m6A Target Gene Information

General Information of the m6A Target Gene (ID: M6ATAR00290)

Target Name	Interferon beta (IFNB1)
Synonyms	IFN-beta; Fibroblast interferon; IFB; IFNB Click to Show/Hide
Gene Name	IFNB1
Chromosomal Location	9p21.3
Family	alpha/beta interferon family
Function	Has antiviral, antibacterial and anticancer activities. Click to Show/Hide
Gene ID	3456
Uniprot ID	IFNB_HUMAN
HGNC ID	HGNC:5434
KEGG ID	hsa:3456

Full List of m6A Methylation Regulator of This Target Gene and Corresponding Disease/Drug Response(s)

IFNB1 can be regulated by the following regulator(s), and cause disease/drug response(s). You can browse detail information of regulator(s) or disease/drug response(s).

Browse Regulator

Browse Disease

Methyltransferase-like 14 (METTL14) [WRITER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by METTL14*
Cell Line	Neural progenitor cell line	Mus musculus
Treatment: METTL14 knockout NPCs Control: Wild type NPCs		GSE158985
Regulation		logFC: 7.66E-01 p-value: 2.22E-04
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	Responses to nonmicrobial dsDNA in uninfected cells, which shape host immunity and contribute to autoimmune disease, are regulated by enzymes controlling m6A epitranscriptomic changes. While METTL14 depletion reduced virus reproduction and stimulated dsDNA- or HCMV-induced Interferon beta (IFNB1) mRNA accumulation, ALKBH5 depletion had the opposite effect.
Target Regulation	Down regulation
Responsed Disease	Unspecified viral infection		ICD-11: 1D9Z	Disease Info
Pathway Response	Cellular senescence			hsa04218
Cell Process	Metabolic reprogramming
	Stress responses
	Aging
In-vitro Model	BSC40	Normal	Chlorocebus pygerythrus	CVCL_3656
	HCMV AD169GFP (Human cytomegalovirus)
	NHDF (Primary Normal Human Dermal Fibroblasts)
	Vero	Normal	Chlorocebus sabaeus	CVCL_0059

RNA demethylase ALKBH5 (ALKBH5) [ERASER]

Regulator Info

*Representative RNA-seq result indicating the expression of this target gene regulated by ALKBH5*
Cell Line	Peritoneal macrophages	Mus musculus
Treatment: ALKBH5-/- peritoneal macrophages Control: Wild type peritoneal macrophages		GSE127739
Regulation		logFC: -6.45E-01 p-value: 8.14E-03
More Results	Click to View More RNA-seq Results

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[1]
Response Summary	Responses to nonmicrobial dsDNA in uninfected cells, which shape host immunity and contribute to autoimmune disease, are regulated by enzymes controlling m6A epitranscriptomic changes. While METTL14 depletion reduced virus reproduction and stimulated dsDNA- or HCMV-induced Interferon beta (IFNB1) mRNA accumulation, ALKBH5 depletion had the opposite effect.
Target Regulation	Up regulation
Responsed Disease	Unspecified viral infection		ICD-11: 1D9Z	Disease Info
Pathway Response	Cellular senescence			hsa04218
Cell Process	Metabolic reprogramming
	Stress responses
	Aging
In-vitro Model	BSC40	Normal	Chlorocebus pygerythrus	CVCL_3656
	HCMV AD169GFP (Human cytomegalovirus)
	NHDF (Primary Normal Human Dermal Fibroblasts)
	Vero	Normal	Chlorocebus sabaeus	CVCL_0059

Heterogeneous nuclear ribonucleoproteins C1/C2 (HNRNPC) [READER]

Regulator Info

In total 1 item(s) under this regulator
Experiment 1 Reporting the m6A Methylation Regulator of This Target Gene				[2]
Response Summary	Overexpression of HNRNPC can promote the proliferation of PC12 cells, inhibit their apoptosis, and inhibit the expression of inflammatory factors Interferon beta (IFNB1), IL-6, and TNF-Alpha, suggesting that HNRNPC can cause PD by inhibiting the proliferation of dopaminergic nerve cells, promoting their apoptosis, and causing immune inflammation.
Target Regulation	Down regulation
Responsed Disease	Parkinson disease		ICD-11: 8A00	Disease Info
Cell Process	Immune inflammation
	Cell apoptosis
In-vitro Model	PC12	Rat adrenal gland pheochromocytoma	Rattus norvegicus	CVCL_0481

