
| mod site | chr2:172491449-172491450:+ | [11] | |
| Sequence | TTCCAAACTGAACTACTTGGACATTCTCATGCGAGCCTTCA | ||
| Motif Score | 3.643047619 | ||
| Cell/Tissue List | HeLa | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000409532.5; ENST00000442250.5; ENST00000264107.11; ENST00000409080.6; ENST00000475302.1; ENST00000416789.1; ENST00000458358.5 | ||
| External Link | RMBase: m6A_site_499651 | ||
| mod ID: M6ASITE048075 | Click to Show/Hide the Full List | ||
| mod site | chr2:172504209-172504210:+ | [11] | |
| Sequence | ATTGATAACCTTGAAAAAAAACAGTGGATCACAAAGTGGAA | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | HeLa; HEK293T; kidney; HepG2; U2OS; hNPCs; hESCs; fibroblasts; A549; Huh7; TIME; TREX; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq; m6A-REF-seq | ||
| Transcript ID List | ENST00000416789.1; ENST00000264107.11; ENST00000409080.6; ENST00000409532.5; ENST00000458358.5; ENST00000442250.5 | ||
| External Link | RMBase: m6A_site_499658 | ||
| mod ID: M6ASITE048076 | Click to Show/Hide the Full List | ||
| mod site | chr2:172504288-172504289:+ | [11] | |
| Sequence | AAAAGCTTCACAGTACCCAAACTGCTTTTTCCAACTCAGAA | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; U2OS; H1A; hNPCs; hESCs; fibroblasts; H1299; Huh7; Jurkat; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; TIME; TREX; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000409532.5; ENST00000409080.6; ENST00000264107.11; ENST00000416789.1 | ||
| External Link | RMBase: m6A_site_499659 | ||
| mod ID: M6ASITE048077 | Click to Show/Hide the Full List | ||
| mod site | chr2:172504347-172504348:+ | [11] | |
| Sequence | AGCCTGCTCAATCCCTGAGGACTGATTTCAGAGTGACTACA | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; CD8T; H1299; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq; m6A-CLIP/IP | ||
| Transcript ID List | ENST00000409532.5; ENST00000409080.6; ENST00000264107.11 | ||
| External Link | RMBase: m6A_site_499660 | ||
| mod ID: M6ASITE048078 | Click to Show/Hide the Full List | ||
| mod site | chr2:172504362-172504363:+ | [16] | |
| Sequence | TGAGGACTGATTTCAGAGTGACTACACACAGTACGAACCTA | ||
| Motif Score | 3.28175 | ||
| Cell/Tissue List | CD8T | ||
| Seq Type List | m6A-CLIP/IP | ||
| Transcript ID List | ENST00000409080.6; ENST00000264107.11; ENST00000409532.5 | ||
| External Link | RMBase: m6A_site_499661 | ||
| mod ID: M6ASITE048079 | Click to Show/Hide the Full List | ||
| mod site | chr2:172504365-172504366:+ | [14] | |
| Sequence | GGACTGATTTCAGAGTGACTACACACAGTACGAACCTACAG | ||
| Motif Score | 2.078666667 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000409080.6; ENST00000264107.11; ENST00000409532.5 | ||
| External Link | RMBase: m6A_site_499662 | ||
| mod ID: M6ASITE048080 | Click to Show/Hide the Full List | ||
| mod site | chr2:172504378-172504379:+ | [11] | |
| Sequence | AGTGACTACACACAGTACGAACCTACAGTTTTAACTGTGGA | ||
| Motif Score | 2.930744048 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; H1299; Huh7; Jurkat; CD4T; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; endometrial; HEC-1-A; GSCs; NB4 | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000264107.11; ENST00000409080.6; ENST00000409532.5 | ||
| External Link | RMBase: m6A_site_499663 | ||
| mod ID: M6ASITE048081 | Click to Show/Hide the Full List | ||
| mod site | chr2:172504446-172504447:+ | [11] | |
| Sequence | TTTGCACAGCCAAATTTAAAACTGTTGGAATGGATTTTTCT | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; U2OS; H1A; H1B; hNPCs; hESCs; fibroblasts; CD8T; H1299; Huh7; Jurkat; peripheral-blood; GSC-11; HEK293A-TOA; iSLK; MSC; TIME; TREX; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq; m6A-CLIP/IP | ||
| Transcript ID List | ENST00000264107.11; ENST00000409532.5; ENST00000409080.6 | ||
| External Link | RMBase: m6A_site_499664 | ||
| mod ID: M6ASITE048082 | Click to Show/Hide the Full List | ||
| mod site | chr2:172504484-172504485:+ | [16] | |
| Sequence | TCTTTAACTGCCGTAATTTAACTTTCTGGGTTGCCTTTATT | ||
| Motif Score | 2.590089286 | ||
| Cell/Tissue List | A549 | ||
| Seq Type List | m6A-CLIP/IP | ||
| Transcript ID List | ENST00000409532.5; ENST00000264107.11; ENST00000409080.6 | ||
| External Link | RMBase: m6A_site_499665 | ||
| mod ID: M6ASITE048083 | Click to Show/Hide the Full List | ||
| mod site | chr2:172504680-172504681:+ | [14] | |
| Sequence | CACGTTAGCTGTCCCACATCACAAGACTATGCCATTGGGGT | ||
| Motif Score | 2.047297619 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000264107.11; ENST00000409080.6 | ||
| External Link | RMBase: m6A_site_499666 | ||
| mod ID: M6ASITE048084 | Click to Show/Hide the Full List | ||