Papillomaviruses [ICD-11: 1D9Z]

Disease Info

In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	Responses to nonmicrobial dsDNA in uninfected cells, which shape host immunity and contribute to autoimmune disease, are regulated by enzymes controlling m6A epitranscriptomic changes. While METTL14 depletion reduced virus reproduction and stimulated dsDNA- or HCMV-induced Interferon beta (IFNB1) mRNA accumulation, ALKBH5 depletion had the opposite effect.
Responsed Disease	Unspecified viral infection [ICD-11: 1D9Z]
Target Regulator	Methyltransferase-like 14 (METTL14)		WRITER	Regulator Info
Target Regulation	Down regulation
Pathway Response	Cellular senescence			hsa04218
Cell Process	Metabolic reprogramming
	Stress responses
	Aging
In-vitro Model	BSC40	Normal	Chlorocebus pygerythrus	CVCL_3656
	HCMV AD169GFP (Human cytomegalovirus)
	NHDF (Primary Normal Human Dermal Fibroblasts)
	Vero	Normal	Chlorocebus sabaeus	CVCL_0059
Experiment 2 Reporting the m6A-centered Disease Response				[1]
Response Summary	Responses to nonmicrobial dsDNA in uninfected cells, which shape host immunity and contribute to autoimmune disease, are regulated by enzymes controlling m6A epitranscriptomic changes. While METTL14 depletion reduced virus reproduction and stimulated dsDNA- or HCMV-induced Interferon beta (IFNB1) mRNA accumulation, ALKBH5 depletion had the opposite effect.
Responsed Disease	Unspecified viral infection [ICD-11: 1D9Z]
Target Regulator	RNA demethylase ALKBH5 (ALKBH5)		ERASER	Regulator Info
Target Regulation	Up regulation
Pathway Response	Cellular senescence			hsa04218
Cell Process	Metabolic reprogramming
	Stress responses
	Aging
In-vitro Model	BSC40	Normal	Chlorocebus pygerythrus	CVCL_3656
	HCMV AD169GFP (Human cytomegalovirus)
	NHDF (Primary Normal Human Dermal Fibroblasts)
	Vero	Normal	Chlorocebus sabaeus	CVCL_0059

Innate immunity [ICD-11: 4A00]

Disease Info

In total 2 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[1]
Response Summary	Responses to nonmicrobial dsDNA in uninfected cells, which shape host immunity and contribute to autoimmune disease, are regulated by enzymes controlling m6A epitranscriptomic changes. While METTL14 depletion reduced virus reproduction and stimulated dsDNA- or HCMV-induced Interferon beta (IFNB1) mRNA accumulation, ALKBH5 depletion had the opposite effect.
Responsed Disease	Innate immunity [ICD-11: 4A00]
Target Regulator	Methyltransferase-like 14 (METTL14)		WRITER	Regulator Info
Target Regulation	Down regulation
Pathway Response	Cellular senescence			hsa04218
Cell Process	Metabolic reprogramming
	Stress responses
	Aging
In-vitro Model	BSC40	Normal	Chlorocebus pygerythrus	CVCL_3656
	HCMV AD169GFP (Human cytomegalovirus)
	NHDF (Primary Normal Human Dermal Fibroblasts)
	Vero	Normal	Chlorocebus sabaeus	CVCL_0059
Experiment 2 Reporting the m6A-centered Disease Response				[1]
Response Summary	Responses to nonmicrobial dsDNA in uninfected cells, which shape host immunity and contribute to autoimmune disease, are regulated by enzymes controlling m6A epitranscriptomic changes. While METTL14 depletion reduced virus reproduction and stimulated dsDNA- or HCMV-induced Interferon beta (IFNB1) mRNA accumulation, ALKBH5 depletion had the opposite effect.
Responsed Disease	Innate immunity [ICD-11: 4A00]
Target Regulator	RNA demethylase ALKBH5 (ALKBH5)		ERASER	Regulator Info
Target Regulation	Up regulation
Pathway Response	Cellular senescence			hsa04218
Cell Process	Metabolic reprogramming
	Stress responses
	Aging
In-vitro Model	BSC40	Normal	Chlorocebus pygerythrus	CVCL_3656
	HCMV AD169GFP (Human cytomegalovirus)
	NHDF (Primary Normal Human Dermal Fibroblasts)
	Vero	Normal	Chlorocebus sabaeus	CVCL_0059

Parkinson disease [ICD-11: 8A00]

Disease Info

In total 1 item(s) under this disease
Experiment 1 Reporting the m6A-centered Disease Response				[2]
Response Summary	Overexpression of HNRNPC can promote the proliferation of PC12 cells, inhibit their apoptosis, and inhibit the expression of inflammatory factors Interferon beta (IFNB1), IL-6, and TNF-Alpha, suggesting that HNRNPC can cause PD by inhibiting the proliferation of dopaminergic nerve cells, promoting their apoptosis, and causing immune inflammation.
Responsed Disease	Parkinson disease [ICD-11: 8A00]
Target Regulator	Heterogeneous nuclear ribonucleoproteins C1/C2 (HNRNPC)		READER	Regulator Info
Target Regulation	Down regulation
Cell Process	Immune inflammation
	Cell apoptosis
In-vitro Model	PC12	Rat adrenal gland pheochromocytoma	Rattus norvegicus	CVCL_0481

RNA Modification Sequencing Data Associated with the Target (ID: M6ATAR00290)

Interferon beta (IFNB1)

N6-methyladenosine (m6A)

In total 17 m6A sequence/site(s) in this target gene
mod ID: M6ASITE087721		Click to Show/Hide the Full List
mod site	chr9:21077199-21077200:-		[4]
Sequence	AATGTACTGCATATGAAAGGACACTAGAAGATTTTGAAATT
Motif Score	3.643047619
Cell/Tissue List	A549; Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000380232.4
External Link	RMBase: m6A_site_817468
mod ID: M6ASITE087722		Click to Show/Hide the Full List
mod site	chr9:21077274-21077275:-		[4]
Sequence	GCCTGTGCCTCTGGGACTGGACAATTGCTTCAAGCATTCTT
Motif Score	3.643047619
Cell/Tissue List	A549; Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000380232.4
External Link	RMBase: m6A_site_817469
mod ID: M6ASITE087723		Click to Show/Hide the Full List
mod site	chr9:21077279-21077280:-		[4]
Sequence	TCCTAGCCTGTGCCTCTGGGACTGGACAATTGCTTCAAGCA
Motif Score	4.065041667
Cell/Tissue List	A549; Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000380232.4
External Link	RMBase: m6A_site_817470
mod ID: M6ASITE087724		Click to Show/Hide the Full List
mod site	chr9:21077309-21077310:-		[4]
Sequence	ACTTACAGGTTACCTCCGAAACTGAAGATCTCCTAGCCTGT
Motif Score	2.627720238
Cell/Tissue List	A549; Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000380232.4
External Link	RMBase: m6A_site_817471
mod ID: M6ASITE087725		Click to Show/Hide the Full List
mod site	chr9:21077329-21077330:-		[4]
Sequence	AACTTTTACTTCATTAACAGACTTACAGGTTACCTCCGAAA
Motif Score	3.319380952
Cell/Tissue List	A549; Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000380232.4
External Link	RMBase: m6A_site_817472
mod ID: M6ASITE087726		Click to Show/Hide the Full List
mod site	chr9:21077348-21077349:-		[4]
Sequence	CAGAGTGGAAATCCTAAGGAACTTTTACTTCATTAACAGAC
Motif Score	3.373380952
Cell/Tissue List	A549
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000380232.4
External Link	RMBase: m6A_site_817473
mod ID: M6ASITE087727		Click to Show/Hide the Full List
mod site	chr9:21077376-21077377:-		[4]
Sequence	AGTACAGTCACTGTGCCTGGACCATAGTCAGAGTGGAAATC
Motif Score	3.622404762
Cell/Tissue List	A549
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000380232.4
External Link	RMBase: m6A_site_817474
mod ID: M6ASITE087728		Click to Show/Hide the Full List
mod site	chr9:21077461-21077462:-		[4]
Sequence	GAAGATTTCACCAGGGGAAAACTCATGAGCAGTCTGCACCT
Motif Score	2.627720238
Cell/Tissue List	A549
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000380232.4
External Link	RMBase: m6A_site_817475
mod ID: M6ASITE087729		Click to Show/Hide the Full List
mod site	chr9:21077491-21077492:-		[4]