| mod site | chr2:172504685-172504686:+ | [11] | |
| Sequence | TAGCTGTCCCACATCACAAGACTATGCCATTGGGGTAGTTG | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | HeLa; HepG2; HEK293T; A549; U2OS; fibroblasts; H1299; Huh7; Jurkat; iSLK; TIME; TREX; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000264107.11; ENST00000409080.6 | ||
| External Link | RMBase: m6A_site_499667 | ||
| mod ID: M6ASITE048085 | Click to Show/Hide the Full List | ||
| mod site | chr2:172504732-172504733:+ | [11] | |
| Sequence | AACGGAAAGTGCTGTCTTAAACTAAATGTGCAATAGAAGGT | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | HeLa; HEK293T; A549; HepG2; U2OS; H1299; Huh7; iSLK; TIME; TREX; endometrial; HEC-1-A | ||
| Seq Type List | m6A-seq; MeRIP-seq | ||
| Transcript ID List | ENST00000409080.6; ENST00000264107.11 | ||
| External Link | RMBase: m6A_site_499668 | ||
| mod ID: M6ASITE048086 | Click to Show/Hide the Full List | ||
| mod site | chr2:172504820-172504821:+ | [14] | |
| Sequence | CCTGCTCACGTCAAATGCATACAAGTTTCATTCTCCCTTTC | ||
| Motif Score | 2.110482143 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000264107.11; ENST00000409080.6 | ||
| External Link | RMBase: m6A_site_499669 | ||
| mod ID: M6ASITE048087 | Click to Show/Hide the Full List | ||
| mod site | chr2:172505239-172505240:+ | [14] | |
| Sequence | TTTCTGGATTTCATACTGTAACATTCAGGAATTCTTGGAGA | ||
| Motif Score | 2.168095238 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000264107.11; ENST00000409080.6 | ||
| External Link | RMBase: m6A_site_499670 | ||
| mod ID: M6ASITE048088 | Click to Show/Hide the Full List | ||
| mod site | chr2:172505279-172505280:+ | [17] | |
| Sequence | AAAATGGGTTTATTCACTGAACTCTAGTGCGGTTTACTCAC | ||
| Motif Score | 3.373380952 | ||
| Cell/Tissue List | A549 | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000264107.11; ENST00000409080.6 | ||
| External Link | RMBase: m6A_site_499671 | ||
| mod ID: M6ASITE048089 | Click to Show/Hide the Full List | ||
| mod site | chr2:172505324-172505325:+ | [17] | |
| Sequence | GCAAATACTGTATATTCAGGACTTGAAAGAAATGGTGAATG | ||
| Motif Score | 4.065041667 | ||
| Cell/Tissue List | hNPCs; A549 | ||
| Seq Type List | m6A-seq; m6A-CLIP/IP | ||
| Transcript ID List | ENST00000264107.11; ENST00000409080.6 | ||
| External Link | RMBase: m6A_site_499672 | ||
| mod ID: M6ASITE048090 | Click to Show/Hide the Full List | ||
| mod site | chr2:172505361-172505362:+ | [17] | |
| Sequence | AATGCCTATGGTGGATCCAAACTGATCCAGTATAAGACTAC | ||
| Motif Score | 2.627720238 | ||
| Cell/Tissue List | hNPCs | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000409080.6; ENST00000264107.11 | ||
| External Link | RMBase: m6A_site_499673 | ||
| mod ID: M6ASITE048091 | Click to Show/Hide the Full List | ||
| mod site | chr2:172505377-172505378:+ | [17] | |
| Sequence | CCAAACTGATCCAGTATAAGACTACTGAATCTGCTACCAAA | ||
| Motif Score | 3.319380952 | ||
| Cell/Tissue List | hNPCs | ||
| Seq Type List | m6A-seq | ||
| Transcript ID List | ENST00000264107.11; ENST00000409080.6 | ||
| External Link | RMBase: m6A_site_499674 | ||
| mod ID: M6ASITE048092 | Click to Show/Hide the Full List | ||
| mod site | chr2:172505602-172505603:+ | [14] | |
| Sequence | TTTTTTAATTACCATGCTTCACAATGTTAAGTTATATGGGG | ||
| Motif Score | 2.047297619 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000264107.11; ENST00000409080.6 | ||
| External Link | RMBase: m6A_site_499675 | ||
| mod ID: M6ASITE048093 | Click to Show/Hide the Full List | ||
| mod site | chr2:172505627-172505628:+ | [15] | |
| Sequence | GTTAAGTTATATGGGGAGCAACAGCAAACAGGTGCTAATTT | ||
| Motif Score | 2.173910714 | ||
| Cell/Tissue List | kidney | ||
| Seq Type List | m6A-REF-seq | ||
| Transcript ID List | ENST00000409080.6; ENST00000264107.11 | ||
| External Link | RMBase: m6A_site_499676 | ||
| mod ID: M6ASITE048094 | Click to Show/Hide the Full List | ||
| mod site | chr2:172506015-172506016:+ | [14] | |
| Sequence | GAGGGTGGTTCAACAAAGAAACAAAGATGTTATGGTGTTTA | ||
| Motif Score | 2.20572619 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000264107.11; ENST00000409080.6 | ||
| External Link | RMBase: m6A_site_499677 | ||
| mod ID: M6ASITE048095 | Click to Show/Hide the Full List | ||
| mod site | chr2:172506095-172506096:+ | [14] | |
| Sequence | CTGGTCTGTTTGCATTTGATACATTTTTGTACTAACTAGCA | ||
| Motif Score | 2.110482143 | ||
| Cell/Tissue List | hESC-HEK293T | ||
| Seq Type List | MAZTER-seq | ||
| Transcript ID List | ENST00000409080.6; ENST00000264107.11 | ||
| External Link | RMBase: m6A_site_499678 | ||
References