Sequence	AAGACAGTCCTGGAAGAAAAACTGGAGAAAGAAGATTTCAC
Motif Score	2.627720238
Cell/Tissue List	A549
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000380232.4
External Link	RMBase: m6A_site_817476
mod ID: M6ASITE087730		Click to Show/Hide the Full List
mod site	chr9:21077508-21077509:-		[4]
Sequence	ATCAGATAAACCATCTGAAGACAGTCCTGGAAGAAAAACTG
Motif Score	2.897386905
Cell/Tissue List	A549
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000380232.4
External Link	RMBase: m6A_site_817477
mod ID: M6ASITE087731		Click to Show/Hide the Full List
mod site	chr9:21077519-21077520:-		[4]
Sequence	TAATGTCTATCATCAGATAAACCATCTGAAGACAGTCCTGG
Motif Score	2.185083333
Cell/Tissue List	A549
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000380232.4
External Link	RMBase: m6A_site_817478
mod ID: M6ASITE087732		Click to Show/Hide the Full List
mod site	chr9:21077549-21077550:-		[4]
Sequence	GAATGAGACTATTGTTGAGAACCTCCTGGCTAATGTCTATC
Motif Score	2.930744048
Cell/Tissue List	A549
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000380232.4
External Link	RMBase: m6A_site_817479
mod ID: M6ASITE087733		Click to Show/Hide the Full List
mod site	chr9:21077562-21077563:-		[4]
Sequence	CTAGCACTGGCTGGAATGAGACTATTGTTGAGAACCTCCTG
Motif Score	3.319380952
Cell/Tissue List	A549
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000380232.4
External Link	RMBase: m6A_site_817480
mod ID: M6ASITE087734		Click to Show/Hide the Full List
mod site	chr9:21077593-21077594:-		[4]
Sequence	AACATCTTTGCTATTTTCAGACAAGATTCATCTAGCACTGG
Motif Score	2.897386905
Cell/Tissue List	A549; Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000380232.4
External Link	RMBase: m6A_site_817481
mod ID: M6ASITE087735		Click to Show/Hide the Full List
mod site	chr9:21077612-21077613:-		[4]
Sequence	CATCTATGAGATGCTCCAGAACATCTTTGCTATTTTCAGAC
Motif Score	2.951386905
Cell/Tissue List	A549; Huh7
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000380232.4
External Link	RMBase: m6A_site_817482
mod ID: M6ASITE087736		Click to Show/Hide the Full List
mod site	chr9:21077696-21077697:-		[4]
Sequence	CTGCCTCAAGGACAGGATGAACTTTGACATCCCTGAGGAGA
Motif Score	3.373380952
Cell/Tissue List	A549
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000380232.4
External Link	RMBase: m6A_site_817483
mod ID: M6ASITE087737		Click to Show/Hide the Full List
mod site	chr9:21077705-21077706:-		[4]
Sequence	GCTTGAATACTGCCTCAAGGACAGGATGAACTTTGACATCC
Motif Score	3.643047619
Cell/Tissue List	A549
Seq Type List	MeRIP-seq
Transcript ID List	ENST00000380232.4
External Link	RMBase: m6A_site_817484

Ref 1	RNA m(6) A modification enzymes shape innate responses to DNA by regulating interferon Beta. Genes Dev. 2018 Dec 1;32(23-24):1472-1484. doi: 10.1101/gad.319475.118. Epub 2018 Nov 21.
Ref 2	Influence of N6-Methyladenosine Modification Gene HNRNPC on Cell Phenotype in Parkinson's Disease. Parkinsons Dis. 2021 Dec 20;2021:9919129. doi: 10.1155/2021/9919129. eCollection 2021.
Ref 3	Efflux ratio cannot assess P-glycoprotein-mediated attenuation of absorptive transport: asymmetric effect of P-glycoprotein on absorptive and secretory transport across Caco-2 cell monolayers. Pharm Res. 2003 Aug;20(8):1200-9. doi: 10.1023/a:1025049014674.
Ref 4	Viral N(6)-methyladenosine upregulates replication and pathogenesis of human respiratory syncytial virus. Nat Commun. 2019 Oct 9;10(1):4595. doi: 10.1038/s41467-019-12504-y.

m6A Target Gene Information

Cite M6AREG

Correspondence

Prof. Feng ZHU

Prof. Shuiping Liu

Visitor Map